Search Results

Search found 39682 results on 1588 pages for 'text pattern'.

Page 141/1588 | < Previous Page | 137 138 139 140 141 142 143 144 145 146 147 148  | Next Page >

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • DDD: Getting aggregate roots for other aggregates

    - by Ed
    I've been studying DDD for the past 2 weeks, and one of the things that really stuck out to me was how aggregate roots can contain other aggregate roots. Aggregate roots are retrieved from the repository, but if a root contains another root, does the repository have a reference to the other repository and asks it to build the subroot?

    Read the article

  • Sorting tree with a materialized path?

    - by Ovid
    I have a tree structure in a table and it uses materialized paths to allow me to find children quickly. However, I also need to sort the results depth-first, as one would expect with threaded forum replies. id | parent_id | matpath | created ----+-----------+---------+---------------------------- 2 | 1 | 1 | 2010-05-08 15:18:37.987544 3 | 1 | 1 | 2010-05-08 17:38:14.125377 4 | 1 | 1 | 2010-05-08 17:38:57.26743 5 | 1 | 1 | 2010-05-08 17:43:28.211708 7 | 1 | 1 | 2010-05-08 18:18:11.849735 6 | 2 | 1.2 | 2010-05-08 17:50:43.288759 9 | 5 | 1.5 | 2010-05-09 14:02:43.818646 8 | 6 | 1.2.6 | 2010-05-09 14:01:17.632695 So the final results should actually be sorted like this: id | parent_id | matpath | created ----+-----------+---------+---------------------------- 2 | 1 | 1 | 2010-05-08 15:18:37.987544 6 | 2 | 1.2 | 2010-05-08 17:50:43.288759 8 | 6 | 1.2.6 | 2010-05-09 14:01:17.632695 3 | 1 | 1 | 2010-05-08 17:38:14.125377 4 | 1 | 1 | 2010-05-08 17:38:57.26743 5 | 1 | 1 | 2010-05-08 17:43:28.211708 9 | 5 | 1.5 | 2010-05-09 14:02:43.818646 7 | 1 | 1 | 2010-05-08 18:18:11.849735 How would I work that out? Can I do that in straight SQL (this is PostgreSQL 8.4) or should additional information be added to this table?

