Search Results

Search found 27946 results on 1118 pages for 'output buffer empty'.

Page 153/1118 | < Previous Page | 149 150 151 152 153 154 155 156 157 158 159 160  | Next Page >

  • Can I avoid a threaded UDP socket in Python dropping data?

    - by 666craig
    First off, I'm new to Python and learning on the job, so be gentle! I'm trying to write a threaded Python app for Windows that reads data from a UDP socket (thread-1), writes it to file (thread-2), and displays the live data (thread-3) to a widget (gtk.Image using a gtk.gdk.pixbuf). I'm using queues for communicating data between threads. My problem is that if I start only threads 1 and 3 (so skip the file writing for now), it seems that I lose some data after the first few samples. After this drop it looks fine. Even by letting thread 1 complete before running thread 3, this apparent drop is still there. Apologies for the length of code snippet (I've removed the thread that writes to file), but I felt removing code would just prompt questions. Hope someone can shed some light :-) import socket import threading import Queue import numpy import gtk gtk.gdk.threads_init() import gtk.glade import pygtk class readFromUDPSocket(threading.Thread): def __init__(self, socketUDP, readDataQueue, packetSize, numScans): threading.Thread.__init__(self) self.socketUDP = socketUDP self.readDataQueue = readDataQueue self.packetSize = packetSize self.numScans = numScans def run(self): for scan in range(1, self.numScans + 1): buffer = self.socketUDP.recv(self.packetSize) self.readDataQueue.put(buffer) self.socketUDP.close() print 'myServer finished!' class displayWithGTK(threading.Thread): def __init__(self, displayDataQueue, image, viewArea): threading.Thread.__init__(self) self.displayDataQueue = displayDataQueue self.image = image self.viewWidth = viewArea[0] self.viewHeight = viewArea[1] self.displayData = numpy.zeros((self.viewHeight, self.viewWidth, 3), dtype=numpy.uint16) def run(self): scan = 0 try: while True: if not scan % self.viewWidth: scan = 0 buffer = self.displayDataQueue.get(timeout=0.1) self.displayData[:, scan, 0] = numpy.fromstring(buffer, dtype=numpy.uint16) self.displayData[:, scan, 1] = numpy.fromstring(buffer, dtype=numpy.uint16) self.displayData[:, scan, 2] = numpy.fromstring(buffer, dtype=numpy.uint16) gtk.gdk.threads_enter() self.myPixbuf = gtk.gdk.pixbuf_new_from_data(self.displayData.tostring(), gtk.gdk.COLORSPACE_RGB, False, 8, self.viewWidth, self.viewHeight, self.viewWidth * 3) self.image.set_from_pixbuf(self.myPixbuf) self.image.show() gtk.gdk.threads_leave() scan += 1 except Queue.Empty: print 'myDisplay finished!' pass def quitGUI(obj): print 'Currently active threads: %s' % threading.enumerate() gtk.main_quit() if __name__ == '__main__': # Create socket (IPv4 protocol, datagram (UDP)) and bind to address socketUDP = socket.socket(socket.AF_INET, socket.SOCK_DGRAM) host = '192.168.1.5' port = 1024 socketUDP.bind((host, port)) # Data parameters samplesPerScan = 256 packetsPerSecond = 1200 packetSize = 512 duration = 1 # For now, set a fixed duration to log data numScans = int(packetsPerSecond * duration) # Create array to store data data = numpy.zeros((samplesPerScan, numScans), dtype=numpy.uint16) # Create queue for displaying from readDataQueue = Queue.Queue(numScans) # Build GUI from Glade XML file builder = gtk.Builder() builder.add_from_file('GroundVue.glade') window = builder.get_object('mainwindow') window.connect('destroy', quitGUI) view = builder.get_object('viewport') image = gtk.Image() view.add(image) viewArea = (1200, samplesPerScan) # Instantiate & start threads myServer = readFromUDPSocket(socketUDP, readDataQueue, packetSize, numScans) myDisplay = displayWithGTK(readDataQueue, image, viewArea) myServer.start() myDisplay.start() gtk.gdk.threads_enter() gtk.main() gtk.gdk.threads_leave() print 'gtk.main finished!'

