Search Results

Search found 3880 results on 156 pages for 'extended ascii'.

Page 139/156 | < Previous Page | 135 136 137 138 139 140 141 142 143 144 145 146  | Next Page >

  • File sizing issue in DOS/FAT

    - by Heather
    I've been tasked with writing a data collection program for a Unitech HT630, which runs a proprietary DOS operating system that can run executables compiled for 16-bit MS DOS with some restrictions. I'm using the Digital Mars C/C++ compiler, which is working well thus far. One of the application requirements is that the data file must be human-readable plain text, meaning the file can be imported into Excel or opened by Notepad. I'm using a variable length record format much like CSV that I've successfully implemented using the C standard library file I/O functions. When saving a record, I have to calculate whether the updated record is larger or smaller than the version of the record currently in the data file. If larger, I first shift all records immediately after the current record forward by the size difference calculated before saving the updated record. EOF is extended automatically by the OS to accommodate the extra data. If smaller, I shift all records backwards by my calculated offset. This is working well, however I have found no way to modify the EOF marker or file size to ignore the data after the end of the last record. Most of the time records will grow in size because the data collection program will be filling some of the empty fields with data when saving a record. Records will only shrink in size when a correction is made on an existing entry, or on a normal record save if the descriptive data in the record is longer than what the program reads in memory. In the situation of a shrinking record, after the last record in the file I'm left with whatever data was sitting there before the shift. I have been writing an EOF delimiter into the file after a "shrinking record save" to signal where the end of my records are and space-filling the remaining data, but then I no longer have a clean file until a "growing record save" extends the size of the file over the space-filled area. The truncate() function in unistd.h does not work (I'm now thinking this is for *nix flavors only?). One proposed solution I've seen involves creating a second file and writing all the data you wish to save into that file, and then deleting the original. Since I only have 4MB worth of disk space to use, this works if the file size is less than 2MB minus the size of my program executable and configuration files, but would fail otherwise. It is very likely that when this goes into production, users would end up with a file exceeding 2MB in size. I've looked at Ralph Brown's Interrupt List and the interrupt reference in IBM PC Assembly Language and Programming and I can't seem to find anything to update the file size or similar. Is reducing a file's size without creating a second file even possible in DOS?

    Read the article

  • Web image loaded by thread in android

    - by Bostjan
    I have an extended BaseAdapter in a ListActivity: private static class RequestAdapter extends BaseAdapter { and some handlers and runnables defined in it // Need handler for callbacks to the UI thread final Handler mHandler = new Handler(); // Create runnable for posting final Runnable mUpdateResults = new Runnable() { public void run() { loadAvatar(); } }; protected static void loadAvatar() { // TODO Auto-generated method stub //ava.setImageBitmap(getImageBitmap("URL"+pic)); buddyIcon.setImageBitmap(avatar); } In the getView function of the Adapter, I'm getting the view like this: if (convertView == null) { convertView = mInflater.inflate(R.layout.messageitem, null); // Creates a ViewHolder and store references to the two children views // we want to bind data to. holder = new ViewHolder(); holder.username = (TextView) convertView.findViewById(R.id.username); holder.date = (TextView) convertView.findViewById(R.id.dateValue); holder.time = (TextView) convertView.findViewById(R.id.timeValue); holder.notType = (TextView) convertView.findViewById(R.id.notType); holder.newMsg = (ImageView) convertView.findViewById(R.id.newMsg); holder.realUsername = (TextView) convertView.findViewById(R.id.realUsername); holder.replied = (ImageView) convertView.findViewById(R.id.replied); holder.msgID = (TextView) convertView.findViewById(R.id.msgID_fr); holder.avatar = (ImageView) convertView.findViewById(R.id.buddyIcon); holder.msgPreview = (TextView) convertView.findViewById(R.id.msgPreview); convertView.setTag(holder); } else { // Get the ViewHolder back to get fast access to the TextView // and the ImageView. holder = (ViewHolder) convertView.getTag(); } and the image is getting loaded this way: Thread sepThread = new Thread() { public void run() { String ava; ava = request[8].replace(".", "_micro."); Log.e("ava thread",ava+", username: "+request[0]); avatar = getImageBitmap(URL+ava); buddyIcon = holder.avatar; mHandler.post(mUpdateResults); //holder.avatar.setImageBitmap(getImageBitmap(URL+ava)); } }; sepThread.start(); Now, the problem I'm having is that if there are more items that need to display the same picture, not all of those pictures get displayed. When you scroll up and down the list maybe you end up filling all of them. When I tried the commented out line (holder.avatar.setImageBitmap...) the app sometimes force closes with "only the thread that created the view can request...". But only sometimes. Any idea how I can fix this? Either option.

    Read the article

  • Using pointers, references, handles to generic datatypes, as generic and flexible as possible

    - by Patrick
    In my application I have lots of different data types, e.g. Car, Bicycle, Person, ... (they're actually other data types, but this is just for the example). Since I also have quite some 'generic' code in my application, and the application was originally written in C, pointers to Car, Bicycle, Person, ... are often passed as void-pointers to these generic modules, together with an identification of the type, like this: Car myCar; ShowNiceDialog ((void *)&myCar, DATATYPE_CAR); The 'ShowNiceDialog' method now uses meta-information (functions that map DATATYPE_CAR to interfaces to get the actual data out of Car) to get information of the car, based on the given data type. That way, the generic logic only has to be written once, and not every time again for every new data type. Of course, in C++ you could make this much easier by using a common root class, like this class RootClass { public: string getName() const = 0; }; class Car : public RootClass { ... }; void ShowNiceDialog (RootClass *root); The problem is that in some cases, we don't want to store the data type in a class, but in a totally different format to save memory. In some cases we have hundreds of millions of instances that we need to manage in the application, and we don't want to make a full class for every instance. Suppose we have a data type with 2 characteristics: A quantity (double, 8 bytes) A boolean (1 byte) Although we only need 9 bytes to store this information, putting it in a class means that we need at least 16 bytes (because of the padding), and with the v-pointer we possibly even need 24 bytes. For hundreds of millions of instances, every byte counts (I have a 64-bit variant of the application and in some cases it needs 6 GB of memory). The void-pointer approach has the advantage that we can almost encode anything in a void-pointer and decide how to use it if we want information from it (use it as a real pointer, as an index, ...), but at the cost of type-safety. Templated solutions don't help since the generic logic forms quite a big part of the application, and we don't want to templatize all this. Additionally, the data model can be extended at run time, which also means that templates won't help. Are there better (and type-safer) ways to handle this than a void-pointer? Any references to frameworks, whitepapers, research material regarding this?