    Read the article

  • Help me alter this query to get the desired results - New*

    - by sandeepan
    Please dump these data first CREATE TABLE IF NOT EXISTS `all_tag_relations` ( `id_tag_rel` int(10) NOT NULL AUTO_INCREMENT, `id_tag` int(10) unsigned NOT NULL DEFAULT '0', `id_tutor` int(10) DEFAULT NULL, `id_wc` int(10) unsigned DEFAULT NULL, PRIMARY KEY (`id_tag_rel`), KEY `All_Tag_Relations_FKIndex1` (`id_tag`), KEY `id_wc` (`id_wc`) ) ENGINE=InnoDB DEFAULT CHARSET=latin1 AUTO_INCREMENT=19 ; INSERT INTO `all_tag_relations` (`id_tag_rel`, `id_tag`, `id_tutor`, `id_wc`) VALUES (1, 1, 1, NULL), (2, 2, 1, NULL), (3, 6, 2, NULL), (4, 7, 2, NULL), (8, 3, 1, 1), (9, 4, 1, 1), (10, 5, 2, 2), (11, 4, 2, 2), (15, 8, 1, 3), (16, 9, 1, 3), (17, 10, 1, 4), (18, 4, 1, 4), (19, 1, 2, 5), (20, 4, 2, 5); CREATE TABLE IF NOT EXISTS `tags` ( `id_tag` int(10) unsigned NOT NULL AUTO_INCREMENT, `tag` varchar(255) DEFAULT NULL, PRIMARY KEY (`id_tag`), UNIQUE KEY `tag` (`tag`), KEY `id_tag` (`id_tag`), KEY `tag_2` (`tag`), KEY `tag_3` (`tag`), KEY `tag_4` (`tag`), FULLTEXT KEY `tag_5` (`tag`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 AUTO_INCREMENT=11 ; INSERT INTO `tags` (`id_tag`, `tag`) VALUES (1, 'Sandeepan'), (2, 'Nath'), (3, 'first'), (4, 'class'), (5, 'new'), (6, 'Bob'), (7, 'Cratchit'), (8, 'more'), (9, 'fresh'), (10, 'second'); CREATE TABLE IF NOT EXISTS `webclasses` ( `id_wc` int(10) NOT NULL AUTO_INCREMENT, `id_author` int(10) NOT NULL, `name` varchar(50) DEFAULT NULL, PRIMARY KEY (`id_wc`) ) ENGINE=InnoDB DEFAULT CHARSET=latin1 AUTO_INCREMENT=5 ; INSERT INTO `webclasses` (`id_wc`, `id_author`, `name`) VALUES (1, 1, 'first class'), (2, 2, 'new class'), (3, 1, 'more fresh'), (4, 1, 'second class'), (5, 2, 'sandeepan class'); About the system - The system consists of tutors and classes. - The data in the table All_Tag_Relations stores tag relations for each tutor registered and each class created by a tutor. The tag relations are used for searching classes. The current data dump corresponds to tutor "Sandeepan Nath" who has created classes named "first class", "more fresh", "second class" and tutor "Bob Cratchit" who has created classes "new class" and "Sandeepan class". I am trying for a search query performs AND logic on the search keywords and returns wvery such class for which the search terms are present in the class name or its tutor name To make it easy, following is the list of search terms and desired results:- Search term result classes (check the id_wc in the results) first class 1 Sandeepan Nath class 1 Sandeepan Nath 1,3 Bob Cratchit 2 Sandeepan Nath bob none Sandeepan Class 1,4,5 I have so far reached upto this query -- Two keywords search SET @tag1 = 4, @tag2 = 1; -- Setting some user variables to see where the ids go. SELECT wc.id_wc, sum( DISTINCT ( wtagrels.id_tag = @tag1 ) ) AS key_1_class_matches, sum( DISTINCT ( wtagrels.id_tag = @tag2 ) ) AS key_2_class_matches, sum( DISTINCT ( ttagrels.id_tag = @tag1 ) ) AS key_1_tutor_matches, sum( DISTINCT ( ttagrels.id_tag = @tag2 ) ) AS key_2_tutor_matches, sum( DISTINCT ( ttagrels.id_tag = wtagrels.id_tag ) ) AS key_class_tutor_matches FROM WebClasses as wc join all_tag_relations AS wtagrels on wc.id_wc = wtagrels.id_wc join all_tag_relations as ttagrels on (wc.id_author = ttagrels.id_tutor) WHERE ( wtagrels.id_tag = @tag1 OR wtagrels.id_tag = @tag2 OR ttagrels.id_tag = @tag1 OR ttagrels.id_tag = @tag2 ) GROUP BY wtagrels.id_wc LIMIT 0 , 20 For search with 1 or 3 terms, remove/add the variable part in this query. Tabulating my observation of the values of key_1_class_matches, key_2_class_matches,key_1_tutor_matches (say, class keys),key_2_tutor_matches for various cases (say, tutor keys). Search term expected result Observation first class 1 for class 1, all class keys+all tutor keys =1 Sandeepan Nath class 1 for class 1, one class key+ all tutor keys = 1 Sandeepan Nath 1,3 both tutor keys =1 for these classes Bob Cratchit 2 both tutor keys = 1 Sandeepan Nath bob none no complete tutor matches for any class I found a pattern that, for any case, the class(es) which should appear in the result have the highest number of matches (all class keys and tutor keys). E.g. searching "first class", only for class =1, total of key matches = 4(1+1+1+1) searching "Sandeepan Nath", for classes 1, 3,4(all classes by Sandeepan Nath) have all the tutor keys matching. But no pattern in the search for "Sandeepan Class" - classes 1,4,5 should match. Now, how do I put a condition into the query, based on that pattern so that only those classes are returned. Do I need to use full text search here because it gives a scoring/rank value indicating the strength of the match? Any sample query would help. Please note - I have already found solution for showing classes when any/all of the search terms match with the class name. http://stackoverflow.com/questions/3030022/mysql-help-me-alter-this-search-query-to-get-desired-results But if all the search terms are in tutor name, it does not work. So, I am modifying the query and experimenting.

    Read the article

  • Regular Expressions: Positive Lookahead and Word Border question

    - by Inf.S
    Hello again Stackoverflow people! Assume I have these words: smartphones, smartphone I want to match the substring "phone" from within them. However, in both case, I want only "phone" to be returned, not "phones" in the first case. In addition to this, I want matches only if the word "phone" is a suffix only, such that: fonephonetics (just an example) is not matched. I assumed that the regex (phone([?=s])?)\b would give me what I need, but it is currently matching "phones" and "phone", but not the "fonephonetics" one. I don't need "phones". I want "phone" for both cases. Any ideas about what is wrong, and what I can do? Thank you in advance!

