Search Results

Search found 62701 results on 2509 pages for 'sql function'.

Page 1471/2509 | < Previous Page | 1467 1468 1469 1470 1471 1472 1473 1474 1475 1476 1477 1478  | Next Page >

  • Configuring a html page from an original demo page

    - by Wold
    I forked into rainyday.js through github, an awesome javascript program made by maroslaw at this link: https://github.com/maroslaw/rainyday.js. Basically I tried taking his demo page and my own photo city.jpg and changed the applicable fields so that I could run it on my own site, but only the picture loads and the script itself doesn't start to run. I'm pretty new to html and javascript so I'm probably omitting something very simple, but here is the script for the demo code: <script src="rainyday.js"></script> <script> function getURLParameter(name) { return decodeURIComponent((new RegExp('[?|&]' + name + '=' + '([^&;]+?)(&|#|;|$)').exec(location.search)||[,''])[1].replace(/\+/g, '%20'))||null; } function demo() { var image = document.getElementById('background'); image.onload = function () { var engine = null; var preset = getURLParameter('preset') || '1'; if (preset === '1') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.rain([ [1, 2, 8000] ]); engine.rain([ [3, 3, 0.88], [5, 5, 0.9], [6, 2, 1] ], 100); } else if (preset === '2') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.VARIABLE_GRAVITY_ANGLE = Math.PI / 8; engine.rain([ [0, 2, 0.5], [4, 4, 1] ], 50); } else if (preset === '3') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.trail = engine.TRAIL_SMUDGE; engine.rain([ [0, 2, 0.5], [4, 4, 1] ], 100); } }; image.crossOrigin = 'anonymous'; if (getURLParameter('imgur')) { image.src = 'http://i.imgur.com/' + getURLParameter('imgur') + '.jpg'; } else if (getURLParameter('img')) { image.src = getURLParameter('img') + '.jpg'; } var youtube = getURLParameter('youtube'); if (youtube) { var div = document.getElementById('sound'); var player = document.createElement('iframe'); player.frameborder = '0'; player.height = '1'; player.width = '1'; player.src = 'https://youtube.com/embed/' + youtube + '?autoplay=1&controls=0&showinfo=0&autohide=1&loop=1'; div.appendChild(player); } } </script> This is where I am naming my background and specifying the photo from within the directory. <body onload="demo();"> <div id="sound" style="z-index: -1;"></div> <div id="parent"> <img id='background' alt="background" src="city.jpg" /> </div> </body> The actual code for the whole entire rainyday.js script can be found here: https://github.com/maroslaw/rainyday.js/blob/master/rainyday.js Thanks in advance for any help and advice!

    Read the article

  • Anything wrong with this code?

    - by Scott B
    Do I actually have to return $postID in each case, in the code below? This is code required for capturing the values of custom fields I've added to the WP post and page editor. Got the idea from here: http://apartmentonesix.com/2009/03/creating-user-friendly-custom-fields-by-modifying-the-post-page/ add_action('save_post', 'custom_add_save'); function custom_add_save($postID){ if (defined('DOING_AUTOSAVE') && DOING_AUTOSAVE) { return $postID; } else { // called after a post or page is saved if($parent_id = wp_is_post_revision($postID)) { $postID = $parent_id; } if ($_POST['my_customHeader']) { update_custom_meta($postID, $_POST['my_customHeader'], 'my_customHeader'); } else { update_custom_meta($postID, '', 'my_customHeader'); } if ($_POST['my_customTitle']) { update_custom_meta($postID, $_POST['my_customTitle'], 'my_customTitle'); } else { update_custom_meta($postID, '', 'my_customTitle'); } } return $postID; //IS THIS EVEN NECESSARY? } function update_custom_meta($postID, $newvalue, $field_name) { // To create new meta if(!get_post_meta($postID, $field_name)){ add_post_meta($postID, $field_name, $newvalue); }else{ // or to update existing meta update_post_meta($postID, $field_name, $newvalue); } }