    Read the article

  • How do you send a named pipe string from umnanaged to managed code space?

    - by billmcf
    I appear to have a named pipes 101 issue. I have a very simple set up to connect a simplex named pipe transmitting from a C++ unmanaged app to a C# managed app. The pipe connects, but I cannot send a "message" through the pipe unless I close the handle which appears to flush the buffer and pass the message through. It's like the message is blocked. I have tried reversing the roles of client/server and invoking them with different Flag combinations without any luck. I can easily send messages in the other direction from C# managed to C++ unmanaged. Does anyone have any insight. Can any of you guys successfully send messages from C++ unmanaged to C# managed? I can find plenty of examples of intra amanged or unmanaged pipes but not inter managed to/from unamanged - just claims to be able to do it. In the listings, I have omitted much of the wrapper stuff for clarity. The key bits I believe that are relevant are the pipe connection/creation/read and write methods. Don't worry too much about blocking/threading here. C# Server side // This runs in its own thread and so it is OK to block private void ConnectToClient() { // This server will listen to the sending client if (m_InPipeStream == null) { m_InPipeStream = new NamedPipeServerStream("TestPipe", PipeDirection.In, 1); } // Wait for client to connect to our server m_InPipeStream.WaitForConnection(); // Verify client is running if (!m_InPipeStream.IsConnected) { return; } // Start listening for messages on the client stream if (m_InPipeStream != null && m_InPipeStream.CanRead) { ReadThread = new Thread(new ParameterizedThreadStart(Read)); ReadThread.Start(m_InPipeStream); } } // This runs in its own thread and so it is OK to block private void Read(object serverObj) { NamedPipeServerStream pipeStream = (NamedPipeServerStream)serverObj; using (StreamReader sr = new StreamReader(pipeStream)) { while (true) { string buffer = "" ; try { // Blocks here until the handle is closed by the client-side!! buffer = sr.ReadLine(); // <<<<<<<<<<<<<< Sticks here } catch { // Read error break; } // Client has disconnected? if (buffer == null || buffer.Length == 0) break; // Fire message received event if message is non-empty if (MessageReceived != null && buffer != "") { MessageReceived(buffer); } } } } C++ client side // Static - running in its own thread. DWORD CNamedPipe::ListenForServer(LPVOID arg) { // The calling app (this) is passed as the parameter CNamedPipe* app = (CNamedPipe*)arg; // Out-Pipe: connect as a client to a waiting server app->m_hOutPipeHandle = CreateFile("\\\\.\\pipe\\TestPipe", GENERIC_WRITE, 0, NULL, OPEN_EXISTING, FILE_ATTRIBUTE_NORMAL, NULL); // Could not create handle if (app->m_hInPipeHandle == NULL || app->m_hInPipeHandle == INVALID_HANDLE_VALUE) { return 1; } return 0; } // Sends a message to the server BOOL CNamedPipe::SendMessage(CString message) { DWORD dwSent; if (m_hOutPipeHandle == NULL || m_hOutPipeHandle == INVALID_HANDLE_VALUE) { return FALSE; } else { BOOL bOK = WriteFile(m_hOutPipeHandle, message, message.GetLength()+1, &dwSent, NULL); //FlushFileBuffers(m_hOutPipeHandle); // <<<<<<< Tried this return (!bOK || (message.GetLength()+1) != dwSent) ? FALSE : TRUE; } } // Somewhere in the Windows C++/MFC code... ... // This write is non-blocking. It just passes through having loaded the pipe. m_pNamedPipe->SendMessage("Hi de hi"); ...

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • zlib gzgets extremely slow?

