Search Results

Search found 27946 results on 1118 pages for 'output buffer empty'.

Page 152/1118 | < Previous Page | 148 149 150 151 152 153 154 155 156 157 158 159  | Next Page >

  • Something like System.Diagnostics.Process.Start to run a stream

    - by phenevo
    Hi, I get from server images and videos by stream. Now I'm saving it: Stream str = client.GetFile(path); using (var outStream = new FileStream(@"c:\myFile.jpg", FileMode.Create)) { var buffer = new byte[4096]; int count; while ((count = str.Read(buffer, 0, buffer.Length)) > 0) { outStream.Write(buffer, 0, count); } } I can be jpg, mpg, flv and a lot of other multimedia types (Before I get stream I know what is a extension of this file). Now I want to not save it , bu run direct from stream. Is it possible ??

    Read the article

  • Large File Download - Connection With Server Reset

    - by daveywc
    I have an asp.net website that allows the user to download largish files - 30mb to about 60mb. Sometimes the download works fine but often it fails at some varying point before the download finishes with the message saying that the connection with the server was reset. Originally I was simply using Server.TransmitFile but after reading up a bit I am now using the code posted below. I am also setting the Server.ScriptTimeout value to 3600 in the Page_Init event. private void DownloadFile(string fname, bool forceDownload) { string path = MapPath(fname); string name = Path.GetFileName(path); string ext = Path.GetExtension(path); string type = ""; // set known types based on file extension if (ext != null) { switch (ext.ToLower()) { case ".mp3": type = "audio/mpeg"; break; case ".htm": case ".html": type = "text/HTML"; break; case ".txt": type = "text/plain"; break; case ".doc": case ".rtf": type = "Application/msword"; break; } } if (forceDownload) { Response.AppendHeader("content-disposition", "attachment; filename=" + name.Replace(" ", "_")); } if (type != "") { Response.ContentType = type; } else { Response.ContentType = "application/x-msdownload"; } System.IO.Stream iStream = null; // Buffer to read 10K bytes in chunk: byte[] buffer = new Byte[10000]; // Length of the file: int length; // Total bytes to read: long dataToRead; try { // Open the file. iStream = new System.IO.FileStream(path, System.IO.FileMode.Open, System.IO.FileAccess.Read, System.IO.FileShare.Read); // Total bytes to read: dataToRead = iStream.Length; //Response.ContentType = "application/octet-stream"; //Response.AddHeader("Content-Disposition", "attachment; filename=" + filename); // Read the bytes. while (dataToRead > 0) { // Verify that the client is connected. if (Response.IsClientConnected) { // Read the data in buffer. length = iStream.Read(buffer, 0, 10000); // Write the data to the current output stream. Response.OutputStream.Write(buffer, 0, length); // Flush the data to the HTML output. Response.Flush(); buffer = new Byte[10000]; dataToRead = dataToRead - length; } else { //prevent infinite loop if user disconnects dataToRead = -1; } } } catch (Exception ex) { // Trap the error, if any. Response.Write("Error : " + ex.Message); } finally { if (iStream != null) { //Close the file. iStream.Close(); } Response.Close(); } }