    Read the article

  • Using JSON Data to Populate a Google Map with Database Objects

    - by MikeH
    I'm revising this question after reading the resources mentioned in the original answers and working through implementing it. I'm using the google maps api to integrate a map into my Rails site. I have a markets model with the following columns: ID, name, address, lat, lng. On my markets/index view, I want to populate a map with all the markets in my markets table. I'm trying to output @markets as json data, and that's where I'm running into problems. I have the basic map displaying, but right now it's just a blank map. I'm following the tutorials very closely, but I can't get the markers to generate dynamically from the json. Any help is much appreciated! Here's my setup: Markets Controller: def index @markets = Market.filter_city(params[:filter]) respond_to do |format| format.html # index.html.erb format.json { render :json => @market} format.xml { render :xml => @market } end end Markets/index view: <head> <script type="text/javascript" src="http://www.google.com/jsapi?key=GOOGLE KEY REDACTED, BUT IT'S THERE" > </script> <script type="text/javascript"> var markets = <%= @markets.to_json %>; </script> <script type="text/javascript" charset="utf-8"> google.load("maps", "2.x"); google.load("jquery", "1.3.2"); </script> </head> <body> <div id="map" style="width:400px; height:300px;"></div> </body> Public/javascripts/application.js: function initialize() { if (GBrowserIsCompatible() && typeof markets != 'undefined') { var map = new GMap2(document.getElementById("map")); map.setCenter(new GLatLng(40.7371, -73.9903), 13); map.addControl(new GLargeMapControl()); function createMarker(latlng, market) { var marker = new GMarker(latlng); var html="<strong>"+market.name+"</strong><br />"+market.address; GEvent.addListener(marker,"click", function() { map.openInfoWindowHtml(latlng, html); }); return marker; } var bounds = new GLatLngBounds; for (var i = 0; i < markets.length; i++) { var latlng=new GLatLng(markets[i].lat,markets[i].lng) bounds.extend(latlng); map.addOverlay(createMarker(latlng, markets[i])); } } } window.onload=initialize; window.onunload=GUnload;

    Read the article

  • Logical python question - handeling directories and files in them

    - by Konstantin
    Hello! I'm using this function to extract files from .zip archive and store it on the server: def unzip_file_into_dir(file, dir): import sys, zipfile, os, os.path os.makedirs(dir, 0777) zfobj = zipfile.ZipFile(file) for name in zfobj.namelist(): if name.endswith('/'): os.mkdir(os.path.join(dir, name)) else: outfile = open(os.path.join(dir, name), 'wb') outfile.write(zfobj.read(name)) outfile.close() And the usage: unzip_file_into_dir('/var/zips/somearchive.zip', '/var/www/extracted_zip') somearchive.zip have this structure: somearchive.zip 1.jpeg 2.jpeg another.jpeg or, somethimes, this one: somearchive.zip somedir/ 1.jpeg 2.jpeg another.jpeg Question is: how do I modify my function, so that my extracted_zip catalog would always contain just images, not images in another subdirectory, even if images are stored in somedir inside an archive.

    Read the article

  • tablednd post issue help please

    - by netrise
    Hi plz i got a terrible headache my script is very simple Why i can’t get $_POST['table-2'] after submiting update button, i want to get ID numbers sorted # index.php <head> <script src="jquery.js" type="text/javascript"></script><br /> <script src="jquery.tablednd.js" type="text/javascript"></script><br /> <script src="jqueryTableDnDArticle.js" type="text/javascript"></script><br /> </head> <body> <form method='POST' action=index.php> <table id="table-2" cellspacing="0" cellpadding="2"> <tr id="a"><td>1</td><td>One</td><td><input type="text" name="one" value="one"/></td></tr> <tr id="b"><td>2</td><td>Two</td><td><input type="text" name="two" value="two"/></td></tr> <tr id="c"><td>3</td><td>Three</td><td><input type="text" name="three" value="three"/></td></tr> <tr id="d"><td>4</td><td>Four</td><td><input type="text" name="four" value="four"/></td></tr> <tr id="e"><td>5</td><td>Five</td><td><input type="text" name="five" value="five"/></td></tr> </table> <input type="submit" name="update" value="Update"> </form> <?php $result[] = $_POST['table-2']; foreach($result as $value) { echo "$value<br/>"; } ?> </body> # jqueryTableDnDArticle.js …………. $(“#table-2?).tableDnD({ onDragClass: “myDragClass”, onDrop: function(table, row) { var rows = table.tBodies[0].rows; var debugStr = “Row dropped was “+row.id+”. New order: “; for (var i=0; i<rows.length; i++) { debugStr += rows[i].id+" "; } //$("#debugArea").html(debugStr); $.ajax({ type: "POST", url: "index.php", data: $.tableDnD.serialize(), success: function(html){ alert("Success"); } }); }, onDragStart: function(table, row) { $("#debugArea").html("Started dragging row "+row.id); } });