    Read the article

  • How to retain canvas state and use it in onDraw() method

    - by marqss
    I want to make a measure tape component for my app. It should look something like this with values from 0cm to 1000cm: Initially I created long bitmap image with repeated tape background. I drew that image to canvas in onDraw() method of my TapeView (extended ImageView). Then I drew a set of numbers with drawText() on top of the canvas. public TapeView(Context context, AttributeSet attrs){ ImageView imageView = new ImageView(mContext); LayoutParams params = new LayoutParams(LayoutParams.WRAP_CONTENT, LayoutParams.FILL_PARENT); imageView.setLayoutParams(params); mBitmap = createTapeBitmap(); imageView.setImageBitmap(mBitmap); this.addView(imageView); } private Bitmap createTapeBitmap(){ Bitmap mBitmap = Bitmap.createBitmap(5000, 100, Config.ARGB_8888); //size of the tape Bitmap tape = BitmapFactory.decodeResource(getResources(),R.drawable.tape);//the image size is 100x100px Bitmap scaledTape = Bitmap.createScaledBitmap(tape, 100, 100, false); Canvas c = new Canvas(mBitmap); Paint paint = new Paint(); paint.setColor(Color.WHITE); paint.setFakeBoldText(true); paint.setAntiAlias(true); paint.setTextSize(30); for(int i=0; i<=500; i++){ //draw background image c.drawBitmap(scaledTape,(i * 200), 0, null); //draw number in the middle of that background String text = String.valueOf(i); int textWidth = (int) paint.measureText(text); int position = (i * 100) + 100 - (textWidth / 2); c.drawText(text, position, 20, paint); } return mBitmap; } Finally I added this view to HorizontalScrollView. At the beginning everything worked beautifully but I realised that the app uses a Lot of memory and sometimes crashed with OutOfMemory exception. It was obvious because a size of the bitmap image was ~4mb! In order to increase the performance, instead of creating the bitmap I use Drawable (with the yellow tape strip) and set the tile mode to REPEAT: setTileModeX(TileMode.REPEAT); The view now is very light but I cannot figure out how to add numbers. There are too many of them to redraw them each time the onDraw method is called. Is there any way that I can draw these numbers on canvas and then save that canvas so it can be reused in onDraw() method?

    Read the article

  • Memory corruption in System.Move due to changed 8087CW mode (png + stretchblt)

    - by André Mussche
    I have strange a memory corruption problem. After many hours debugging and trying I think I found something. For example: I do a simple string assignment: sTest := 'SET LOCK_TIMEOUT '; However, the result sometimes becomes: sTest = 'SET LOCK'#0'TIMEOUT ' So, the _ gets replaced by an 0 byte. I have seen this happening once (reproducing is tricky, dependent on timing) in the System.Move function, when it uses the FPU stack (fild, fistp) for fast memory copy (in case of 9 till 32 bytes to move): ... @@SmallMove: {9..32 Byte Move} fild qword ptr [eax+ecx] {Load Last 8} fild qword ptr [eax] {Load First 8} cmp ecx, 8 jle @@Small16 fild qword ptr [eax+8] {Load Second 8} cmp ecx, 16 jle @@Small24 fild qword ptr [eax+16] {Load Third 8} fistp qword ptr [edx+16] {Save Third 8} ... Using the FPU view and 2 memory debug views (Delphi - View - Debug - CPU - Memory) I saw it going wrong... once... could not reproduce however... This morning I read something about the 8087CW mode, and yes, if this is changed into $27F I get memory corruption! Normally it is $133F: The difference between $133F and $027F is that $027F sets up the FPU for doing less precise calculations (limiting to Double in stead of Extended) and different infiniti handling (which was used for older FPU’s, but is not used any more). Okay, now I found why but not when! I changed the working of my AsmProfiler with a simple check (so all functions are checked at enter and leave): if Get8087CW = $27F then //normally $1372? if MainThreadID = GetCurrentThreadId then //only check mainthread DebugBreak; I "profiled" some units and dll's and bingo (see stack): Windows.StretchBlt(3372289943,0,0,514,345,4211154027,0,0,514,345,13369376) pngimage.TPNGObject.DrawPartialTrans(4211154027,(0, 0, 514, 345, (0, 0), (514, 345))) pngimage.TPNGObject.Draw($7FF62450,(0, 0, 514, 345, (0, 0), (514, 345))) Graphics.TCanvas.StretchDraw((0, 0, 514, 345, (0, 0), (514, 345)),$7FECF3D0) ExtCtrls.TImage.Paint Controls.TGraphicControl.WMPaint((15, 4211154027, 0, 0)) So it is happening in StretchBlt... What to do now? Is it a fault of Windows, or a bug in PNG (included in D2007)? Or is the System.Move function not failsafe?

    Read the article

  • iOS: Gesture recogniser for smooth scrolling and flicking a View

    - by AppleDeveloper
    I am building an iPad app where I needed to allow resizing views functionality using divider view provided between two views. This divider view is just a 20px height view between two half screen content views - please refer attached images. When user scrolls this divider view up or down, both content views changes their sizes appropriately. I have extended UIView and implemented this using touchMoved delegate as code given below in touchesMoved delegate. It works fine. The only thing is missing with TouchMoved is you can't flick divider view to top or bottom directly. You have to scroll all the way to top or bottom! To support flicking the view I have tried UIPanGestureRecognizer but I don't see smooth scrolling with it. When I handle split position change in UIGestureRecognizerStateChanged state, just touching divider view flick it to top or bottom. Handling split position change in UIGestureRecognizerStateEnded does the same but I don't see content view resizing with dividerview scrolling! Could someone please tell me how could I achieve both smooth scrolling of divider view with resizing content views(like touchMoved) and flicking the view. Any alternative approach would also fine. Thanks. - (void)touchesMoved:(NSSet *)touches withEvent:(UIEvent *)event { UITouch *touch = [touches anyObject]; if (touch) { CGPoint lastPt = [touch previousLocationInView:self]; CGPoint pt = [touch locationInView:self]; float offset = pt.y - lastPt.y; self.parentViewController.splitPosition = self.parentViewController.splitPosition + offset; } } - (void)handlePan:(UIPanGestureRecognizer*)recognizer { CGPoint translation = [recognizer translationInView:recognizer.view]; CGPoint velocity = [recognizer velocityInView:recognizer.view]; if (recognizer.state == UIGestureRecognizerStateBegan) { } else if (recognizer.state == UIGestureRecognizerStateChanged) { // If I change split position here, I don't see smooth scrolling dividerview...it directly jumps to the top or bottom! self.parentViewController.splitPosition = self.parentViewController.splitPosition + translation.y; } else if (recognizer.state == UIGestureRecognizerStateEnded) { // If I change split position here, the same thing happens at end and I don't see my divider view moving with my scrolling and resizing my views. self.parentViewController.splitPosition = self.parentViewController.splitPosition + translation.y; } } Initial screen Increased top view size by scrolling divider view Top view is totally hidden here but I have to scroll divider view all the way to top. I want to flick the divider view so that it directly goes from any position to top