    Read the article

  • Corrupted NTFS Drive showing multiple unallocated partitions

    - by volting
    My external hdd with a single NTFS partition was accidentaly plugged out (kids!)... and is now corrupted. Iv tried running ntfsfix - with no luck - output below.. When I look at the disk under disk management in Windows 7 it shows up as having 5 partitions 2 of which are unallocated - none have drive letters and it is not possible to set any (that option and most others are greyed out) - so I can't run chkdsk /f Iv tried using Minitool partition wizard which was mentioned as a solution to another similar question here. It showed the whole drive as one partition, but as unallocated, and the option -- "Check File System" was greyout. Is there anything else I could try ? Output of fdisk -l Disk /dev/sdb: 1500.3 GB, 1500299395072 bytes 255 heads, 63 sectors/track, 182401 cylinders, total 2930272256 sectors Units = sectors of 1 * 512 = 512 bytes Sector size (logical/physical): 512 bytes / 512 bytest I/O size (minimum/optimal): 512 bytes / 512 bytes Disk identifier: 0x69205244 This doesn't look like a partition table Probably you selected the wrong device. Device Boot Start End Blocks Id System /dev/sdb1 ? 218129509 1920119918 850995205 72 Unknown /dev/sdb2 ? 729050177 1273024900 271987362 74 Unknown /dev/sdb3 ? 168653938 168653938 0 65 Novell Netware 386 /dev/sdb4 2692939776 2692991410 25817+ 0 Empty Partition table entries are not in disk order Output of ntfsfix me@vaio:/dev$ sudo ntfsfix /dev/sdb Mounting volume... ntfs_mst_post_read_fixup_warn: magic: 0xffffffff size: 1024 usa_ofs: 65535 usa_count: 65534: Invalid argument Record 0 has no FILE magic (0xffffffff) Failed to load $MFT: Input/output error FAILED Attempting to correct errors... ntfs_mst_post_read_fixup_warn: magic: 0xffffffff size: 1024 usa_ofs: 65535 usa_count: 65534: Invalid argument Record 0 has no FILE magic (0xffffffff) Failed to load $MFT: Input/output error FAILED Failed to startup volume: Input/output error Checking for self-located MFT segment... ntfs_mst_post_read_fixup_warn: magic: 0xffffffff size: 1024 usa_ofs: 65535 usa_count: 65534: Invalid argument OK ntfs_mst_post_read_fixup_warn: magic: 0xffffffff size: 1024 usa_ofs: 65535 usa_count: 65534: Invalid argument Record 0 has no FILE magic (0xffffffff) Failed to load $MFT: Input/output error Volume is corrupt. You should run chkdsk. Options available with MiniTool: Related questions: How to fix a damaged/corrupted NTFS filesystem/partition without losing the data on it? Repair corrupted NTFS File System

    Read the article

  • for loop with count from array, limit output? PHP

    - by Philip
    print '<div id="wrap">'; print "<table width=\"100%\" border=\"0\" align=\"center\" cellpadding=\"3\" cellspacing=\"3\">"; for($i=0; $i<count($news_comments); $i++) { print ' <tr> <td width="30%"><strong>'.$news_comments[$i]['comment_by'].'</strong></td> <td width="70%">'.$news_comments[$i]['comment_date'].'</td> </tr> <tr> <td></td> <td>'.$news_comments[$i]['comment'].'</td> </tr> '; } print '</table></div>'; $news_comments is a 3 diemensional array from mysqli_fetch_assoc returned from a function elsewhere, for some reason my for loop returns the total of the array sets such as [0][2] etc until it reaches the max amount from the counted $news_comments var which is a return function of LIMIT 10. my problem is if I add any text/html/icons inside the for loop it prints it in this case 11 times even though only array sets 1 and 2 have data inside them. How do I get around this? My function query is as follows: function news_comments() { require_once '../data/queries.php'; // get newsID from the url $urlID = $_GET['news_id']; // run our query for newsID information $news_comments = selectQuery('*', 'news_comments', 'WHERE news_id='.$urlID.'', 'ORDER BY comment_date', 'DESC', '10'); // requires 6 params // check query for results if(!$news_comments) { // loop error session and initiate var foreach($_SESSION['errors'] as $error=>$err) { print htmlentities($err) . 'for News Comments, be the first to leave a comment!'; } } else { print '<div id="wrap">'; print "<table width=\"100%\" border=\"0\" align=\"center\" cellpadding=\"3\" cellspacing=\"3\">"; for($i=0; $i<count($news_comments); $i++) { print ' <tr> <td width="30%"><strong>'.$news_comments[$i]['comment_by'].'</strong></td> <td width="70%">'.$news_comments[$i]['comment_date'].'</td> </tr> <tr> <td></td> <td>'.$news_comments[$i]['comment'].'</td> </tr> '; } print '</table></div>'; } }// End function Any help is greatly appreciated.