    Read the article

  • Anova test in the loop and outputing the p-value in separate column

    - by Juanhijuan
    Once again I'm trying to get an answer. I am already stuck for like 5h with that so that's why I keep trying to get an answer. That's my data: id Sequence variable value 75 AAAAGAAAVANQGKK BiotinControl1_2 3893050.50 192 AAAAGAAAVANQGKK BiotinControl1_2 900604.61 3770 AAFTKLDQVWGSE BiotinControl1_2 90008.14 The code which I am trying to use to calculate the p-value: My Code: tbl_anv <- tbl_all_onlyK[,c("id", "BiotinControl1_2", "BiotinControl2", "BiotinControl3", "BiotinTreatment1_2", "BiotinTreatment2", "BiotinTreatment3", "Sequence")] tbl_reo <- melt(tbl_anv, measure.vars=2:7) set.seed(1) vars <- c("id", "BiotinControl1_2", "BiotinControl2", "BiotinControl3", "BiotinTreatment1_2", "BiotinTreatment2", "BiotinTreatment3", "Sequence") tbl_reo <- as.data.frame(tbl_reo) by(tbl_reo,tbl_reo$Sequence,function(x){ anova(lm(value ~ variable, data = x))$"Pr(>F)"[1] }) An error ocurs: There were 50 or more warnings (use warnings() to see the first 50) Anyway, how can I do that and export the p-value in the separate column. That's what I tried to do on my own: aov_test <- by(tbl_reo,tbl_reo$Sequence,function(x){ anova(lm(value ~ variable, data = x))$"Pr(>F)"[1] }) tbl_reo[,5] <- aov.test[[1]]$'Pr(>F)'[1]

    Read the article

  • Explain a block of crazy JS code inside Sizzle(the CSS selector engine)

    - by Andy Li
    So, here is the function for pre-filtering "CHILD": function(match){ if ( match[1] === "nth" ) { // parse equations like 'even', 'odd', '5', '2n', '3n+2', '4n-1', '-n+6' var test = /(-?)(\d*)n((?:\+|-)?\d*)/.exec( match[2] === "even" && "2n" || match[2] === "odd" && "2n+1" || !/\D/.test( match[2] ) && "0n+" + match[2] || match[2]); // calculate the numbers (first)n+(last) including if they are negative match[2] = (test[1] + (test[2] || 1)) - 0; match[3] = test[3] - 0; } // TODO: Move to normal caching system match[0] = done++; return match; } The code is extracted from line 442-458 of sizzle.js. So, why is the line var test = ..., have the exec inputing a boolean? Or is that really a string? Can someone explain it by splitting it into a few more lines of code?

    Read the article

  • Generating random numbers in C

    - by moonstruckhorrors
    While searching for Tutorials on generating random numbers in C I found This Topic When I try to use the rand() function with parameters, I always get the random number generated 0. When I try to use the rand() function with parameters, I always get the value 41. And whenever I try to use arc4random() and random() functions, I get a LNK2019 error. Here's what I'm doing: #include <stdlib.h> int main() { int x; x = rand(6); printf("%d", x); } This code always generate 41. Where am I going wrong?? P.S. : I'm running Windows XP SP3 and using VS2010 Command Prompt as compiler. P.P.S. : Took me 15 minutes to learn how to format properly.