    - by monkeyking
    I'm doing stuff related to parsing huge globs of textfiles, and was testing what input method to use. There is not much of a difference using c++ std::ifstreams vs c FILE, According to the documentation of zlib, it supports uncompressed files, and will read the file without decompression. I'm seeing a difference from 12 seconds using non zlib to more than 4 minutes using zlib.h This I've tested doing multiple runs, so its not a disk cache issue. Am I using zlib in some wrong way? thanks #include <zlib.h> #include <cstdio> #include <cstdlib> #include <fstream> #define LENS 1000000 size_t fg(const char *fname){ fprintf(stderr,"\t-> using fgets\n"); FILE *fp =fopen(fname,"r"); size_t nLines =0; char *buffer = new char[LENS]; while(NULL!=fgets(buffer,LENS,fp)) nLines++; fprintf(stderr,"%lu\n",nLines); return nLines; } size_t is(const char *fname){ fprintf(stderr,"\t-> using ifstream\n"); std::ifstream is(fname,std::ios::in); size_t nLines =0; char *buffer = new char[LENS]; while(is. getline(buffer,LENS)) nLines++; fprintf(stderr,"%lu\n",nLines); return nLines; } size_t iz(const char *fname){ fprintf(stderr,"\t-> using zlib\n"); gzFile fp =gzopen(fname,"r"); size_t nLines =0; char *buffer = new char[LENS]; while(0!=gzgets(fp,buffer,LENS)) nLines++; fprintf(stderr,"%lu\n",nLines); return nLines; } int main(int argc,char**argv){ if(atoi(argv[2])==0) fg(argv[1]); if(atoi(argv[2])==1) is(argv[1]); if(atoi(argv[2])==2) iz(argv[1]); }

    Read the article

  • Progressively stream the output of an ASP.NET page - or render a page outside of an HTTP request

    - by Evgeny
    I have an ASP.NET 2.0 page with many repeating blocks, including a third-party server-side control (so it's not just plain HTML). Each is quite expensive to generate, in terms of both CPU and RAM. I'm currently using a standard Repeater control for this. There are two problems with this simple approach: The entire page must be rendered before any of it is returned to the client, so the user must wait a long time before they see any data. (I write progress messages using Response.Write, so there is feedback, but no actual results.) The ASP.NET worker process must hold everything in memory at the same time. There is no inherent needs for this: once one block is processed it won't be changed, so it could be returned to the client and the memory could be freed. I would like to somehow return these blocks to the client one at a time, as each is generated. I'm thinking of extracting the stuff inside the Repeater into a separate page and getting it repeatedly using AJAX, but there are some complications involved in that and I wonder if there is some simper approach. Ideally I'd like to keep it as one page (from the client's point of view), but return it incrementally. Another way would be to do something similar, but on the server: still create a separate page, but have the server access it and then Response.Write() the HTML it gets to the response stream for the real client request. Is there a way to avoid an HTTP request here, though? Is there some ASP.NET method that would render a UserControl or a Page outside of an HTTP request and simply return the HTML to me as a string? I'm open to other ideas on how to do this as well.

    Read the article

  • Why isn't my log4net appender buffering?

    - by Eric
    I've created a custom log4net appender. It descends from log4net.Appender.SmtpAppender which descends from log4net.Appender.BufferingAppenderSkeleton. I programatically setup the following parameters in its constructor: this.Lossy = false; //don't drop any messages this.BufferSize = 3; //buffer up to 3 messages this.Threshold = log4net.Core.Level.Error; //append messages of Error or higher this.Evaluator = new log4net.Core.LevelEvaluator(Level.Off); //don't flush the buffer for any message, regardless of level I expect this would buffer 3 events of level Error or higher and deliver those events when the buffer is filled. However, I'm finding that the events are not buffered at all; instead, SendBuffer() is called immediately every time an error is logged. Is there a mistake in my configuration? Thanks

    Read the article

  • boost.asio error on read from socket.