    Read the article

  • When using Query Syntax in C# "Enumeration yielded no results". How to retrieve output

    - by Shantanu Gupta
    I have created this query to fetch some result from database. Here is my table structure. What exaclty is happening. DtMapGuestDepartment as Table 1 DtDepartment as Table 2 Are being used var dept_list= from map in DtMapGuestDepartment.AsEnumerable() where map.Field<Nullable<long>>("GUEST_ID") == DRowGuestPI.Field<Nullable<long>>("PK_GUEST_ID") join dept in DtDepartment.AsEnumerable() on map.Field<Nullable<long>>("DEPARTMENT_ID") equals dept.Field<Nullable<long>>("DEPARTMENT_ID") select dept.Field<string>("DEPARTMENT_ID"); I am performing this query on DataTables and expect it to return me a datatable. Here I want to select distinct department from Table 1 as well which will be my next quest. Please answer to that also if possible.

    Read the article

  • ignore certain buffers using iswitchb

    - by robUK
    Hello, GNU Emacs 23.1 I am using iswitchb. However, when I press c-x b I get a list of buffers. However, I don't want to display one like scratch, Messages, GNU Emacs, etc. Just the buffers I have opened myself. So I am looking for a way to ignore these buffers. This is what I have in my configuration. However, it doesn't ignore the buffers I don't want. Have I done anything wrong? ;; Setup iswitchb to select different buffers, ignore buffers to reduce list (iswitchb-mode 1) (setq iswitchb-buffer-ignore '("*scratch*")) (setq iswitchb-buffer-ignore '("*Messages*")) (setq iswitchb-buffer-ignore '("*GNU Emacs*")) (setq iswitchb-buffer-ignore '("*compilation*")) Many thanks for any suggestions,

    Read the article

  • copying a short int to a char array

    - by cateof
    I have a short integer variable called s_int that holds value = 2 unsighed short s_int = 2; I want to copy this number to a char array to the first and second position of a char array. Let's say we have char buffer[10];. We want the two bytes of s_int to be copied at buffer[0] and buffer[1]. How can I do it?

    Read the article

  • Is it possible to BitBlt directly on to a GDI+ bitmap?

    - by jnm2
    I am trying to BitBlt from an HBITMAP to a GDI+ bitmap. I tried this, but nothing happens: Bitmap Buffer = New Bitmap(608, 392) Graphics BufferGraphics = Graphics.FromImage(Buffer); IntPtr hBufferDC = BufferGraphics.GetHdc(); ... BitBlt(hBufferDC, x, y, width, height, hInputDC, 0, 0, SRCCOPY); EDIT: Apparently the hDC doesn't work if I acquire it and then much later use it with BitBlt. I needed to make sure the hDC was still valid. This is the solution: Bitmap Buffer = New Bitmap(608, 392) Graphics BufferGraphics = Graphics.FromImage(Buffer); ... IntPtr hBufferDC = BufferGraphics.GetHdc(); BitBlt(hBufferDC, x, y, width, height, hInputDC, 0, 0, SRCCOPY); BufferGraphics.ReleaseHdc(hBufferDC); Does anyone know why this change is necessary? Why might it not work to use an hDC that was gotten earlier as in the first example?

    Read the article

  • Java: Combination of recursive loops which has different FOR loop inside; Output: FOR loops indexes