    Read the article

  • Understanding WebRequest

    - by Nai
    I found this snippet of code here that allows you to log into a website and get the response from the logged in page. However, I'm having trouble understanding all the part of the code. I've tried my best to fill in whatever I understand so far. Hope you guys can fill in the blanks for me. Thanks string nick = "mrbean"; string password = "12345"; //this is the query data that is getting posted by the website. //the query parameters 'nick' and 'password' must match the //name of the form you're trying to log into. you can find the input names //by using firebug and inspecting the text field string postData = "nick=" + nick + "&password=" + password; // this puts the postData in a byte Array with a specific encoding //Why must the data be in a byte array? byte[] data = Encoding.ASCII.GetBytes(postData); // this basically creates the login page of the site you want to log into WebRequest request = WebRequest.Create("http://www.mrbeanandme.com/login/"); // im guessing these parameters need to be set but i dont why? request.Method = "POST"; request.ContentType = "application/x-www-form-urlencoded"; request.ContentLength = data.Length; // this opens a stream for writing the post variables. // im not sure what a stream class does. need to do some reading into this. Stream stream = request.GetRequestStream(); // you write the postData to the website and then close the connection? stream.Write(data, 0, data.Length); stream.Close(); // this receives the response after the log in WebResponse response = request.GetResponse(); stream = response.GetResponseStream(); // i guess you need a stream reader to read a stream? StreamReader sr = new StreamReader(stream); // this outputs the code to console and terminates the program Console.WriteLine(sr.ReadToEnd()); Console.ReadLine();

    Read the article

  • Ideas for designing an automated content tagging system needed

    - by Benjamin Smith
    I am currently designing a website that amongst other is required to display and organise small amounts of text content (mainly quotes, article stubs, etc.). I currently have a database with 250,000+ items and need to come up with a method of tagging each item with relevant tags which will eventually allow for easy searching/browsing of the content for users. A very simplistic idea I have (and one that I believe is employed by some sites that I have been looking to for inspiration (http://www.brainyquote.com/quotes/topics.html)), is to simply search the database for certain words or phrases and use these words as tags for the content. This can easily be extended so that if for example a user wanted to show all items with a theme of love then I would just return a list of items with words and phrases relating to this theme. This would not be hard to implement but does not provide very good results. For example if I were to search for the month 'May' in the database with the aim of then classifying the items returned as realting to the topic of Spring then I would get back all occurrences of the word May, regardless of the semantic meaning. Another shortcoming of this method is that I believe it would be quite hard to automate the process to any large scale. What I really require is a library that can take an item, break it down and analyse the semantic meaning and also return a list of tags that would correctly classify the item. I know this is a lot to ask and I have a feeling I will end up reverting to the aforementioned method but I just thought I should ask if anyone knew of any pre-existing solution. I think that as the items in the database are short then it is probably quite a hard task to analyse any meaning from them however I may be mistaken. Another path to possibly go down would be to use something like amazon turk to outsource the task which may produce good results but would be expensive. Eventually I would like users to be able to (and want to!) tag content and to vote for the most relevant tags, possibly using a gameification mechanic as motivation however this is some way down the line. A temporary fix may be the best thing if this were the route I decided to go down as I could use the rough results I got as the starting point for a more in depth solution. If you've read this far, thanks for sticking with me, I know I'm spitballing but any input would be really helpful. Thanks.

    Read the article

  • How to obtain the first cluster of the directory's data in FAT using C# (or at least C++) and Win32A

    - by DarkWalker
    So I have a FAT drive, lets say H: and a directory 'work' (full path 'H:\work'). I need to get the NUMBER of the first cluster of that directory. The number of the first cluster is 2-bytes value, that is stored in the 26th and 27th bytes of the folder enty (wich is 32 bytes). Lets say I am doing it with file, NOT a directory. I can use code like this: static public string GetDirectoryPtr(string dir) { IntPtr ptr = CreateFile(@"H:\Work\dover.docx", GENERIC_READ, FILE_SHARE_READ | FILE_SHARE_WRITE, IntPtr.Zero, OPEN_EXISTING, 0,//FILE_FLAG_BACKUP_SEMANTICS, IntPtr.Zero); try { const uint bytesToRead = 2; byte[] readbuffer = new byte[bytesToRead]; if (ptr.ToInt32() == -1) return String.Format("Error: cannot open direcotory {0}", dir); if (SetFilePointer(ptr, 26, 0, 0) == -1) return String.Format("Error: unable to set file pointer on file {0}", ptr); uint read = 0; // real count of read bytes if (!ReadFile(ptr, readbuffer, bytesToRead, out read, 0)) return String.Format("cant read from file {0}. Error #{1}", ptr, Marshal.GetLastWin32Error()); int result = readbuffer[0] + 16 * 16 * readbuffer[1]; return result.ToString();//ASCIIEncoding.ASCII.GetString(readbuffer); } finally { CloseHandle(ptr); } } And it will return some number, like 19 (quite real to me, this is the only file on the disk). But I DONT need a file, I need a folder. So I am puttin FILE_FLAG_BACKUP_SEMANTICS param for CreateFile call... and dont know what to do next =) msdn is very clear on this issue http://msdn.microsoft.com/en-us/library/aa365258(v=VS.85).aspx It sounds to me like: "There is no way you can get a number of the folder's first cluster". The most desperate thing is that my tutor said smth like "You are going to obtain this or you wont pass this course". The true reason why he is so sure this is possible is because for 10 years (or may be more) he recieved the folder's first cluster number as a HASH of the folder's addres (and I was stupid enough to point this to him, so now I cant do it the same way) PS: This is the most spupid task I have ever had!!! This value is not really used anythere in program, it is only fcking pointless integer.

    Read the article

  • How can I group an array of rectangles into "Islands" of connected regions?