    - by niXman
    The following code of the client: typedef boost::array<char, 10> header_packet; header_packet header; boost::system::error_code error; ... /** send header */ boost::asio::write( _socket, boost::asio::buffer(header, header.size()), boost::asio::transfer_all(), error ); /** send body */ boost::asio::write( _socket, boost::asio::buffer(buffer, buffer.length()), boost::asio::transfer_all(), error ); of the server: struct header { boost::uint32_t header_length; boost::uint32_t id; boost::uint32_t body_length; }; static header unpack_header(const header_packet& data) { header hdr; sscanf(data.data(), "%02d%04d%04d", &hdr.header_length, &hdr.id, &hdr.body_length); return hdr; } void connection::start() { boost::asio::async_read( _socket, boost::asio::buffer(_header, _header.size()), boost::bind( &connection::read_header_handler, shared_from_this(), boost::asio::placeholders::error ) ); } /***************************************************************************/ void connection::read_header_handler(const boost::system::error_code& e) { if ( !e ) { std::cout << "readed header: " << _header.c_array() << std::endl; std::cout << constants::unpack_header(_header); boost::asio::async_read( _socket, boost::asio::buffer(_body, constants::unpack_header(_header).body_length), boost::bind( &connection::read_body_handler, shared_from_this(), boost::asio::placeholders::error ) ); } else { /** report error */ std::cout << "read header finished with error: " << e.message() << std::endl; } } /***************************************************************************/ void connection::read_body_handler(const boost::system::error_code& e) { if ( !e ) { std::cout << "readed body: " << _body.c_array() << std::endl; start(); } else { /** report error */ std::cout << "read body finished with error: " << e.message() << std::endl; } } On the server side the method read_header_handler() is called, but the method read_body_handler() is never called. Though the client has written down the data in a socket. The header is readed and decoded successfully. What's the error?

    Read the article

  • Read non-blocking from multiple fifos in parallel

    - by Ole Tange
    I sometimes sit with a bunch of output fifos from programs that run in parallel. I would like to merge these fifos. The naïve solution is: cat fifo* > output But this requires the first fifo to complete before reading the first byte from the second fifo, and this will block the parallel running programs. Another way is: (cat fifo1 & cat fifo2 & ... ) > output But this may mix the output thus getting half-lines in output. When reading from multiple fifos, there must be some rules for merging the files. Typically doing it on a line by line basis is enough for me, so I am looking for something that does: parallel_non_blocking_cat fifo* > output which will read from all fifos in parallel and merge the output on with a full line at a time. I can see it is not hard to write that program. All you need to do is: open all fifos do a blocking select on all of them read nonblocking from the fifo which has data into the buffer for that fifo if the buffer contains a full line (or record) then print out the line if all fifos are closed/eof: exit goto 2 So my question is not: can it be done? My question is: Is it done already and can I just install a tool that does this?

    Read the article

  • Same IL code, different output - how is it possible?