    - by vvinjj
    currently recursion is fresh & difficult topic for me, however I need to use it in one of my algorithms. Here is the challenge: I need a method where I specify number of recursions (number of nested FOR loops) and number of iterations for each FOR loop. The result should show me, something simmilar to counter, however each column of counter is limited to specific number. ArrayList<Integer> specs= new ArrayList<Integer>(); specs.add(5); //for(int i=0 to 5; i++) specs.add(7); specs.add(9); specs.add(2); specs.add(8); specs.add(9); public void recursion(ArrayList<Integer> specs){ //number of nested loops will be equal to: specs.size(); //each item in specs, specifies the For loop max count e.g: //First outside loop will be: for(int i=0; i< specs.get(0); i++) //Second loop inside will be: for(int i=0; i< specs.get(1); i++) //... } The the results will be similar to outputs of this manual, nested loop: int[] i; i = new int[7]; for( i[6]=0; i[6]<5; i[6]++){ for( i[5]=0; i[5]<7; i[5]++){ for(i[4] =0; i[4]<9; i[4]++){ for(i[3] =0; i[3]<2; i[3]++){ for(i[2] =0; i[2]<8; i[2]++){ for(i[1] =0; i[1]<9; i[1]++){ //... System.out.println(i[1]+" "+i[2]+" "+i[3]+" "+i[4]+" "+i[5]+" "+i[6]); } } } } } } I already, killed 3 days on this, and still no results, was searching it in internet, however the examples are too different. Therefore, posting the programming question in internet first time in my life. Thank you in advance, you are free to change the code efficiency, I just need the same results.

    Read the article

  • In ASP.NET, is it possible to output cache by host name? ie varybyhost or varbyhostheader?

    - by Pure.Krome
    Hi folks, I've got a website that has a number of host headers. Depending on the host header, the results are different - both visually (theme'd) and data. So lets imagine i have a website called 'Foo' - that returns search results (original, eh?). Now, the same code runs both sites. It is physically the same server/website (using Host Headers) :- www.foo.com www.foo.com.au Now, if i goto '.com', the site is theme'd in blue. if i goto the '.com.au' site, it's theme'd in red. And the data is different for the same search result, based on the host name (ie. us results for .com, au results for .com.au) SO .. if i wish to use OutputCaching .. can this be handled / differ by the host name? I don't want to have the first person goto the .com site .. grab the results ... and the a second person goto my .com.au .. same search data .. and get the theme and results for the .com site. Possible?

    Read the article

  • PHP: How can I eliminate quotes around output from CSV file?

    - by brian johnson
    This code: <?php $curl=curl_init(); curl_setopt ($curl,CURLOPT_URL,"http://download.finance.yahoo.com/d/quotes.csv?s=XIN&f=l1c1p2rj1y&e=.csv"); curl_setopt ($curl,CURLOPT_HEADER,0); ob_start(); curl_exec ($curl); curl_close ($curl); $data=ob_get_clean(); $data = explode(",",$data); foreach ($data as $results) echo "<td>$results</td>"; ?> yields these results in my browser: 2.80 +0.02 "+0.72%" 1.85 204.2M 1.44 How can I have this PHP code above eliminate the quotations around the "+0.72%" so the end result is just: 0.72% ?

    Read the article

  • How do you prevent Git from printing 'remote:' on each line of the output of a post-recieve hook?

    - by Matt Hodan
    I recently configured an EC2 instance with a Git deployment workflow that resembles Heroku, but I can't seem to figure out how Heroku prevents the Git post-receive hook from outputting 'remote:' on each line. Consider the following two examples (one from my EC2 project and one from a Heroku project): My EC2 project: git push prod master Counting objects: 9, done. Delta compression using up to 2 threads. Compressing objects: 100% (5/5), done. Writing objects: 100% (5/5), 456 bytes, done. Total 5 (delta 3), reused 0 (delta 0) remote: remote: Receiving push remote: Deploying updated files (by resetting HEAD) remote: HEAD is now at bf17da8 test commit remote: Running bundler to install gem dependencies remote: Fetching source index for http://rubygems.org/ remote: Installing rake (0.8.7) remote: Installing abstract (1.0.0) ... remote: Installing railties (3.0.0) remote: Installing rails (3.0.0) remote: Your bundle is complete! It was installed into ./.bundle/gems remote: Launching (by restarting Passenger)... done remote: To ssh://[email protected]/~/apps/app_name e8bd06f..bf17da8 master -> master Heroku: $> git push heroku master Counting objects: 179, done. Delta compression using up to 2 threads. Compressing objects: 100% (89/89), done. Writing objects: 100% (105/105), 42.70 KiB, done. Total 105 (delta 53), reused 0 (delta 0) -----> Heroku receiving push -----> Rails app detected -----> Gemfile detected, running Bundler version 1.0.3 Unresolved dependencies detected; Installing... Using --without development:test Fetching source index for http://rubygems.org/ Installing rake (0.8.7) Installing abstract (1.0.0) ... Installing railties (3.0.0) Installing rails (3.0.0) Your bundle is complete! It was installed into ./.bundle/gems Compiled slug size is 4.8MB -----> Launching... done http://your_app_name.heroku.com deployed to Heroku To [email protected]:your_app_name.git 3bf6e8d..642f01a master -> master