    - by Eric
    The problem I have an array of java.awt.Rectangles. For those who are not familiar with this class, the important piece of information is that they provide an .intersects(Rectangle b) function. I would like to write a function that takes this array of Rectangles, and breaks it up into groups of connected rectangles. Lets say for example, that these are my rectangles (constructor takes the arguments x, y, width,height): Rectangle[] rects = new Rectangle[] { new Rectangle(0, 0, 4, 2), //A new Rectangle(1, 1, 2, 4), //B new Rectangle(0, 4, 8, 2), //C new Rectangle(6, 0, 2, 2) //D } A quick drawing shows that A intersects B and B intersects C. D intersects nothing. A tediously drawn piece of ascii art does the job too: +-------+ +---+ ¦A+---+ ¦ ¦ D ¦ +-+---+-+ +---+ ¦ B ¦ +-+---+---------+ ¦ +---+ C ¦ +---------------+ Therefore, the output of my function should be: new Rectangle[][]{ new Rectangle[] {A,B,C}, new Rectangle[] {D} } The failed code This was my attempt at solving the problem: public List<Rectangle> getIntersections(ArrayList<Rectangle> list, Rectangle r) { List<Rectangle> intersections = new ArrayList<Rectangle>(); for(Rectangle rect : list) { if(r.intersects(rect)) { list.remove(rect); intersections.add(rect); intersections.addAll(getIntersections(list, rect)); } } return intersections; } public List<List<Rectangle>> mergeIntersectingRects(Rectangle... rectArray) { List<Rectangle> allRects = new ArrayList<Rectangle>(rectArray); List<List<Rectangle>> groups = new ArrayList<ArrayList<Rectangle>>(); for(Rectangle rect : allRects) { allRects.remove(rect); ArrayList<Rectangle> group = getIntersections(allRects, rect); group.add(rect); groups.add(group); } return groups; } Unfortunately, there seems to be an infinite recursion loop going on here. My uneducated guess would be that java does not like me doing this: for(Rectangle rect : allRects) { allRects.remove(rect); //... } Can anyone shed some light on the issue?

    Read the article

  • Sitecore E-Commerce Module - Discount/Promotional Codes

    - by Zachary Kniebel
    I am working on a project for which I must use Sitecore's E-Commerce Module (and Sitecore 6.5 rev. 120706 - aka 'Update 5') to create a web-store. One of the features that I am trying to implement is a generic promotional/discount code system - customer enters a code at checkout which grants a discount like 'free shipping', '20% off', etc. At the moment, I am looking for some guidance (a high-level solution, a few pseudo-ideas, some references to review, etc) as to how this can be accomplished. Summary: What I am looking for is a way to detect whether or not the user entered a promo code at a previous stage in the checkout line, and to determine what that promo code is, if they did. Progress Thus Far: I have thoroughly reviewed all of the Sitecore E-Commerce Services (SES) documentation, especially "SES Order Line Extension" documentation (which I believe will have to be modified/extended in order to accomplish this task). Additionally, I have thoroughly reviewed the Sitecore Community article Extending Sitecore E-Commerce - Pricing and believe that it may be a useful guide for applying a discount statically, but does not say much in the way of applying a discount dynamically. After reviewing these documents, I have come up with the following possible high-level solution to start from: I create a template to represent a promotional code, which holds all data relevant to the promotion (percent off, free shipping, code, etc). I then create another template (based on the Product Search Group template) that holds a link to an item within a global "Promotional Code" items folder. Next, I use the Product Search Group features of my new template to choose which products to apply the discount to. In the source code for the checkout I create a class that checks if a code has been entered and, if so, somehow carry it through the rest of the checkout process. This is where I get stuck. More Details: No using cookies No GET requests No changing/creating/deleting items in the Sitecore Database during the checkout process (e.g., no manipulation of fields of a discount item during checkout to signal that the discount has been applied) must stay within the scope of C# Last Notes: I will update this post with any more information that I find/progress that I make. I upgrade all answers that are relevant and detailed, thought-provoking, or otherwise useful to me and potentially useful to others, in addition to any high-level answers that serve as a feasible solution to this problem; even if your idea doesn't help me, if I think it will help someone else I will still upgrade it. Thanks, in advance, for all your help! :)

    Read the article

  • Converting C source to C++

    - by Barry Kelly
    How would you go about converting a reasonably large (300K), fairly mature C codebase to C++? The kind of C I have in mind is split into files roughly corresponding to modules (i.e. less granular than a typical OO class-based decomposition), using internal linkage in lieu private functions and data, and external linkage for public functions and data. Global variables are used extensively for communication between the modules. There is a very extensive integration test suite available, but no unit (i.e. module) level tests. I have in mind a general strategy: Compile everything in C++'s C subset and get that working. Convert modules into huge classes, so that all the cross-references are scoped by a class name, but leaving all functions and data as static members, and get that working. Convert huge classes into instances with appropriate constructors and initialized cross-references; replace static member accesses with indirect accesses as appropriate; and get that working. Now, approach the project as an ill-factored OO application, and write unit tests where dependencies are tractable, and decompose into separate classes where they are not; the goal here would be to move from one working program to another at each transformation. Obviously, this would be quite a bit of work. Are there any case studies / war stories out there on this kind of translation? Alternative strategies? Other useful advice? Note 1: the program is a compiler, and probably millions of other programs rely on its behaviour not changing, so wholesale rewriting is pretty much not an option. Note 2: the source is nearly 20 years old, and has perhaps 30% code churn (lines modified + added / previous total lines) per year. It is heavily maintained and extended, in other words. Thus, one of the goals would be to increase mantainability. [For the sake of the question, assume that translation into C++ is mandatory, and that leaving it in C is not an option. The point of adding this condition is to weed out the "leave it in C" answers.]

    Read the article

  • polymorphism, inheritance in c# - base class calling overridden method?