    Read the article

  • Getting value from key pair value into appended property using jQuery

    - by Neil
    How do I get the value from a key pair value into the rel property of an anchor tag? When I split the code to put the value in the correct place it doesn't work, the end of the a tag would appear on screen instead value wouldn't be applied. When I look at the resulting code in console in Firebug the rel and href swapped order so the rel is first. The 'key' should be and is in the correct location but the 'value' needs to be applied to the rel attribute. What am I doing wrong? $(function() { var obj = {"firstThing":"4","secondThing":"6","aThirdThing":"2","anotherThing":"3","followedByAnother":"4"}; $.each(obj, function(key,value) { $('#newmine').append("<li class='tagBlocks'>","<a href='#' rel=''>",value," ",key); }); });

    Read the article

  • Clear Select options when selecting one field while using multiple forms on same page

    - by Nizam
    Hi all, I have a situation where the second select list option is generated from the first select list selected option. Like when we select Country corresponding states are generated in next select list. In my case I am having multiple forms on single page which are same. Can anyone let me know how to implement it on multiple forms. I tried the following code but it didn't work $(".country").change(function(){ $.get("sample.php?val=" + $(this).val(), function(data){ $(this).parent().next().children('.state').children('option').remove(); $(this).parent().next().children('.state').append(data); }); Waiting for your support thanks in advance

    Read the article

  • Slider with keypress control bugs when keys pressed to quickly.

    - by Jaybuz
    Hello, I've made a slider that uses the left and right arrow keys to move the slide but when pressed to quickly it will bug a little and I was wondering if it's possible to limit the amount of presses in say a second. You can see it here: {link} $('#slider-nav div').click(function() { $('#slider-nav div').removeClass('selected').addClass(''); $('#slider-nav div:eq('+($.jcarousel.intval($(this).text())-1)+')').addClass('selected'); }) // Allow left and right keys to control slider $(document.documentElement).keypress(function(e) { var code = (e.keyCode ? e.keyCode : e.which); var direction = null; // handle cursor keys if (code == 37) { // left key direction = 'prev'; } else if (code == 39) { // right key direction = 'next'; } if (direction != null) { $('#slider-nav div.selected')[direction]().click(); } });

    Read the article

  • array won't work actionscript 3

    - by steve
    I've tried everything. Arrays are quite simple so I don't know why this doesn't function: var menuList:Array = [menu_bag_mc,menu_chips_mc,menu_coke_mc,menu_cup_mc,menu_deodorant_mc,menu_fork_mc,menu_knife_mc,menu_lighter_mc,menu_milk_mc,menu_pill_mc,menu_rings_mc,menu_shampoo_mc,menu_spoon_mc,menu_straw_mc,menu_toothbrush_mc,menu_trashbag_mc,menu_water_mc]; function captureAllClicks(event:MouseEvent):void { trace(menuList.indexOf(event.target)); } stage.addEventListener(MouseEvent.CLICK, captureAllClicks); Every time I click on any of the items on the stage (which are all given the instance names listed above. each is a tweening movieclip containing a button) I get a trace of -1. WHY?!

    Read the article

  • XQuery fn:replace not behaving as expected

    - by CoolGravatar
    I have an Excel worksheet in XML format which contains <Cell ss:StyleID="s127"><Data ss:Type="String">A01-Replace</Data></Cell> I want to replace @A01-Replace with a different string. I'm using the XQuery's replace function like so: let $excel := doc("excel.xml") let $test := "another string" return replace($excel, "(A[0-9]+-Replace)", $test) Before calling replace, the variable $excel is valid XML upon output. However, when I output $excel after I call the replace function, all of the XML tags have been stripped, and $excel is a string with the content of the cells as its values. I would like to keep the XML tags there. Any ideas?

    Read the article

  • Create new or update existing entity at one go with JPA

    - by Alex R
    A have a JPA entity that has timestamp field and is distinguished by a complex identifier field. What I need is to update timestamp in an entity that has already been stored, otherwise create and store new entity with the current timestamp. As it turns out the task is not as simple as it seems from the first sight. The problem is that in concurrent environment I get nasty "Unique index or primary key violation" exception. Here's my code: // Load existing entity, if any. Entity e = entityManager.find(Entity.class, id); if (e == null) { // Could not find entity with the specified id in the database, so create new one. e = entityManager.merge(new Entity(id)); } // Set current time... e.setTimestamp(new Date()); // ...and finally save entity. entityManager.flush(); Please note that in this example entity identifier is not generated on insert, it is known in advance. When two or more of threads run this block of code in parallel, they may simultaneously get null from entityManager.find(Entity.class, id) method call, so they will attempt to save two or more entities at the same time, with the same identifier resulting in error. I think that there are few solutions to the problem. Sure I could synchronize this code block with a global lock to prevent concurrent access to the database, but would it be the most efficient way? Some databases support very handy MERGE statement that updates existing or creates new row if none exists. But I doubt that OpenJPA (JPA implementation of my choice) supports it. Event if JPA does not support SQL MERGE, I can always fall back to plain old JDBC and do whatever I want with the database. But I don't want to leave comfortable API and mess with hairy JDBC+SQL combination. There is a magic trick to fix it using standard JPA API only, but I don't know it yet. Please help.