    Read the article

  • Help me alter this query to get the desired results

    - by sandeepan
    Please dump these data first CREATE TABLE IF NOT EXISTS `all_tag_relations` ( `id_tag_rel` int(10) NOT NULL AUTO_INCREMENT, `id_tag` int(10) unsigned NOT NULL DEFAULT '0', `id_tutor` int(10) DEFAULT NULL, `id_wc` int(10) unsigned DEFAULT NULL, PRIMARY KEY (`id_tag_rel`), KEY `All_Tag_Relations_FKIndex1` (`id_tag`), KEY `id_wc` (`id_wc`) ) ENGINE=InnoDB DEFAULT CHARSET=latin1 AUTO_INCREMENT=19 ; INSERT INTO `all_tag_relations` (`id_tag_rel`, `id_tag`, `id_tutor`, `id_wc`) VALUES (1, 1, 1, NULL), (2, 2, 1, NULL), (3, 6, 2, NULL), (4, 7, 2, NULL), (8, 3, 1, 1), (9, 4, 1, 1), (10, 5, 2, 2), (11, 4, 2, 2), (15, 8, 1, 3), (16, 9, 1, 3), (17, 10, 1, 4), (18, 4, 1, 4), (19, 1, 2, 5), (20, 4, 2, 5); CREATE TABLE IF NOT EXISTS `tags` ( `id_tag` int(10) unsigned NOT NULL AUTO_INCREMENT, `tag` varchar(255) DEFAULT NULL, PRIMARY KEY (`id_tag`), UNIQUE KEY `tag` (`tag`), KEY `id_tag` (`id_tag`), KEY `tag_2` (`tag`), KEY `tag_3` (`tag`), KEY `tag_4` (`tag`), FULLTEXT KEY `tag_5` (`tag`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 AUTO_INCREMENT=11 ; INSERT INTO `tags` (`id_tag`, `tag`) VALUES (1, 'Sandeepan'), (2, 'Nath'), (3, 'first'), (4, 'class'), (5, 'new'), (6, 'Bob'), (7, 'Cratchit'), (8, 'more'), (9, 'fresh'), (10, 'second'); CREATE TABLE IF NOT EXISTS `webclasses` ( `id_wc` int(10) NOT NULL AUTO_INCREMENT, `id_author` int(10) NOT NULL, `name` varchar(50) DEFAULT NULL, PRIMARY KEY (`id_wc`) ) ENGINE=InnoDB DEFAULT CHARSET=latin1 AUTO_INCREMENT=5 ; INSERT INTO `webclasses` (`id_wc`, `id_author`, `name`) VALUES (1, 1, 'first class'), (2, 2, 'new class'), (3, 1, 'more fresh'), (4, 1, 'second class'), (5, 2, 'sandeepan class'); About the system - The system consists of tutors and classes. - The data in the table All_Tag_Relations stores tag relations for each tutor registered and each class created by a tutor. The tag relations are used for searching classes. The current data dump corresponds to tutor "Sandeepan Nath" who has created classes named "first class", "more fresh", "second class" and tutor "Bob Cratchit" who has created classes "new class" and "Sandeepan class". I am trying for a search query performs AND logic on the search keywords and returns wvery such class for which the search terms are present in the class name or its tutor name To make it easy, following is the list of search terms and desired results:- Search term result classes (check the id_wc in the results) first class 1 Sandeepan Nath class 1 Sandeepan Nath 1,3 Bob Cratchit 2 Sandeepan Nath bob none Sandeepan Class 1,4,5 I have so far reached upto this query -- Two keywords search SET @tag1 = 4, @tag2 = 1; -- Setting some user variables to see where the ids go. SELECT wc.id_wc, sum( DISTINCT ( wtagrels.id_tag = @tag1 ) ) AS key_1_class_matches, sum( DISTINCT ( wtagrels.id_tag = @tag2 ) ) AS key_2_class_matches, sum( DISTINCT ( ttagrels.id_tag = @tag1 ) ) AS key_1_tutor_matches, sum( DISTINCT ( ttagrels.id_tag = @tag2 ) ) AS key_2_tutor_matches, sum( DISTINCT ( ttagrels.id_tag = wtagrels.id_tag ) ) AS key_class_tutor_matches FROM WebClasses as wc join all_tag_relations AS wtagrels on wc.id_wc = wtagrels.id_wc join all_tag_relations as ttagrels on (wc.id_author = ttagrels.id_tutor) WHERE ( wtagrels.id_tag = @tag1 OR wtagrels.id_tag = @tag2 OR ttagrels.id_tag = @tag1 OR ttagrels.id_tag = @tag2 ) GROUP BY wtagrels.id_wc LIMIT 0 , 20 For search with 1 or 3 terms, remove/add the variable part in this query. Tabulating my observation of the values of key_1_class_matches, key_2_class_matches,key_1_tutor_matches (say, class keys),key_2_tutor_matches for various cases (say, tutor keys). Search term expected result Observation first class 1 for class 1, all class keys+all tutor keys =1 Sandeepan Nath class 1 for class 1, one class key+ all tutor keys = 1 Sandeepan Nath 1,3 both tutor keys =1 for these classes Bob Cratchit 2 both tutor keys = 1 Sandeepan Nath bob none no complete tutor matches for any class I found a pattern that, for any case, the class(es) which should appear in the result have the highest number of matches (all class keys and tutor keys). E.g. searching "first class", only for class =1, total of key matches = 4(1+1+1+1) searching "Sandeepan Nath", for classes 1, 3,4(all classes by Sandeepan Nath) have all the tutor keys matching. But no pattern in the search for "Sandeepan Class" - classes 1,4,5 should match. Now, how do I put a condition into the query, based on that pattern so that only those classes are returned. Do I need to use full text search here because it gives a scoring/rank value indicating the strength of the match? Any sample query would help. Please note - I have already found solution for showing classes when any/all of the search terms match with the class name. http://stackoverflow.com/questions/3030022/mysql-help-me-alter-this-search-query-to-get-desired-results But if all the search terms are in tutor name, it does not work. So, I am modifying the query and experimenting.