    - by Andrew Johns
    This code doesn't work, but hopefully you'll get what I'm trying to achieve here. I've got a Money class, which I've taken from http://www.noticeablydifferent.com/CodeSamples/Money.aspx, and extended it a little to include currency conversion. The implementation for the actual conversion rate could be different in each project, so I decided to move the actual method for retrieving a conversion rate (GetCurrencyConversionRate) into a derived class, but the ConvertTo method contains code that would work for any implementation assuming the derived class has overriden GetCurrencyConversionRate so it made sense to me to keep it in the parent class? So what I'm trying to do is get an instance of SubMoney, and be able to call the .ConvertTo() method, which would in turn use the overriden GetCurrencyConversionRate, and return a new instance of SubMoney. The problem is, I'm not really understanding some concepts of polymorphism and inheritance yet, so not quite sure what I'm trying to do is even possible in the way I think it is, as what is currently happening is that I end up with an Exception where it has used the base GetCurrencyConversionRate method instead of the derived one. Something tells me I need to move the ConvertTo method down to the derived class, but this seems like I'll be duplicating code in multiple implementations, so surely there's a better way? public class Money { public CurrencyConversionRate { get { return GetCurrencyConversionRate(_regionInfo.ISOCurrencySymbol); } } public static decimal GetCurrencyConversionRate(string isoCurrencySymbol) { throw new Exception("Must override this method if you wish to use it."); } public Money ConvertTo(string cultureName) { // convert to base USD first by dividing current amount by it's exchange rate. Money someMoney = this; decimal conversionRate = this.CurrencyConversionRate; decimal convertedUSDAmount = Money.Divide(someMoney, conversionRate).Amount; // now convert to new currency CultureInfo cultureInfo = new CultureInfo(cultureName); RegionInfo regionInfo = new RegionInfo(cultureInfo.LCID); conversionRate = GetCurrencyConversionRate(regionInfo.ISOCurrencySymbol); decimal convertedAmount = convertedUSDAmount * conversionRate; Money convertedMoney = new Money(convertedAmount, cultureName); return convertedMoney; } } public class SubMoney { public SubMoney(decimal amount, string cultureName) : base(amount, cultureName) {} public static new decimal GetCurrencyConversionRate(string isoCurrencySymbol) { // This would get the conversion rate from some web or database source decimal result = new Decimal(2); return result; } }

    Read the article

  • Decode base64 data as array in Python

    - by skerit
    I'm using this handy Javascript function to decode a base64 string and get an array in return. This is the string: base64_decode_array('6gAAAOsAAADsAAAACAEAAAkBAAAKAQAAJgEAACcBAAAoAQAA') This is what's returned: 234,0,0,0,235,0,0,0,236,0,0,0,8,1,0,0,9,1,0,0,10,1,0,0,38,1,0,0,39,1,0,0,40,1,0,0 The problem is I don't really understand the javascript function: var base64chars = 'ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/'.split(""); var base64inv = {}; for (var i = 0; i < base64chars.length; i++) { base64inv[base64chars[i]] = i; } function base64_decode_array (s) { // remove/ignore any characters not in the base64 characters list // or the pad character -- particularly newlines s = s.replace(new RegExp('[^'+base64chars.join("")+'=]', 'g'), ""); // replace any incoming padding with a zero pad (the 'A' character is zero) var p = (s.charAt(s.length-1) == '=' ? (s.charAt(s.length-2) == '=' ? 'AA' : 'A') : ""); var r = []; s = s.substr(0, s.length - p.length) + p; // increment over the length of this encrypted string, four characters at a time for (var c = 0; c < s.length; c += 4) { // each of these four characters represents a 6-bit index in the base64 characters list // which, when concatenated, will give the 24-bit number for the original 3 characters var n = (base64inv[s.charAt(c)] << 18) + (base64inv[s.charAt(c+1)] << 12) + (base64inv[s.charAt(c+2)] << 6) + base64inv[s.charAt(c+3)]; // split the 24-bit number into the original three 8-bit (ASCII) characters r.push((n >>> 16) & 255); r.push((n >>> 8) & 255); r.push(n & 255); } // remove any zero pad that was added to make this a multiple of 24 bits return r; } What's the function of those "<<<" and "" characters. Or is there a function like this for Python?

    Read the article

  • Scalable Database Tagging Schema

    - by Longpoke
    EDIT: To people building tagging systems. Don't read this. It is not what you are looking for. I asked this when I wasn't aware that RDBMS all have their own optimization methods, just use a simple many to many scheme. I have a posting system that has millions of posts. Each post can have an infinite number of tags associated with it. Users can create tags which have notes, date created, owner, etc. A tag is almost like a post itself, because people can post notes about the tag. Each tag association has an owner and date, so we can see who added the tag and when. My question is how can I implement this? It has to be fast searching posts by tag, or tags by post. Also, users can add tags to posts by typing the name into a field, kind of like the google search bar, it has to fill in the rest of the tag name for you. I have 3 solutions at the moment, but not sure which is the best, or if there is a better way. Note that I'm not showing the layout of notes since it will be trivial once I get a proper solution for tags. Method 1. Linked list tagId in post points to a linked list in tag_assoc, the application must traverse the list until flink=0 post: id, content, ownerId, date, tagId, notesId tag_assoc: id, tagId, ownerId, flink tag: id, name, notesId Method 2. Denormalization tags is simply a VARCHAR or TEXT field containing a tab delimited array of tagId:ownerId. It cannot be a fixed size. post: id, content, ownerId, date, tags, notesId tag: id, name, notesId Method 3. Toxi (from: http://www.pui.ch/phred/archives/2005/04/tags-database-schemas.html, also same thing here: http://stackoverflow.com/questions/20856/how-do-you-recommend-implementing-tags-or-tagging) post: id, content, ownerId, date, notesId tag_assoc: ownerId, tagId, postId tag: id, name, notesId Method 3 raises the question, how fast will it be to iterate through every single row in tag_assoc? Methods 1 and 2 should be fast for returning tags by post, but for posts by tag, another lookup table must be made. The last thing I have to worry about is optimizing searching tags by name, I have not worked that out yet. I made an ASCII diagram here: http://pastebin.com/f1c4e0e53