    Read the article

  • What's the best way to capture output from SQL Management Studio and paste it into an Outlook email?

    - by Decker
    I'm constantly executing ad-hoc queries in SQL Management Studio and need to send the results to people via email. This happens several times a day so I'm looking for the best way to copy the results of the query from the results window into an Outlook email body so that it can be formatted in a reader friendly manner. I haven't come up with anything that works well for me. When it really matters, I end up going into Excel, executing the query from within there and then attaching the resulting spreadsheet. I'm looking for something that I can do without involving Excel if possible. Any ideas?

    Read the article

  • Faster way to clone.

    - by AngryHacker
    I am trying to optimize a piece of code that clones an object: #region ICloneable public object Clone() { MemoryStream buffer = new MemoryStream(); BinaryFormatter formatter = new BinaryFormatter(); formatter.Serialize(buffer, this); // takes 3.2 seconds buffer.Position = 0; return formatter.Deserialize(buffer); // takes 2.1 seconds } #endregion Pretty standard stuff. The problem is that the object is pretty beefy and it takes 5.4 seconds (according ANTS Profiler - I am sure there is the profiler overhead, but still). Is there a better and faster way to clone?

    Read the article

  • What's the best way to unit test code that generates random output?

    - by Flynn1179
    Specifically, I've got a method picks n items from a list in such a way that a% of them meet one criterion, and b% meet a second, and so on. A simplified example would be to pick 5 items where 50% have a given property with the value 'true', and 50% 'false'; 50% of the time the method would return 2 true/3 false, and the other 50%, 3 true/2 false. Statistically speaking, this means that over 100 runs, I should get about 250 true/250 false, but because of the randomness, 240/260 is entirely possible. What's the best way to unit test this? I'm assuming that even though technically 300/200 is possible, it should probably fail the test if this happens. Is there a generally accepted tolerance for cases like this, and if so, how do you determine what that is?

    Read the article

  • PIX_FMT_YUYV422 8 bits conversion ffmpeg

    - by Sridhar
    Hi, I have a raw YUYV422 buffer with 8-bit 4:2:2 Component Y’CbCr format (Y0, Cb, Y1, Cr order). I know that ffmpeg's PIX_FMT_YUYV422 only handle 16-bit buffers.So I am getting Bad memory error when scaling that buffer into YUV420P. Can any one give me a clue, how can I use this buffer with ffmpeg to covert into YUV420. Thanks, Raghu

    Read the article

  • How do you pass in a value to a subfunction in Matlab I am getting output errors?

    - by Ben Fossen
    Below is my code in Matlab I am having trouble with the line sum = (h/2) * (f(a) + f(b)) + h; Matlab says I have to many outputs when I try to call the f(x) function. Is my problem with the f(x) function function Trapezoid_Uniform(a,b,n) h = (b - a)/n; sum = (h/2) * (f(a) + f(b)) + h; for i = 1:n-1 x = a + i*h; sum = sum + f(x); end sum = sum*h; disp(sum); end function f(z) f = exp(z); end

    Read the article

  • How do I output Unicode characters as a pair of ASCII characters?