    Read the article

  • Does .NET Regex support global matching?

    - by Dave
    I haven't been able to find anything online regarding this. There's RegexOptions, but it doesn't have Global as one of its options. The inline modifiers list also doesn't mention global matching. In a nutshell, I've got a regex to parse something like --arga= "arg1" --argb ="arg2" into separate argument name/value pairs using this regex: --(\\w+)\\s*=\\s*\"(\\w+)\"\\s* but the .NET Regex class doesn't do it globally (iteratively). So in order for me to get this to work, I'd have to do a match, then remove this from the argument string, and loop over and over again until I've exhausted all of the arguments. It would be nicer to run the regex once, and then loop over the match groups to get the name value pairs. Is this possible? What am I missing?

    Read the article

  • PHP-REGEX: accented letters matches non-accented ones, and visceversa. How to achive it?

    - by Lightworker
    I want to do the typical higlight code. So I have something like: $valor = preg_replace("/(".$_REQUEST['txt_search'].")/iu", "<span style='background-color:yellow; font-weight:bold;'>\\1</span>", $valor); Now, the request word could be something like "josé". And with it, I want "jose" or "JOSÉ" or "José" or ... highlighted too. With this expression, if I write "josé", it matches "josé" and "JOSÉ" (and all the case variants). It always matches the accented variants only. If I search "jose", it matches "JOSE", "jose", "Jose"... but not the accented ones. So I've partially what I want, cause I have case insensitive on accented and non-accented separately. I need it fully combined, wich means accent (unicode) insensitive, so I can search "jose", and highlight "josé", "josÉ", "José", "JOSE", "JOSÉ", "JoSé", ... I don't want to do a replace of accents on the word, cause when I print it on screen I need to see the real word as it comes. Any ideas? Thanks!

    Read the article

  • Multi-tenant Access Control: Repository or Service layer?

    - by FreshCode
    In a multi-tenant ASP.NET MVC application based on Rob Conery's MVC Storefront, should I be filtering the tenant's data in the repository or the service layer? 1. Filter tenant's data in the repository: public interface IJobRepository { IQueryable<Job> GetJobs(short tenantId); } 2. Let the service filter the repository data by tenant: public interface IJobService { IList<Job> GetJobs(short tenantId); } My gut-feeling says to do it in the service layer (option 2), but it could be argued that each tenant should in essence have their own "virtual repository," (option 1) where this responsibility lies with the repository. Which is the most elegant approach: option 1, option 2 or is there a better way? Update: I tried the proposed idea of filtering at the repository, but the problem is that my application provides the tenant context (via sub-domain) and only interacts with the service layer. Passing the context all the way to the repository layer is a mission. So instead I have opted to filter my data at the service layer. I feel that the repository should represent all data physically available in the repository with appropriate filters for retrieving tenant-specific data, to be used by the service layer. Final Update: I ended up abandoning this approach due to the unnecessary complexities. See my answer below.

    Read the article

  • JQuery text display problem?