    Read the article

  • UDP Tracker not responding

    - by kelton52
    Alright, so I'm trying to connect to UDP trackers using c#, but I never get a response. I also don't get any errors. Here's my code. namespace UDPTester { class MainClass { public static bool messageReceived = false; public static Random Random = new Random(); public static void LOG(string format, params object[] args) { Console.WriteLine (format,args); } public static void Main (string[] args) { LOG ("Creating Packet..."); byte[] packet; using(var stream = new MemoryStream()) { var bc = new MiscUtil.Conversion.BigEndianBitConverter(); using(var br = new MiscUtil.IO.EndianBinaryWriter(bc,stream)) { LOG ("Magic Num: {0}",(Int64)0x41727101980); br.Write (0x41727101980); br.Write((Int32)0); br.Write ((Int32)Random.Next()); packet = stream.ToArray(); LOG ("Packet Size: {0}",packet.Length); } } LOG ("Connecting to tracker..."); var client = new System.Net.Sockets.UdpClient("tracker.openbittorrent.com",80); UdpState s = new UdpState(); s.e = client.Client.RemoteEndPoint; s.u = client; StartReceiving(s); LOG ("Sending Packet..."); client.Send(packet,packet.Length); while(!messageReceived) { Thread.Sleep(1000); } LOG ("Ended"); } public static void StartReceiving(UdpState state) { state.u.BeginReceive(ReceiveCallback,state); } public static void ReceiveCallback(IAsyncResult ar) { UdpClient u = (UdpClient)((UdpState)(ar.AsyncState)).u; IPEndPoint e = (IPEndPoint)((UdpState)(ar.AsyncState)).e; Byte[] receiveBytes = u.EndReceive(ar, ref e); string receiveString = Encoding.ASCII.GetString(receiveBytes); LOG("Received: {0}", receiveString); messageReceived = true; StartReceiving((UdpState)ar.AsyncState); } } public class UdpState { public UdpClient u; public EndPoint e; } } I was using a normal BinaryWriter, but that didn't work, and I read somewhere that it wants it's data in BigEndian. This doesn't work for any of the UDP trackers I've found, any ideas why I'm not getting a response? Did they maybe change the protocol and not tell anyone? HTTP trackers all work fine. Trackers I've tried udp://tracker.publicbt.com:80 udp://tracker.ccc.de:80 udp://tracker.istole.it:80 Also, I'm not interested in using MonoTorrent(and when I was using it, the UDP didn't work anyways). Protocol Sources http://xbtt.sourceforge.net/udp_tracker_protocol.html http://www.rasterbar.com/products/libtorrent/udp_tracker_protocol.html

    Read the article

  • C++ using cdb_read returns extra characters on some reads

    - by Moe Be
    Hi All, I am using the following function to loop through a couple of open CDB hash tables. Sometimes the value for a given key is returned along with an additional character (specifically a CTRL-P (a DLE character/0x16/0o020)). I have checked the cdb key/value pairs with a couple of different utilities and none of them show any additional characters appended to the values. I get the character if I use cdb_read() or cdb_getdata() (the commented out code below). If I had to guess I would say I am doing something wrong with the buffer I create to get the result from the cdb functions. Any advice or assistance is greatly appreciated. char* HashReducer::getValueFromDb(const string &id, vector <struct cdb *> &myHashFiles) { unsigned char hex_value[BUFSIZ]; size_t hex_len; //construct a real hex (not ascii-hex) value to use for database lookups atoh(id,hex_value,&hex_len); char *value = NULL; vector <struct cdb *>::iterator my_iter = myHashFiles.begin(); vector <struct cdb *>::iterator my_end = myHashFiles.end(); try { //while there are more databases to search and we have not found a match for(; my_iter != my_end && !value ; my_iter++) { //cerr << "\n looking for this MD5:" << id << " hex(" << hex_value << ") \n"; if (cdb_find(*my_iter, hex_value, hex_len)){ //cerr << "\n\nI found the key " << id << " and it is " << cdb_datalen(*my_iter) << " long\n\n"; value = (char *)malloc(cdb_datalen(*my_iter)); cdb_read(*my_iter,value,cdb_datalen(*my_iter),cdb_datapos(*my_iter)); //value = (char *)cdb_getdata(*my_iter); //cerr << "\n\nThe value is:" << value << " len is:" << strlen(value)<< "\n\n"; }; } } catch (...){} return value; }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • python object to native c++ pointer

    - by Lodle
    Im toying around with the idea to use python as an embedded scripting language for a project im working on and have got most things working. However i cant seem to be able to convert a python extended object back into a native c++ pointer. So this is my class: class CGEGameModeBase { public: virtual void FunctionCall()=0; virtual const char* StringReturn()=0; }; class CGEPYGameMode : public CGEGameModeBase, public boost::python::wrapper<CGEPYGameMode> { public: virtual void FunctionCall() { if (override f = this->get_override("FunctionCall")) f(); } virtual const char* StringReturn() { if (override f = this->get_override("StringReturn")) return f(); return "FAILED TO CALL"; } }; Boost wrapping: BOOST_PYTHON_MODULE(GEGameMode) { class_<CGEGameModeBase, boost::noncopyable>("CGEGameModeBase", no_init); class_<CGEPYGameMode, bases<CGEGameModeBase> >("CGEPYGameMode", no_init) .def("FunctionCall", &CGEPYGameMode::FunctionCall) .def("StringReturn", &CGEPYGameMode::StringReturn); } and the python code: import GEGameMode def Ident(): return "Alpha" def NewGamePlay(): return "NewAlpha" def NewAlpha(): import GEGameMode import GEUtil class Alpha(GEGameMode.CGEPYGameMode): def __init__(self): print "Made new Alpha!" def FunctionCall(self): GEUtil.Msg("This is function test Alpha!") def StringReturn(self): return "This is return test Alpha!" return Alpha() Now i can call the first to functions fine by doing this: const char* ident = extract< const char* >( GetLocalDict()["Ident"]() ); const char* newgameplay = extract< const char* >( GetLocalDict()["NewGamePlay"]() ); printf("Loading Script: %s\n", ident); CGEPYGameMode* m_pGameMode = extract< CGEPYGameMode* >( GetLocalDict()[newgameplay]() ); However when i try and convert the Alpha class back to its base class (last line above) i get an boost error: TypeError: No registered converter was able to extract a C++ pointer to type class CGEPYGameMode from this Python object of type Alpha I have done alot of searching on the net but cant work out how to convert the Alpha object into its base class pointer. I could leave it as an object but rather have it as a pointer so some non python aware code can use it. Any ideas?