    - by ChrisF
    How do I convert (as an example): Señor Coconut Y Su Conjunto - Introducciõn to: Señor Coconut Y Su Conjunto - Introducciõn I've got an app that creates m3u playlists, but when the track filename, artist or title contains non ASCII characters it doesn't get read properly by the music player so the track doesn't get played. I've discovered that if I write the track out as: #EXTINFUTF8:76,Señor Coconut Y Su Conjunto - Introducciõn #EXTINF:76,Señor Coconut Y Su Conjunto - Introducciõn #UTF8:01-Introducciõn.mp3 01-Introducciõn.mp3 Then the music player will read it correctly and play the track. My problem is that I can't find the information I need to be able to do the conversion properly.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Thread locking issue with FileHelpers between calling engine.ReadNext() method and readign engine.Li

    - by Rad
    I use producer/consumer pattern with FileHelpers library to import data from one file (which can be huge) using multiple threads. Each thread is supposed to import a chunk of that file and I would like to use LineNumber property of the FileHelperAsyncEngine instance that is reading the file as primary key for imported rows. FileHelperAsyncEngine internally has an IEnumerator IEnumerable.GetEnumerator(); which is iterated over using engine.ReadNext() method. That internally sets LineNumber property (which seems is not thread safe). Consumers will have Producers assiciated with them that will supply DataTables to Consumers which will consume them via SqlBulkLoad class which will use IDataReader implementation which will iterate over a collection of DataTables which are internal to a Consumer instance. Each instance of will have one SqlBulkCopy instance associate with it. I have thread locking issue. Below is how I create multiple Producer threads. I start each thread afterwords. Produce method on a producer instance will be called determining which chunk of input file will be processed. It seems that engine.LineNumber is not thread safe and I doesn't import a proper LineNumber in the database. It seems that by the time engine.LineNumber is read some other thread called engine.ReadNext() and changed engine.LineNumber property. I don't want to lock the loop that is supposed to process a chunk of input file because I loose parallelism. How to reorganize the code to solve this threading issue? Thanks Rad for (int i = 0; i < numberOfProducerThreads; i++) DataConsumer consumer = dataConsumers[i]; //create a new producer DataProducer producer = new DataProducer(); //consumer has already being created consumer.Subscribe(producer); FileHelperAsyncEngine orderDetailEngine = new FileHelperAsyncEngine(recordType); orderDetailEngine.Options.RecordCondition.Condition = RecordCondition.ExcludeIfBegins; orderDetailEngine.Options.RecordCondition.Selector = STR_ORDR; int skipLines = i * numberOfBufferTablesToProcess * DataBuffer.MaxBufferRowCount; Thread newThread = new Thread(() => { producer.Produce(consumer, inputFilePath, lineNumberFieldName, dict, orderDetailEngine, skipLines, numberOfBufferTablesToProcess); consumer.SetEndOfData(producer); }); producerThreads.Add(newThread); thread.Start();} public void Produce(DataConsumer consumer, string inputFilePath, string lineNumberFieldName, Dictionary<string, object> dict, FileHelperAsyncEngine engine, int skipLines, int numberOfBufferTablesToProcess) { lock (this) { engine.Options.IgnoreFirstLines = skipLines; engine.BeginReadFile(inputFilePath); } int rowCount = 1; DataTable buffer = consumer.BufferDataTable; while (engine.ReadNext() != null) { lock (this) { dict[lineNumberFieldName] = engine.LineNumber; buffer.Rows.Add(ObjectFieldsDataRowMapper.MapObjectFieldsToDataRow(engine.LastRecord, dict, buffer)); if (rowCount % DataBuffer.MaxBufferRowCount == 0) { consumer.AddBufferDataTable(buffer); buffer = consumer.BufferDataTable; } if (rowCount % (numberOfBufferTablesToProcess * DataBuffer.MaxBufferRowCount) == 0) { break; } rowCount++; } } if (buffer.Rows.Count > 0) { consumer.AddBufferDataTable(buffer); } engine.Close(); }

    Read the article

< Previous Page | 148 149 150 151 152 153 154 155 156 157 158 159  | Next Page >