    Read the article

  • Searching with MATCH(), AGAINST() and AS score with mysqli and php

    - by Drew
    Below is the code I am using to search my table. I have made the relevant columns FULLTEXT in the table. This doesn't return me anything. Can someone tell me what it is that i'm doing wrong? Thanks in advance. $sql = 'SELECT id,uname,class,school, MATCH(uname, class, school) AGAINST(?) AS score FROM images WHERE MATCH(uname, class, school) AGAINST(? IN BOOLEAN MODE) ORDER BY score DES'; $stmt = $db_connection->prepare($sql); $stmt->bind_param('ss',$keyword,$keyword); $stmt->execute(); $stmt->store_result(); $stmt->bind_result($id,$uname,$class,$school); $xml = "<data>".PHP_EOL; while($stmt->fetch()){ $xml .= " <person>".PHP_EOL; $xml .= " <id>$id</id>".PHP_EOL; $xml .= " <name>$uname</name>".PHP_EOL; $xml .= " <class>$class</class>".PHP_EOL; $xml .= " <school>$school</school>".PHP_EOL; $xml .= " </person>".PHP_EOL; } $xml .= "</data>"; echo $xml; Below is an image of the indexes of the table:

    Read the article

  • NHibernate unintential lazy property loading

    - by chiccodoro
    I introduced a mapping for a business object which has (among others) a property called "Name": public class Foo : BusinessObjectBase { ... public virtual string Name { get; set; } } For some reason, when I fetch "Foo" objects, NHibernate seems to apply lazy property loading (for simple properties, not associations): The following code piece generates n+1 SQL statements, whereof the first only fetches the ids, and the remaining n fetch the Name for each record: ISession session = ...IQuery query = session.CreateQuery(queryString); ITransaction tx = session.BeginTransaction(); List<Foo> result = new List<Foo>(); foreach (Foo foo in query.Enumerable()) { result.Add(foo); } tx.Commit(); session.Close(); produces: NHibernate: select foo0_.FOO_ID as col_0_0_ from V1_FOO foo0_ NHibernate: SELECT foo0_.FOO_ID as FOO1_2_0_, foo0_.NAME as NAME2_0_ FROM V1_FOO foo0_ WHERE foo0_.FOO_ID=:p0;:p0 = 81 NHibernate: SELECT foo0_.FOO_ID as FOO1_2_0_, foo0_.NAME as NAME2_0_ FROM V1_FOO foo0_ WHERE foo0_.FOO_ID=:p0;:p0 = 36470 NHibernate: SELECT foo0_.FOO_ID as FOO1_2_0_, foo0_.NAME as NAME2_0_ FROM V1_FOO foo0_ WHERE foo0_.FOO_ID=:p0;:p0 = 36473 Similarly, the following code leads to a LazyLoadingException after session is closed: ISession session = ... ITransaction tx = session.BeginTransaction(); Foo result = session.Load<Foo>(id); tx.Commit(); session.Close(); Console.WriteLine(result.Name); Following this post, "lazy properties ... is rarely an important feature to enable ... (and) in Hibernate 3, is disabled by default." So what am I doing wrong? I managed to work around the LazyLoadingException by doing a NHibernateUtil.Initialize(foo) but the even worse part are the n+1 sql statements which bring my application to its knees. This is how the mapping looks like: <class name="Foo" table="V1_FOO"> ... <property name="Name" column="NAME"/> </class> BTW: The abstract "BusinessObjectBase" base class encapsulates the ID property which serves as the internal identifier.