    Read the article

  • L-Soft LISTSERV TCPGUI Interface for PHP Creation

    - by poolnoodl
    I'm trying to use LISTSERV's "API" in PHP. L-Soft calls this TCPGUI, and essentially, you can request data like over Telnet. To do this, I'm using PHP's TCP socket functions. I've seen this done in other languages but can't quite convert it to PHP. I can connect, I can change set ASCII or BINARY mode. But I can never quite craft the header packet the way I need to authenticate, so I'm thinking I'm messing up my conversion. C: http://www.lsoft.com/manuals/16.0/htmlhelp/advanced%20topics/TCPGUI.html#2334328 $origin = '[email protected]'; $pwd = 'password'; $host = "example.com"; $port = 2306; $email = "[email protected]"; $list = "mailinglist"; $command = "Query $list FOR $email"; $fp = stream_socket_client("tcp://$host:$port", $errno, $errstr, 30); $cmd = $command . " PW=" . $pwd; $len = strlen($cmd); $orglen = strlen($origin); $n = $len + $orglen + 1; $headerPacket[0] = "1"; $headerPacket[1] = "B"; $headerPacket[2] = "\r"; $headerPacket[3] = "\n"; $headerPacket[4] = ord($n / 256); $headerPacket[5] = ord($n + 255); $headerPacket[6] = ord($orglen); for ($i = 0; $i < $orglen; $i++) { $headerPacket[$i + 7] = ord($origin[$i]); } for ($i = 0; $i < $len; $i++) { $cmdPacket[$i] = ord($cmd[$i]); } fwrite($fp, implode($headerPacket)); while (!feof($fp)) { echo fgets($fp, 1024); } Any thoughts on where I'm going wrong? I'd much appreciate it if anyone could point me toward some code to do this, days of googling and searching here on SO has only lead me to examples in other languages. Of course, if you know C (or Java or Perl as linked below in my comment to bypass the spam filter), PHP, and socket programming fairly well, you could probably rewrite the whole of the code in an hour, maybe a few minutes. You'd have my eternal thanks for that.

    Read the article

  • T-SQL generated from LINQ to SQL is missing a where clause

    - by Jimmy W
    I have extended some functionality to a DataContext object (called "CodeLookupAccessDataContext") such that the object exposes some methods to return results of LINQ to SQL queries. Here are the methods I have defined: public List<CompositeSIDMap> lookupCompositeSIDMap(int regionId, int marketId) { var sidGroupId = CompositeSIDGroupMaps.Where(x => x.RegionID.Equals(regionId) && x.MarketID.Equals(marketId)) .Select(x => x.CompositeSIDGroup); IEnumerator<int> sidGroupIdEnum = sidGroupId.GetEnumerator(); if (sidGroupIdEnum.MoveNext()) return lookupCodeInfo<CompositeSIDMap, CompositeSIDMap>(x => x.CompositeSIDGroup.Equals(sidGroupIdEnum.Current), x => x); else return null; } private List<TResult> lookupCodeInfo<T, TResult>(Func<T, bool> compLambda, Func<T, TResult> selectLambda) where T : class { System.Data.Linq.Table<T> dataTable = this.GetTable<T>(); var codeQueryResult = dataTable.Where(compLambda) .Select(selectLambda); List<TResult> codeList = new List<TResult>(); foreach (TResult row in codeQueryResult) codeList.Add(row); return codeList; } CompositeSIDGroupMap and CompositeSIDMap are both tables in our database that are represented as objects in my DataContext object. I wrote the following code to call these methods and display the T-SQL generated after calling these methods: using (CodeLookupAccessDataContext codeLookup = new CodeLookupAccessDataContext()) { codeLookup.Log = Console.Out; List<CompositeSIDMap> compList = codeLookup.lookupCompositeSIDMap(5, 3); } I got the following results in my log after invoking this code: SELECT [t0].[CompositeSIDGroup] FROM [dbo].[CompositeSIDGroupMap] AS [t0] WHERE ([t0].[RegionID] = @p0) AND ([t0].[MarketID] = @p1) -- @p0: Input Int (Size = 0; Prec = 0; Scale = 0) [5] -- @p1: Input Int (Size = 0; Prec = 0; Scale = 0) [3] -- Context: SqlProvider(Sql2005) Model: AttributedMetaModel Build: 3.5.30729.1 SELECT [t0].[PK_CSM], [t0].[CompositeSIDGroup], [t0].[InputSID], [t0].[TargetSID], [t0].[StartOffset], [t0].[EndOffset], [t0].[Scale] FROM [dbo].[CompositeSIDMap] AS [t0] -- Context: SqlProvider(Sql2005) Model: AttributedMetaModel Build: 3.5.30729.1 The first T-SQL statement contains a where clause as specified and returns one column as expected. However, the second statement is missing a where clause and returns all columns, even though I did specify which rows I wanted to view and which columns were of interest. Why is the second T-SQL statement generated the way it is, and what should I do to ensure that I filter out the data according to specifications via the T-SQL? Also note that I would prefer to keep lookupCodeInfo() and especially am interested in keeping it enabled to accept lambda functions for specifying which rows/columns to return.

    Read the article

  • Patterns for dynamic CMS components (event driven?)

    - by CitrusTree
    Sorry my title is not great, this is my first real punt at moving 100% to OO as I've been procedural for more years than I can remember. I'm finding it hard to understand if what I'm trying to do is possible. Depending on people's thoughts on the 2 following points, I'll go down that route. The CMS I'm putting together is quote small, however focuses very much on different types of content. I could easily use Drupal which I'm very comfortable with, but I want to give myself a really good reasons to move myself into design patterns / OO-PHP 1) I have created a base 'content' class which I wish to be able to extend to handle different types of content. The base class, for example, handles HTML content, and extensions might handle XML or PDF output instead. On the other hand, at some point I may wish to extend the base class for a given project completely. I.e. if class 'content-v2' extended class 'content' for that site, any calls to that class should actually call 'content-v2' instead. Is that possible? If the code instantiates an object of type 'content' - I actually want it to instantiate one of type 'content-v2'... I can see how to do it using inheritance, but that appears to involve referring to the class explicitly, I can't see how to link the class I want it to use instead dynamically. 2) Secondly, the way I'm building this at the moment is horrible, I'm not happy with it. It feels very linear indeed - i.e. get session details get content build navigation theme page publish. To do this all the objects are called 1-by-1 which is all very static. I'd like it to be more dynamic so that I can add to it at a later date (very closely related to first question). Is there a way that instead of my orchestrator class calling all the other classes 1-by-1, then building the whole thing up at the end, that instead each of the other classes can 'listen' for specific events, then at the applicable point jump in and do their but? That way the orchestrator class would not need to know what other classes were required, and call them 1-by-1. Sorry if I've got this all twisted in my head. I'm trying to build this so it's really flexible.