    - by Hali
    When I compile this code with mono (gmcs) and run it, it outputs -1 (both with mono and .Net framework). When I compile it with VS (csc), it outputs -1 when I run it with mono, and 0 when I run it with the .Net framework. The code in question is: using System; public class Program { public static void Main() { Console.WriteLine(string.Compare("alo\0alo\0", "alo\0alo\0\0", false, System.Globalization.CultureInfo.InvariantCulture)); } } Compiled with VS: .method public hidebysig static void Main() cil managed { .entrypoint // Code size 29 (0x1d) .maxstack 8 IL_0000: nop IL_0001: ldstr bytearray (61 00 6C 00 6F 00 00 00 61 00 6C 00 6F 00 00 00 ) // a.l.o...a.l.o... IL_0006: ldstr bytearray (61 00 6C 00 6F 00 00 00 61 00 6C 00 6F 00 00 00 // a.l.o...a.l.o... 00 00 ) IL_000b: ldc.i4.0 IL_000c: call class [mscorlib]System.Globalization.CultureInfo [mscorlib]System.Globalization.CultureInfo::get_InvariantCulture() IL_0011: call int32 [mscorlib]System.String::Compare(string, string, bool, class [mscorlib]System.Globalization.CultureInfo) IL_0016: call void [mscorlib]System.Console::WriteLine(int32) IL_001b: nop IL_001c: ret } // end of method Program::Main Compiled with mono: .method public hidebysig static void Main() cil managed { .entrypoint // Code size 27 (0x1b) .maxstack 8 IL_0000: ldstr bytearray (61 00 6C 00 6F 00 00 00 61 00 6C 00 6F 00 00 00 ) // a.l.o...a.l.o... IL_0005: ldstr bytearray (61 00 6C 00 6F 00 00 00 61 00 6C 00 6F 00 00 00 // a.l.o...a.l.o... 00 00 ) IL_000a: ldc.i4.0 IL_000b: call class [mscorlib]System.Globalization.CultureInfo [mscorlib]System.Globalization.CultureInfo::get_InvariantCulture() IL_0010: call int32 [mscorlib]System.String::Compare(string, string, bool, class [mscorlib]System.Globalization.CultureInfo) IL_0015: call void [mscorlib]System.Console::WriteLine(int32) IL_001a: ret } // end of method Program::Main The only difference is the two extra NOP instructions in the VS version. How is it possible?

    Read the article

  • Bash: Is it ok to use same input file as output of a piped command?

    - by Amro
    Consider something like: cat file | command > file Is this good practice? Could this overwrite the input file as the same time as we are reading it, or is it always read first in memory then piped to second command? Obviously I can use temp files as intermediary step, but I'm just wondering.. t=$(mktemp) cat file | command > ${t} && mv ${t} file

    Read the article

  • Why in the following code the output is different when I compile or run it more than once

    - by Sanjeev
    class Name implements Runnable { public void run() { for (int x = 1; x <= 3; x++) { System.out.println("Run by " + Thread.currentThread().getName() + ", x is " + x); } } } public class Threadtest { public static void main(String [] args) { // Make one Runnable Name nr = new Name(); Thread one = new Thread(nr); Thread two = new Thread(nr); Thread three = new Thread(nr); one.setName("A"); two.setName("B"); three.setName("C"); one.start(); two.start(); three.start(); } } The answer is different while compiling and running more then one time I don't know why? any idea.

    Read the article

  • MySQL Query, limit output display according/only to associated ID!

    - by Jess
    So here's my situation. I have a books table and authors table. An author can have many books... In my authors page view, the user (logged in) can click an author in a tabled row and be directed to a page displaying the author's books (collected like this URI format: viewauthorbooks.php?author_id=23), very straight forward... However, in my query, I need to display the books for the author only, and not all books stored in the books table (as i currently have!) As I am a complete novice, I used the most simple query of: SELECT * FROM tasks_tb :)....this returns the books for me, but returns every single value (book) in the database, and not ones associated with the selected author. And when I click a different author the same books are displayed for them...I think everyone gets what I'm trying to achieve, I just don't know how to perform the query. I'm guessing that I need to start using more advanced query clauses like INNER JOIN etc. Anyone care to help me out :)

    Read the article

  • how to mount partitions from USB drives in Windows using Delphi?