    Read the article

  • JPA Inheritance and Relations - Clarification question

    - by Michael
    Here the scenario: I have a unidirectional 1:N Relation from Person Entity to Address Entity. And a bidirectional 1:N Relation from User Entity to Vehicle Entity. Here is the Address class: @Entity public class Address implements Serializable { private static final long serialVersionUID = 1L; @Id @GeneratedValue(strategy = GenerationType.AUTO) privat Long int ... The Vehicles Class: @Entity public class Vehicle implements Serializable { @Id @GeneratedValue(strategy = GenerationType.AUTO) private Long id; @ManyToOne private User owner; ... @PreRemove protected void preRemove() { //this.owner.removeVehicle(this); } public Vehicle(User owner) { this.owner = owner; ... The Person Class: @Entity @Inheritance(strategy = InheritanceType.JOINED) @DiscriminatorColumn(name="PERSON_TYP") public class Person implements Serializable { @Id protected String username; @OneToMany(cascade = CascadeType.ALL, orphanRemoval=true) @JoinTable(name = "USER_ADDRESS", joinColumns = @JoinColumn(name = "USERNAME"), inverseJoinColumns = @JoinColumn(name = "ADDRESS_ID")) protected List<Address> addresses; ... @PreRemove protected void prePersonRemove(){ this.addresses = null; } ... The User Class which is inherited from the Person class: @Entity @Table(name = "Users") @DiscriminatorValue("USER") public class User extends Person { @OneToMany(mappedBy = "owner", cascade = {CascadeType.PERSIST, CascadeType.REMOVE}) private List<Vehicle> vehicles; ... When I try to delete a User who has an address I have to use orphanremoval=true on the corresponding relation (see above) and the preRemove function where the address List is set to null. Otherwise (no orphanremoval and adress list not set to null) a foreign key contraint fails. When i try to delete a user who has an vehicle a concurrent Acces Exception is thrown when do not uncomment the "this.owner.removeVehicle(this);" in the preRemove Function of the vehicle. The thing i do not understand is that before i used this inheritance there was only a User class which had all relations: @Entity @Table(name = "Users") public class User implements Serializable { @Id protected String username; @OneToMany(mappedBy = "owner", cascade = {CascadeType.PERSIST, CascadeType.REMOVE}) private List<Vehicle> vehicles; @OneToMany(cascade = CascadeType.ALL) @JoinTable(name = "USER_ADDRESS", joinColumns = @JoinColumn(name = "USERNAME") inverseJoinColumns = @JoinColumn(name = "ADDRESS_ID")) ptivate List<Address> addresses; ... No orphanremoval, and the vehicle class has used the uncommented statement above in its preRemove function. And - I could delte a user who has an address and i could delte a user who has a vehicle. So why doesn't everything work without changes when i use inheritance? I use JPA 2.0, EclipseLink 2.0.2, MySQL 5.1.x and Netbeans 6.8

    Read the article

  • Why are functional languages considered a boon for multi threaded environments?

    - by Billy ONeal
    I hear a lot about functional languages, and how they scale well because there is no state around a function; and therefore that function can be massively parallelized. However, this makes little sense to me because almost all real-world practical programs need/have state to take care of. I also find it interesting that most major scaling libraries, i.e. MapReduce, are typically written in imperative languages like C or C++. I'd like to hear from the functional camp where this hype I'm hearing is coming from....

    Read the article

  • Why is FLD1 loading NaN instead?