    - by SLAPme
    Kind of new to JQuery and I was wondering how can I state that the users submitted info was saved when they click the submit button by displaying the message Changes saved at the top of the form and then have it disappear when the user leaves the web page and return back to it? Right now my code only displays that changes were saved at the bottom of the form outside of the lists and will not disappear when the users leave the web page and return back to it. Here is the JQuery code. $(function() { $(".save-button").click(function() { $.post($("#contact-form").attr("action"), $("#contact-form").serialize(), function(html) { $("div.contact-info-form").html(html); $('#contact-form').append('<li>Changes saved!</li>'); }); return false; // prevent normal submit }); }); Here is the html code. <div id="contact-info-form" class="form-content"> <h2>Contact Information</h2> <form method="post" action="index.php" id="contact-form"> <fieldset> <ul> <li><label for="address">Address 1: </label><input type="text" name="address" id="address" size="25" class="input-size" value="<?php if (isset($_POST['address'])) { echo $_POST['address']; } else if(!empty($address)) { echo $address; } ?>" /></li> <li><label for="address_two">Address 2: </label><input type="text" name="address_two" id="address_two" size="25" class="input-size" value="<?php if (isset($_POST['address_two'])) { echo $_POST['address_two']; } else if(!empty($address_two)) { echo $address_two; } ?>" /></li> <li><label for="city_town">City/Town: </label><input type="text" name="city_town" id="city_town" size="25" class="input-size" value="<?php if (isset($_POST['city_town'])) { echo $_POST['city_town']; } else if(!empty($city_town)) { echo $city_town; } ?>" /></li> <li><label for="state_province">State/Province: </label> <?php echo '<select name="state_province" id="state_province">' . "\n"; foreach($state_options as $option) { if ($option == $state_province) { echo '<option value="' . $option . '" selected="selected">' . $option . '</option>' . "\n"; } else { echo '<option value="'. $option . '">' . $option . '</option>'."\n"; } } echo '</select>'; ?> </li> <li><label for="zipcode">Zip/Post Code: </label><input type="text" name="zipcode" id="zipcode" size="5" class="input-size" value="<?php if (isset($_POST['zipcode'])) { echo $_POST['zipcode']; } else if(!empty($zipcode)) { echo $zipcode; } ?>" /></li> <li><label for="country">Country: </label> <?php echo '<select name="country" id="country">' . "\n"; foreach($countries as $option) { if ($option == $country) { echo '<option value="' . $option . '" selected="selected">' . $option . '</option>' . "\n"; } else if($option == "-------------") { echo '<option value="' . $option . '" disabled="disabled">' . $option . '</option>'; } else { echo '<option value="'. $option . '">' . $option . '</option>'."\n"; } } echo '</select>'; ?> </li> <li><label for="email">Email Address: </label><input type="text" name="email" id="email" size="25" class="input-size" value="<?php if (isset($_POST['email'])) { echo $_POST['email']; } else if(!empty($email)) { echo $email; } ?>" /><br /><span>We don't spam or share your email with third parties. We respect your privacy.</span></li> <li><input type="submit" name="submit" value="Save Changes" class="save-button" /> <input type="hidden" name="contact_info_submitted" value="true" /> <input type="submit" name="submit" value="Preview Changes" class="preview-changes-button" /></li> </ul> </fieldset> </form> </div>

    Read the article

  • C# Inheritence: Choosing what repository based on type of inherited class

    - by Oskar Kjellin
    I have been making a program that downloads information about movies from the internet. I have a base class Title, which represents all titles. Movie, Serie and Episode are inherited from that class. To save them to the database I have 2 services, MovieService and SerieService. They in turn call repositories, but that is not important here. I have a method Save(Title title) which I am not very happy with. I check for what type the title is and then call the correct service. I would like to perhaps write like this: ITitleService service = title.GetService(); title.GetSavedBy(service); So I have an abstract method on Title that returns an ITitleSaver, which will return the correct service for the instance. My question is how should I implement ITitleSaver? If I make it accept Title I will have to cast it to the correct type before calling the correct overload. Which will lead to having to deal with casting once again. What is the best approach to dealing with this? I would like to have the saving logic in the corresponding class.

    Read the article

  • Access Adobe InDesign files

    - by PeterMmm
    I need some directions for the following problem: I have a lot of InDesign files and i have to setup a process that will track if a certain paragraph or text block has changed between diferent versions of the file. If the text block has changed i want to extract that text block in a "portable" format (html, pdf, txt). Is there an Adobe product that would do that ? Is there any public API to access an InDesign file ? Is there the posibility to export InDesign to, say, html ?

    Read the article

  • Get user-inputed file name from JFileChooser Save dialog box

    - by Anya
    This answer to this question may seem obvious, but I'm actually struggling with it quite a bit. I've searched through JFileChooser methods in the API, and I've looked at some of the questions already asked and answered here on stackoverflow. My question is this. In my program, I am to allow the user to type in a file name which I will then use to create a brand new file that I will write on. How do you get the text the user has entered in the textfield next to the label "Save As:" on the Save dialog box provided by JFileChooser? Is there a JFileChooser method that would allow me to get that user-inputed text? Or would I have to go through another class, or do something else to get that text? Thank you so much, to anyone who answers. It's very late for me now, and this program is due in a few hours (meaning I'll be having another sleepless night). Desperate may be too strong a word, but I'm something close enough.