    - by user569556
    Hi. I'm a Delphi programmer. I want to mount all partitions from USB drives in Windows (XP). The OS is doing this automatically but there are situations when such a program is useful. I know how to find if a drive is on USB or not. My code so far is: type STORAGE_QUERY_TYPE = (PropertyStandardQuery = 0, PropertyExistsQuery, PropertyMaskQuery, PropertyQueryMaxDefined); TStorageQueryType = STORAGE_QUERY_TYPE; STORAGE_PROPERTY_ID = (StorageDeviceProperty = 0, StorageAdapterProperty); TStoragePropertyID = STORAGE_PROPERTY_ID; STORAGE_PROPERTY_QUERY = packed record PropertyId: STORAGE_PROPERTY_ID; QueryType: STORAGE_QUERY_TYPE; AdditionalParameters: array[0..9] of AnsiChar; end; TStoragePropertyQuery = STORAGE_PROPERTY_QUERY; STORAGE_BUS_TYPE = (BusTypeUnknown = 0, BusTypeScsi, BusTypeAtapi, BusTypeAta, BusType1394, BusTypeSsa, BusTypeFibre, BusTypeUsb, BusTypeRAID, BusTypeiScsi, BusTypeSas, BusTypeSata, BusTypeMaxReserved = $7F); TStorageBusType = STORAGE_BUS_TYPE; STORAGE_DEVICE_DESCRIPTOR = packed record Version: DWORD; Size: DWORD; DeviceType: Byte; DeviceTypeModifier: Byte; RemovableMedia: Boolean; CommandQueueing: Boolean; VendorIdOffset: DWORD; ProductIdOffset: DWORD; ProductRevisionOffset: DWORD; SerialNumberOffset: DWORD; BusType: STORAGE_BUS_TYPE; RawPropertiesLength: DWORD; RawDeviceProperties: array[0..0] of AnsiChar; end; TStorageDeviceDescriptor = STORAGE_DEVICE_DESCRIPTOR; const IOCTL_STORAGE_QUERY_PROPERTY = $002D1400; var i: Integer; H: THandle; USBDrives: array of Byte; Query: TStoragePropertyQuery; dwBytesReturned: DWORD; Buffer: array[0..1023] of Byte; sdd: TStorageDeviceDescriptor absolute Buffer; begin SetLength(UsbDrives, 0); SetErrorMode(SEM_FAILCRITICALERRORS); for i := 0 to 99 do begin H := CreateFile(PChar('\\.\PhysicalDrive' + IntToStr(i)), 0, FILE_SHARE_READ or FILE_SHARE_WRITE, nil, OPEN_EXISTING, 0, 0); if H <> INVALID_HANDLE_VALUE then begin try dwBytesReturned := 0; FillChar(Query, SizeOf(Query), 0); FillChar(Buffer, SizeOf(Buffer), 0); sdd.Size := SizeOf(Buffer); Query.PropertyId := StorageDeviceProperty; Query.QueryType := PropertyStandardQuery; if DeviceIoControl(H, IOCTL_STORAGE_QUERY_PROPERTY, @Query, SizeOf(Query), @Buffer, SizeOf(Buffer), dwBytesReturned, nil) then if sdd.BusType = BusTypeUsb then begin SetLength(USBDrives, Length(USBDrives) + 1); UsbDrives[High(USBDrives)] := Byte(i); end; finally CloseHandle(H); end; end; end; for i := 0 to High(USBDrives) do begin // end; end. But I don't know how to access partitions on each drive and mounts them. Can you please help me? I searched before I asked and I couldn't find a working code. But if I did not properly then I'm sorry and please show me that topic. Best regards, John

    Read the article

  • Why does this log output show the same answer in each iteration?

    - by Will Hancock
    OK, I was reading an article on optimising JS for Googles V8 engine, when i saw this code example... I nearly skimmed over it, but then I saw this; |=; a[0] |= b; a = new Array(); a[0] = 0; for (var b = 0; b < 10; b++) { console.log(a, b) a[0] |= b; // Much better! 2x faster. } a[0] |= b; So I ran it, in my console, with a console.log in the loop and resulted in 15; [15] 0 [15] 1 [15] 2 [15] 3 [15] 4 [15] 5 [15] 6 [15] 7 [15] 8 [15] 9 WHAT?!?! Where the hell does it get 15 from, on every iteration?!?!?! I've been a web dev for 7 years, and this has stumped me and a fellow colleague. Can somebody talk me through this code? Cheers.

    Read the article

  • How do I output the preorder traversal of a tree given the inorder and postorder tranversal?