    - by Bernd Jendrissek
    I have a one-liner C function that is just return value * pow(1.+rate, -delay); - it discounts a future value to a present value. The interesting part of the disassembly is 0x080555b9 : neg %eax 0x080555bb : push %eax 0x080555bc : fildl (%esp) 0x080555bf : lea 0x4(%esp),%esp 0x080555c3 : fldl 0xfffffff0(%ebp) 0x080555c6 : fld1 0x080555c8 : faddp %st,%st(1) 0x080555ca : fxch %st(1) 0x080555cc : fstpl 0x8(%esp) 0x080555d0 : fstpl (%esp) 0x080555d3 : call 0x8051ce0 0x080555d8 : fmull 0xfffffff8(%ebp) While single-stepping through this function, gdb says (rate is 0.02, delay is 2; you can see them on the stack): (gdb) si 0x080555c6 30 return value * pow(1.+rate, -delay); (gdb) info float R7: Valid 0x4004a6c28f5c28f5c000 +41.68999999999999773 R6: Valid 0x4004e15c28f5c28f6000 +56.34000000000000341 R5: Valid 0x4004dceb851eb851e800 +55.22999999999999687 R4: Valid 0xc0008000000000000000 -2 =R3: Valid 0x3ff9a3d70a3d70a3d800 +0.02000000000000000042 R2: Valid 0x4004ff147ae147ae1800 +63.77000000000000313 R1: Valid 0x4004e17ae147ae147800 +56.36999999999999744 R0: Valid 0x4004efb851eb851eb800 +59.92999999999999972 Status Word: 0x1861 IE PE SF TOP: 3 Control Word: 0x037f IM DM ZM OM UM PM PC: Extended Precision (64-bits) RC: Round to nearest Tag Word: 0x0000 Instruction Pointer: 0x73:0x080555c3 Operand Pointer: 0x7b:0xbff41d78 Opcode: 0xdd45 And after the fld1: (gdb) si 0x080555c8 30 return value * pow(1.+rate, -delay); (gdb) info float R7: Valid 0x4004a6c28f5c28f5c000 +41.68999999999999773 R6: Valid 0x4004e15c28f5c28f6000 +56.34000000000000341 R5: Valid 0x4004dceb851eb851e800 +55.22999999999999687 R4: Valid 0xc0008000000000000000 -2 R3: Valid 0x3ff9a3d70a3d70a3d800 +0.02000000000000000042 =R2: Special 0xffffc000000000000000 Real Indefinite (QNaN) R1: Valid 0x4004e17ae147ae147800 +56.36999999999999744 R0: Valid 0x4004efb851eb851eb800 +59.92999999999999972 Status Word: 0x1261 IE PE SF C1 TOP: 2 Control Word: 0x037f IM DM ZM OM UM PM PC: Extended Precision (64-bits) RC: Round to nearest Tag Word: 0x0020 Instruction Pointer: 0x73:0x080555c6 Operand Pointer: 0x7b:0xbff41d78 Opcode: 0xd9e8 After this, everything goes to hell. Things get grossly over or undervalued, so even if there were no other bugs in my freeciv AI attempt, it would choose all the wrong strategies. Like sending the whole army to the arctic. (Sigh, if only I were getting that far.) I must be missing something obvious, or getting blinded by something, because I can't believe that fld1 should ever possibly fail. Even less that it should fail only after a handful of passes through this function. On earlier passes the FPU correctly loads 1 into ST(0). The bytes at 0x080555c6 definitely encode fld1 - checked with x/... on the running process. What gives?

    Read the article

  • XCode, error: '_object' undeclared. Need some help solving this problem

    - by user309030
    I've got this code in my viewController.m file - (void)viewDidLoad { [super viewDidLoad]; GameLogic *_game = [[GameLogic alloc] init]; [_game initGame]; ....... } GameLogic is another class which I created. in the same viewController.m file, I have got another function - (void)test { if([_game returnElecFence]) { NSLog(@"YES"); } else { NSLog(@"NO"); } } Problem is, whenever the test function is called, I get an error saying '_game' undeclared. I tried putting the GameLogic init code in the .h file and on top of the @implementation to make it global but every method I tried resulted in a worse error. TIA to anyone who can suggest some ideas to clear this error up

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • approximating log10[x^k0 + k1]