    Read the article

  • Apache URL rewrite query

    - by ant-1980
    Can anyone tell me how to do this? i'm stumped! I need a modified URL in this format this55-is-a-test-id-23.html But I need the 23 as a GET. I can't rely on searching for 'id' as this may occur elsewhere in the URL. Is there any way of searching for the last occurrence of id and passing that as a get using an Apache RewriteRule in .htaccess?? Many thanks Ant

    Read the article

  • How can I extract the nth occurrence of a match in a Perl regex?

    - by Zaid
    Is it possible to extract the n'th match in a string of single-quoted words? use strict; use warnings; my $string1 = '\'I want to\' \'extract the word\' \'Perl\',\'from this string\''; my $string2 = '\'What about\',\'getting\',\'Perl\',\'from\',\'here\',\'?\''; sub extract_quoted { my ($string, $index) = @_; my ($wanted) = $string =~ /some_regex_using _$index/; return $wanted; } extract_wanted ($string1, 3); # Should return 'Perl', with quotes extract_wanted ($string2, 3); # Should return 'Perl', with quotes

    Read the article

  • Comparing 2 columns in the same table with the "Like" function

    - by Vic
    I'm trying to come up with a way to query the values in two different columns in the same table where the result set will indicate instances where the value of columnB doesn't contain the value of columnA. For example, my "Nodes" table contains columns "NodeName" and "DNS". The values should look similar to the following: NodeName DNS Router1 Router1.mydomain.com I want to run a query to show which rows have a DNS value that does not contain (or begin with) the value of the NodeName field. I think the query should function something similar to the following, but obviously I'm missing something with regard to the use of "Like" in this situation. SELECT NodeName, DNS WHERE DNS NOT LIKE 'NodeName%' I'm using SQL Server 2005, and any suggestions would be greatly appreciated... :)

    Read the article

  • C#/ASP.NET MVC 4 Instantiate Object Derived From Interface In Factory Method

    - by Chris
    Currently have a Factory class that features a GetSelector function, which returns a concrete implementation of ISelector. I have several different classes that implement ISelector and based on a setting I would like to receive the appropriate ISelector back. public interface ISelector { string GetValue(string Params); } public class XmlSelector : ISelector { public string GetValue(string Params) { // open XML file and get value } } public static class SelectorFactory { public static ISelector GetSelector() { return new XmlSelector(); // Needs changing to look at settings } } My question is what is the best way to store the setting? I am aware of using AppSettings etc. but I'm not sure whether I want to have to store strings in the web.config and perform a switch on it - just seems to be really tightly coupled in that if a new implementation of ISelector is made, then the Factory would need to be changed. Is there any way of perhaps storing an assembly name and instantiating based on that? Thanks, Chris

    Read the article

  • Alignment of Hebrew Vowel points in Android

    - by Aharon Manne
    I want to display Hebrew text with vowel points (nikkud) using the Canvas.drawText interface. The vowel points come out misaligned, as in the following image taken using a Motorola Defy+ device: The hiriq is between the resh and the yod, the holam between the vav and nun. I have added the rtl code (\u200F) to the string at both ends, no joy. I know that there are applications that have solved this problem, such as the Smart Siddur. Is there a difference between text-based applications and graphics based? I would think that the same engine renders the text in both cases. I suppose I could split up the string and place the vowels separately, but that seems pretty painful and not extensible. TIA for any clues.

    Read the article

  • How can I substitute the nth occurrence of a match in a Perl regex?

    - by Zaid
    Following up from an earlier question on extracting the n'th regex match, I now need to substitute the match, if found. I thought that I could define the extraction subroutine and call it in the substitution with the /e modifier. I was obviously wrong (admittedly, I had an XY problem). use strict; use warnings; sub extract_quoted { # à la codaddict my ($string, $index) = @_; while($string =~ /'(.*?)'/g) { $index--; return $1 if(! $index); } return; } my $string = "'How can I','use' 'PERL','to process this' 'line'"; extract_quoted ( $string, 3 ); $string =~ s/&extract_quoted($string,2)/'Perl'/e; print $string; # Prints 'How can I','use' 'PERL','to process this' 'line' There are, of course, many other issues with this technique: What if there are identical matches at different positions? What if the match isn't found? In light of this situation, I'm wondering in what ways this could be implemented.