    Read the article

  • Safely escaping and reading back a file path in ruby

    - by user336851
    I need to save a few informations about some files. Nothing too fancy so I thought I would go with a simple one line per item text file. Something like this : # write io.print "%i %s %s\n" % [File.mtime(fname), fname, Digest::SHA1.file(fname).hexdigest] # read io.each do |line| mtime, name, hash = line.scanf "%i %s %s" end Of course this doesn't work because a file name can contain spaces (breaking scanf) and line breaks (breaking IO#each). The line break problem can be avoided by dropping the use of each and going with a bunch of gets(' ') while not io.eof? mtime = Time.at(io.gets(" ").to_i) name = io.gets " " hash = io.gets "\n" end Dealing with spaces in the names is another matter. Now we need to do some escaping. note : I like space as a record delimiter but I'd have no issue changing it for one easier to use. In the case of filenames though, the only one that could help is ascii nul "\0" but a nul delimited file isn't really a text file anymore... I initially had a wall of text detailing the iterations of my struggle to make a correct escaping function and its reciprocal but it was just boring and not really useful. I'll just give you the final result: def write_name(io, val) io << val.gsub(/([\\ ])/, "\\\\\\1") # yes that' 6 backslashes ! end def read_name(io) name, continued = "", true while continued continued = false name += io.gets(' ').gsub(/\\(.)/) do |c| if c=="\\\\" "\\" elsif c=="\\ " continued=true " " else raise "unexpected backslash escape : %p (%s %i)" % [c, io.path, io.pos] end end end return name.chomp(' ') end I'm not happy at all with read_name. Way too long and akward, I feel it shouldn't be that hard. While trying to make this work I tried to come up with other ways : the bittorrent encoded / php serialize way : prefix the file name with the length of the name then just io.read(name_len.to_i). It works but it's a real pita to edit the file by hand. At this point we're halfway to a binary format. String#inspect : This one looks expressly made for that purpose ! Except it seems like the only way to get the value back is through eval. I hate the idea of eval-ing a string I didn't generate from trusted data. So. Opinions ? Isn't there some lib which can do all this ? Am I missing something obvious ? How would you do that ?

    Read the article

  • Enterprise library not responding.

    - by Costa
    Hi I spent a day trying to make Ent Lib Logging work and log anything into database or event log, I have a web application and console application withe the same Ent Lib config, only the console is capable to log into the Event Log, I tried everything with permissions, but I don't know what exactly I am doing, which services should have what, It does not work!! HELP This is the config file which is automatically generated from Ent Lib utility and it works only on App.config, not on web.config <loggingConfiguration name="Logging Application Block" tracingEnabled="true" defaultCategory="General" logWarningsWhenNoCategoriesMatch="true" revertImpersonation="false"> <listeners> <add source="Logger" formatter="Text Formatter" log="Application" machineName="" listenerDataType="Microsoft.Practices.EnterpriseLibrary.Logging.Configuration.FormattedEventLogTraceListenerData, Microsoft.Practices.EnterpriseLibrary.Logging, Version=4.1.0.0, Culture=neutral, PublicKeyToken=31bf3856ad364e35" traceOutputOptions="None" filter="All" type="Microsoft.Practices.EnterpriseLibrary.Logging.TraceListeners.FormattedEventLogTraceListener, Microsoft.Practices.EnterpriseLibrary.Logging, Version=4.1.0.0, Culture=neutral, PublicKeyToken=31bf3856ad364e35" name="Formatted EventLog TraceListener" /> </listeners> <formatters> <add template="Timestamp: {timestamp}&#xD;&#xA;Message: {message}&#xD;&#xA;Category: {category}&#xD;&#xA;Priority: {priority}&#xD;&#xA;EventId: {eventid}&#xD;&#xA;Severity: {severity}&#xD;&#xA;Title:{title}&#xD;&#xA;Machine: {machine}&#xD;&#xA;Application Domain: {appDomain}&#xD;&#xA;Process Id: {processId}&#xD;&#xA;Process Name: {processName}&#xD;&#xA;Win32 Thread Id: {win32ThreadId}&#xD;&#xA;Thread Name: {threadName}&#xD;&#xA;Extended Properties: {dictionary({key} - {value}&#xD;&#xA;)}" type="Microsoft.Practices.EnterpriseLibrary.Logging.Formatters.TextFormatter, Microsoft.Practices.EnterpriseLibrary.Logging, Version=4.1.0.0, Culture=neutral, PublicKeyToken=31bf3856ad364e35" name="Text Formatter" /> </formatters> <categorySources> <add switchValue="All" name="General"> <listeners> <add name="Formatted EventLog TraceListener" /> </listeners> </add> </categorySources> <specialSources> <allEvents switchValue="All" name="All Events" /> <notProcessed switchValue="All" name="Unprocessed Category" /> <errors switchValue="All" name="Logging Errors &amp; Warnings"> <listeners> <add name="Formatted EventLog TraceListener" /> </listeners> </errors> </specialSources> </loggingConfiguration> thanks

    Read the article

  • Approaches for Content-based Item Recommendations

    - by PartlyCloudy
    Hello, I'm currently developing an application where I want to group similar items. Items (like videos) can be created by users and also their attributes can be altered or extended later (like new tags). Instead of relying on users' preferences as most collaborative filtering mechanisms do, I want to compare item similarity based on the items' attributes (like similar length, similar colors, similar set of tags, etc.). The computation is necessary for two main purposes: Suggesting x similar items for a given item and for clustering into groups of similar items. My application so far is follows an asynchronous design and I want to decouple this clustering component as far as possible. The creation of new items or the addition of new attributes for an existing item will be advertised by publishing events the component can then consume. Computations can be provided best-effort and "snapshotted", which means that I'm okay with the best result possible at a given point in time, although result quality will eventually increase. So I am now searching for appropriate algorithms to compute both similar items and clusters. At important constraint is scalability. Initially the application has to handle a few thousand items, but later million items might be possible as well. Of course, computations will then be executed on additional nodes, but the algorithm itself should scale. It would also be nice if the algorithm supports some kind of incremental mode on partial changes of the data. My initial thought of comparing each item with each other and storing the numerical similarity sounds a little bit crude. Also, it requires n*(n-1)/2 entries for storing all similarities and any change or new item will eventually cause n similarity computations. Thanks in advance! UPDATE tl;dr To clarify what I want, here is my targeted scenario: User generate entries (think of documents) User edit entry meta data (think of tags) And here is what my system should provide: List of similar entries to a given item as recommendation Clusters of similar entries Both calculations should be based on: The meta data/attributes of entries (i.e. usage of similar tags) Thus, the distance of two entries using appropriate metrics NOT based on user votings, preferences or actions (unlike collaborative filtering). Although users may create entries and change attributes, the computation should only take into account the items and their attributes, and not the users associated with (just like a system where only items and no users exist). Ideally, the algorithm should support: permanent changes of attributes of an entry incrementally compute similar entries/clusters on changes scale something better than a simple distance table, if possible (because of the O(n²) space complexity)

    Read the article

< Previous Page | 135 136 137 138 139 140 141 142 143 144 145 146  | Next Page >