    - by Yale Zhang
    Greetings. I'm trying to approximate the function Log10[x^k0 + k1], where .21 < k0 < 21, 0 < k1 < ~2000, and x is integer < 2^14. k0 & k1 are constant. For practical purposes, you can assume k0 = 2.12, k1 = 2660. The desired accuracy is 5*10^-4 relative error. This function is virtually identical to Log[x], except near 0, where it differs a lot. I already have came up with a SIMD implementation that is ~1.15x faster than a simple lookup table, but would like to improve it if possible, which I think is very hard due to lack of efficient instructions. My SIMD implementation uses 16bit fixed point arithmetic to evaluate a 3rd degree polynomial (I use least squares fit). The polynomial uses different coefficients for different input ranges. There are 8 ranges, and range i spans (64)2^i to (64)2^(i + 1). The rational behind this is the derivatives of Log[x] drop rapidly with x, meaning a polynomial will fit it more accurately since polynomials are an exact fit for functions that have a derivative of 0 beyond a certain order. SIMD table lookups are done very efficiently with a single _mm_shuffle_epi8(). I use SSE's float to int conversion to get the exponent and significand used for the fixed point approximation. I also software pipelined the loop to get ~1.25x speedup, so further code optimizations are probably unlikely. What I'm asking is if there's a more efficient approximation at a higher level? For example: Can this function be decomposed into functions with a limited domain like log2((2^x) * significand) = x + log2(significand) hence eliminating the need to deal with different ranges (table lookups). The main problem I think is adding the k1 term kills all those nice log properties that we know and love, making it not possible. Or is it? Iterative method? don't think so because the Newton method for log[x] is already a complicated expression Exploiting locality of neighboring pixels? - if the range of the 8 inputs fall in the same approximation range, then I can look up a single coefficient, instead of looking up separate coefficients for each element. Thus, I can use this as a fast common case, and use a slower, general code path when it isn't. But for my data, the range needs to be ~2000 before this property hold 70% of the time, which doesn't seem to make this method competitive. Please, give me some opinion, especially if you're an applied mathematician, even if you say it can't be done. Thanks.

    Read the article

  • How do I process a jQuery SVG group event in a single handler?

    - by rmflow
    I'm trying to draw a button using jQuery SVG, the button is a filled rect and the text is placed on top of the rect. Rect and text are grouped and I want to control the mouseover/mouseout events. The problem is: mouseover/mouseout events are triggered separately for every element of the group. Is it possible to make a single event handler for entire group? Here is an example: gClear = svg.group(); btClear = svg.rect(gClear, 10, 10, 100, h-20, 5 ,5, attrs); txtClear = svg.text(gClear, 35, 30, "Clear", {fontFamily: "Verdana", fontWeight: "bold", fontSize: "16px"}); $(gClear, svg.root()).bind("mouseover", function() { $(btClear).animate({svgFill: '#adf'}, 100); }).bind("mouseout", function() { $(btClear).animate({svgFill: '#fff'}, 100); }) When I move the mouse inside the rect the events mouseover/mouseout are triggered. Can I make "text" events transparent or can I have a single event handler for the group?

    Read the article

  • Validate zip and display error with onBlur event

    - by phil
    Check if zip is 5 digit number, if not then display 'zip is invalid'. I want to use onBlur event to trigger the display. But it's not working. <script> $(function(){ function valid_zip() { var pat=/^[0-9]{5}$/; if ( !pat.test( $('#zip').val() ) ) {$('#zip').after('<p>zip is invalid</p>');} } }) </script> zip (US only) <input type="text" name='zip' id='zip' maxlength="5" onBlur="valid_zip()">

    Read the article

  • Problems with display of UTF-8 encoded content from a DB

    - by LookUp Webmaster
    Dear members of the Stackoverflow community, We are developing a web application using the Zend Framework, and we are facing some encoding issues that we hope you might help us solve. The situation goes something like this: There are certain tables on a MySQL database that need to be displayed as html. Because the site is designed using the Spanish language, the database contains some characters like "á" or "ñ". Our internal policy is to set all the encodings as UTF-8, including all the databases and the tables. The problem is, that when we retrieve the content from the DB, some characters are displayed as question marks. We are out of ideas. These are all the things that we have already tried and double-checked: 1. The SQL file from which we load all the data is properly UTF-8 encoded. 2. The SQL is loaded through phpmyadmin (which is configured as UTF-8), and the resulting tables are displayed properly. 3. The netbeans environment used for coding is also set as UTF-8. The weird thing is that all the content that is hard-coded either as php or html is displayed properly. Only the values that are extracted from the database have issues. Any ideas? Thank you very much.

    Read the article

< Previous Page | 1467 1468 1469 1470 1471 1472 1473 1474 1475 1476 1477 1478  | Next Page >