    Read the article

  • Adding data (not only text) to a multi column ListView (WPF)

    - by user811804
    I am working on a WPF application in C# (.NET 4.0) where I have a ListView with a GridView that has two columns. I dynamically want to add rows (in code). My dilemma is that only the first column will have regular text added to it. The second column will have an object that includes a multi column Grid with TextBlocks. (see link http://imageshack.us/photo/my-images/803/listview.png/) If I do what you would normally do when you want to enter text in all columns (ie. DisplayMemberBinding) all I get in the second column is the text "System.Windows.Grid", which obviously isn't what I want. For reference if I just try to add the Grid object (with the TextBlocks) with the code listView1.Items.Add(grid1) (not using DisplayMemberBinding) the object gets added to the second column only (with the first column being blank) and not how it normally works with text where the same text ends up in all columns. I hope my question is detailed enough and any help with this would be much appreciated. EDIT: I have tried the following code, howeever every time I click the button to add a new row every single row gets updated with the same datatemplate. (ie. the second column always shows the same data on every row.) xaml: <Window x:Class="TEST.MainWindow" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" Name="AAA" Title="MainWindow" Height="350" Width="525" Loaded="Window_Loaded"> <Grid Name="grid1"> <Grid.ColumnDefinitions> <ColumnDefinition Width="374*" /> <ColumnDefinition Width="129*" /> </Grid.ColumnDefinitions> <Button Content="Button" Height="23" HorizontalAlignment="Left" Margin="21,12,0,0" Name="button1" VerticalAlignment="Top" Width="75" Grid.Column="1" Click="button1_Click" /> </Grid> code: public partial class MainWindow : Window { ListView listView1 = new ListView(); GridViewColumn viewCol2 = new GridViewColumn(); public MainWindow() { InitializeComponent(); Style style = new Style(typeof(ListViewItem)); style.Setters.Add(new Setter(ListViewItem.HorizontalContentAlignmentProperty, HorizontalAlignment.Stretch)); listView1.ItemContainerStyle = style; GridView gridView1 = new GridView(); listView1.View = gridView1; GridViewColumn viewCol1 = new GridViewColumn(); viewCol1.Header = "Option"; gridView1.Columns.Add(viewCol1); viewCol2.Header = "Value"; gridView1.Columns.Add(viewCol2); grid1.Children.Add(listView1); viewCol1.DisplayMemberBinding = new Binding("Option"); } private void Window_Loaded(object sender, RoutedEventArgs e) { } private void button1_Click(object sender, RoutedEventArgs e) { DataTemplate dataTemplate = new DataTemplate(); FrameworkElementFactory spFactory = new FrameworkElementFactory(typeof(Grid)); Random random = new Random(); int cols = random.Next(1, 6); int full = 100; for (int i = 0; i < cols; i++) { FrameworkElementFactory col1 = new FrameworkElementFactory(typeof(ColumnDefinition)); int partWidth = random.Next(0, full); full -= partWidth; col1.SetValue(ColumnDefinition.WidthProperty, new GridLength(partWidth, GridUnitType.Star)); spFactory.AppendChild(col1); } if (full > 0) { FrameworkElementFactory col1 = new FrameworkElementFactory(typeof(ColumnDefinition)); col1.SetValue(ColumnDefinition.WidthProperty, new GridLength(full, GridUnitType.Star)); spFactory.AppendChild(col1); } for (int i = 0; i < cols; i++) { FrameworkElementFactory text1 = new FrameworkElementFactory(typeof(TextBlock)); SolidColorBrush sb1 = new SolidColorBrush(); switch (i) { case 0: sb1.Color = Colors.Blue; break; case 1: sb1.Color = Colors.Red; break; case 2: sb1.Color = Colors.Yellow; break; case 3: sb1.Color = Colors.Green; break; case 4: sb1.Color = Colors.Purple; break; case 5: sb1.Color = Colors.Pink; break; case 6: sb1.Color = Colors.Brown; break; } text1.SetValue(TextBlock.BackgroundProperty, sb1); text1.SetValue(Grid.ColumnProperty, i); spFactory.AppendChild(text1); } if (full > 0) { FrameworkElementFactory text1 = new FrameworkElementFactory(typeof(TextBlock)); SolidColorBrush sb1 = new SolidColorBrush(Colors.Black); text1.SetValue(TextBlock.BackgroundProperty, sb1); text1.SetValue(Grid.ColumnProperty, cols); spFactory.AppendChild(text1); } dataTemplate.VisualTree = spFactory; viewCol2.CellTemplate = dataTemplate; int rows = listView1.Items.Count + 1; listView1.Items.Add(new { Option = "Row " + rows }); } }