    - by user342580
    Given the code for outputing the postorder traversal of a tree when I have the preorder and the inorder traversal in an interger array. How do I similarily get the preorder with the inorder and postorder array given? void postorder( int preorder[], int prestart, int inorder[], int inostart, int length) { if(length==0) return; //terminating condition int i; for(i=inostart; i<inostart+length; i++) if(preorder[prestart]==inorder[i])//break when found root in inorder array break; postorder(preorder, prestart+1, inorder, inostart, i-inostart); postorder(preorder, prestart+i-inostart+1, inorder, i+1, length-i+inostart-1); cout<<preorder[prestart]<<" "; } Here is the prototype for preorder() void preorder( int inorderorder[], int inostart, int postorder[], int poststart, int length)

    Read the article

  • get the current time in C

    - by Antrromet
    I want to get the current time of my system. For that i'm using the following code in C. time_t now; struct tm *mytime = localtime(&now); if ( strftime(buffer, sizeof buffer, "%X", mytime) ) { printf("time1 = \"%s\"\n", buffer); } But the problem of this code is that its giving some random time.Also the random time is different all the time.I want the current time of my system. Can anyone please tell me how to solve this issue?

    Read the article

  • Is the C++ compiler optimizer allowed to break my destructor ability to be called multiple times?

    - by sharptooth
    We once had an interview with a very experienced C++ developer who couldn't answer the following question: is it necessary to call the base class destructor from the derived class destructor in C++? Obviously the answer is no, C++ will call the base class destructor automagically anyway. But what if we attempt to do the call? As I see it the result will depend on whether the base class destructor can be called twice without invoking erroneous behavior. For example in this case: class BaseSafe { public: ~BaseSafe() { } private: int data; }; class DerivedSafe { public: ~DerivedSafe() { BaseSafe::~BaseSafe(); } }; everything will be fine - the BaseSafe destructor can be called twice safely and the program will run allright. But in this case: class BaseUnsafe { public: BaseUnsafe() { buffer = new char[100]; } ~BaseUnsafe () { delete[] buffer; } private: char* buffer; }; class DerivedUnsafe { public: ~DerivedUnsafe () { BaseUnsafe::~BaseUnsafe(); } }; the explicic call will run fine, but then the implicit (automagic) call to the destructor will trigger double-delete and undefined behavior. Looks like it is easy to avoid the UB in the second case. Just set buffer to null pointer after delete[]. But will this help? I mean the destructor is expected to only be run once on a fully constructed object, so the optimizer could decide that setting buffer to null pointer makes no sense and eliminate that code exposing the program to double-delete. Is the compiler allowed to do that?

    Read the article

  • Why is C++ fwrite() producing larger output in release?

    - by waffleShirt
    I recently wrote an implementation of the Canonical Huffman compression algorithm. I have a 500kb test file that can be compressed to about 250kb when running the debug and release builds from within Visual Studio 2008. However when I run the release build straight from the executeable the test file only compresses to about 330kb. I am assuming that something is going wrong when the file is written using fwrite(). I have tested the program and confirmed that uncompressing the files always produces the correct uncompressed file. Does anyone know why this could possibly be? How could the same executeable file be producing different sized outputs based on where it is launched from?

    Read the article

  • What happens when we say "listen to a port" ?

    - by smwikipedia
    Hi, When we start a server application, we always need to speicify the port number it listens to. But how is this "listening mechanism" implemented under the hood? My current imagination is like this: The operating system associate the port number with some buffer. The server application's responsibiligy is to monitor this buffer. If there's no data in this buffer, the server application's listen operation will just block the application. When some data arrives from the wire, the operating system will know that check the data and see if it is targed at this port number. And then it will fill the buffer. And then OS will notify the blocked server application and the server application will get the data and continue to run. Question is: If the above scenario is correct, how could the opearting system know there's data arriving from wire? It cannot be a busy pooling. Is it some kind of interrupt-based mechanism? If there's too much data arriving and the buffer is not big enough, will there be data loss? Is the "listen to a port" operation really a blocking operation? Many thanks.

    Read the article

< Previous Page | 149 150 151 152 153 154 155 156 157 158 159 160  | Next Page >