    Read the article

  • Dependecy Injection with Massive ORM: dynamic trouble

    - by Sergi Papaseit
    I've started working on an MVC 3 project that needs data from an enormous existing database. My first idea was to go ahead and use EF 4.1 and create a bunch of POCO's to represent the tables I need, but I'm starting to think the mapping will get overly complicated as I only need some of the columns in some of the tables. (thanks to Steven for the clarification in the comments. So I thought I'd give Massive ORM a try. I normally use a Unit of Work implementation so I can keep everything nicely decoupled and can use Dependency Injection. This is part of what I have for Massive: public interface ISession { DynamicModel CreateTable<T>() where T : DynamicModel, new(); dynamic Single<T>(string where, params object[] args) where T : DynamicModel, new(); dynamic Single<T>(object key, string columns = "*") where T : DynamicModel, new(); // Some more methods supported by Massive here } And here's my implementation of the above interface: public class MassiveSession : ISession { public DynamicModel CreateTable<T>() where T : DynamicModel, new() { return new T(); } public dynamic Single<T>(string where, params object[] args) where T: DynamicModel, new() { var table = CreateTable<T>(); return table.Single(where, args); } public dynamic Single<T>(object key, string columns = "*") where T: DynamicModel, new() { var table = CreateTable<T>(); return table.Single(key, columns); } } The problem comes with the First(), Last() and FindBy() methods. Massive is based around a dynamic object called DynamicModel and doesn't define any of the above method; it handles them through a TryInvokeMethod() implementation overriden from DynamicObject instead: public override bool TryInvokeMember(InvokeMemberBinder binder, object[] args, out object result) { } I'm at a loss on how to "interface" those methods in my ISession. How could my ISession provide support for First(), Last() and FindBy()? Put it another way, how can I use all of Massive's capabilities and still be able to decouple my classes from data access?

    Read the article

  • WPF tree data binding

    - by Am
    Hi, I have a well defined tree repository. Where I can rename items, move them up, down, etc. Add new and delete. The data is stored in a table as follows: Index Parent Label Left Right 1 0 root 1 14 2 1 food 2 7 3 2 cake 3 4 4 2 pie 5 6 5 1 flowers 8 13 6 5 roses 9 10 7 5 violets 11 12 Representing the following tree: (1) root (14) (2) food (7) (8) flowers (13) (3) cake (4) (5) pie (6) (9) roeses (10) (11) violets (12) or root food cake pie flowers roses violets Now, my problem is how to represent this in a bindable way, so that a TreeView can handle all the possible data changes? Renaming is easy, all I need is to make the label an updatble field. But what if a user moves flowers above food? I can make the relevant data changes, but they cause a complete data change to all other items in the tree. And all the examples I found of bindable hierarchies are good for non static trees.. So my current (and bad) solution is to reload the displayed tree after relocation change. Any direction will be good. Thanks

    Read the article

  • Dependency injection and factory

    - by legenden
    Trying to figure out how to best handle the following scenario: Assume a RequestContext class which has a dependency to an external service, such as: public class RequestContext : IRequestContext { private readonly ServiceFactory<IWeatherService> _weatherService; public RequestContext(ServiceFactory<IWeatherService> weatherService, UserLocation location, string query) { _weatherService = weatherService; ... What sort of dependency should I require in the class that will ultimately instantiate RequestContext? It could be ServiceFactory<IWeatherService>, but that doesn't seem right, or I could create an IRequestContextFactory for it along the lines of: public class RequestContextFactory : IRequestContextFactory { private readonly ServiceFactory<IWeatherService> _weatherService; public RequestContextFactory(ServiceFactory<IWeatherService> weatherService) { _weatherService = weatherService; } public RequestContext Create(UserLocation location, string query) { return new RequestContext(_weatherService, location, query); } } And then pass the IRequestContextFactory through constructor injection. This seems like a good way to do it, but the problem with this approach is that I think it hinders discoverability (devs must know about the factory and implement it, which is not really apparent). Is there a better/more discoverable way that I'm missing?

    Read the article

  • Can anyone explain UriMatcher (Android SDK)?

    - by mobibob
    I have been tasked with designing my web services client code to use the utility class UriMatcher in the Android SDK. Unfortunately, the example in the Dev Guide does not relate to anything in my mind. I know I am missing some fundamental points to the functionality and possibly about Uri itself. If you can tie it to some web APIs that are accessible with HTTP POST request, that would be ideal.

    Read the article

  • Is factory method proper design for my problem?

    - by metdos
    Hello Everyone, here is my problem and I'm considering to use factory method in C++, what are your opinions ? There are a Base Class and a lot of Subclasses. I need to transfer objects on network via TCP. I will create objects in first side, and using this object I will create a byte array TCP message, and send it to other side. On the other side I will decompose TCP message, I will create object and I will add this object to a polymorphic queue.

    Read the article

< Previous Page | 137 138 139 140 141 142 143 144 145 146 147 148  | Next Page >