Search Results

Search found 4204 results on 169 pages for 'green computing'.

Page 154/169 | < Previous Page | 150 151 152 153 154 155 156 157 158 159 160 161  | Next Page >

  • A shortest path problem with superheroes and intergalactic journeys

    - by Dman
    You are a super-hero in the year 2222 and you are faced with this great challenge: starting from your home planet Ilop you must try to reach Acinhet or else your planet will be destroyed by evil green little monsters. To do this you are given a map of the universe: there are N planets and M inter-planetary connections ( bidirectional ) that bind these planets. Each connection requires a certain time and a certain amount of fuel in order for you to cover the connection from one planet to another. The total time spent going from one planet to another is obtained by multiplying the time past to cover each connection between all the planets you go through. There are some "key planets", that allow you to refuel if you arrive on those certain "key planets". A "key planet" is the planet with the property that if it disappears the road between at least two planets would be lost.(In the example posted below with the input/output files such a "key planet" is 2 because without it the road to 7 would be lost) When you start your mission you are given the possibility of choosing between K ships each with its own maximum fuel capacity. The goal is to find the SHORTEST TIME CONSUMING path but also choose the ship with the minimum fuel capacity that can cover that shortest path(this means that if more ships can cover the shortest path you choose the one with the minimum fuel capacity). Because the minimum time can be a rather large number (over long long int) you are asked to provide only the last 6 digits of the number. For a better understanding of the task, here is an example of input/output files: INPUT: mission.in 7 8 6 1 4 6 5 9 8 7 10 1 2 7 8 1 4 14 9 1 5 3 1 2 3 1 2 2 7 7 1 3 4 2 2 4 6 4 1 5 6 3 7 On the first line (in order): N M K On the second line :the number for the starting planet and the finishing planet On the third line :K numbers that represent the capacities of the ships you can choose from Then you have M lines, all of them have the same structure: Xi Yi Ti Fi-which means that there is a connection between Xi and Yi and you can cover the distance from Xi to Yi in Ti time and with a Fi fuel consumption. OUTPUT:mission.out 000014 8 1 2 3 4 On the first line:the minimum time and fuel consumption; On the second line :the path Restrictions: 2 = N = 1 000 1 = M = 30 000 1 = K = 10 000 Any suggestions or ideas of how this problem might be solved would be most welcomed.

    Read the article

  • Why Won't My ASP.NET Hyperlink Work in IE?

    - by Giffyguy
    I'm making a very simple ad button system using ASP.NET 2.0 The advertisment is a 150x150px square that is displayed on "the r house." (Scroll down a little and you'll see the bright green "Angry Octopus" on the right side of the screen.) Now, I am not the administrator of "the r house." Instead, I am the administrator of angryoctopus.net Therefore, I don't have the ability to change the ad display code on a whim. So I gave "the r house" this snippet of code to display our ad nicely, while still allowing me to customize the back-end code on my end: <iframe src="http://www.angryoctopus.net/Content/Ad/150x150.aspx" frameborder="0" width="150" height="150" scrolling="no" style="padding: 0; margin: 0;"></iframe> You'll find this snippet in the page source to "the r house." On my side, the code looks like this: <asp:HyperLink runat="server" NavigateUrl="http://www.angryoctopus.net/" Target="_top"> <asp:Panel ID="pnlMain" runat="server" BackColor="#D1E231" style="padding: 0; margin: 0" Width="150" Height="150"> <asp:Image runat="server" ImageUrl="http://www.angryoctopus.net/Content/Ad/150x150.png" BorderStyle="None" style="padding: 0; margin: 0" /> </asp:Panel> </asp:HyperLink> ... and there's some insignificant back-end C# code for hit-counting. This looks all well and good from the code standpoint, as far as I can tell. Everything works in Firefox and Chrome. Also, everything appears to work in IE8 in all of my tests. I haven't tested IE7. But when you view "the r house" in IE(8) the hyperlink doesn't do anything, and the cursor doesn't indicate that the hyperlink is even there. Although you can see the target URL in the status bar. I've considered the fact that "the r house" uses XHTML 1.0 Strict could be causing problems, but that would probably effect Firefox and Chrome right? (My aspx pages use XHTML 1.0 Transitional) My only other theory is that some random CSS class could be applying a weird attribute to my iframe, but again I would expect that would effect Firefox and Chrome. Is this a security issue with IE? Does anyone know what part of the r house's website could be blocking the hyperlink in IE? And how can I get around this without having to hard code anything on the r house's website? Is there an alternative to iframe that would do the same job without requiring complicated scripting?

    Read the article

  • Custom activity designers in Workflow Foundation 3.5: How do they work?

    - by stakx
    Intent of this post: I realise that Workflow Foundation is not extremely popular on StackOverflow and that there will probably be not many answers, or none at all. This post is intended as a resource to people trying to customise workflow activities' appearance through custom designer classes. Goals: I am attempting to create a custom designer class for Workflow activities to achieve the following: Make activities look less technical. For example, I don't necessarily want to see the internal object name as the activity's "title" -- instead, I'd like to see something more descriptive. Display the values of certain properties beneath the title text. I would like to see some properties' values directly underneath the title so that I don't need to look somewhere else (namely, at the Properties window). Provide custom drop areas and draw custom internal arrows. As an example, I would like to be able to have custom drop areas in very specific places. What I found out so far: I created a custom designer class deriving from SequentialActivityDesigner as follows: [Designer(typeof(SomeDesigner))] public partial class SomeActivity: CompositeActivity { ... } class PlainDesigner : SequentialActivityDesigner { ... } Through overriding some properties and the OnPaint method, I found out about the following correspondences between the properties and how the activity will be displayed: Figure 1. Relationship between some properties of an SequentialActivityDesigner and the displayed activity. Possible solutions for goal #1 (make activities look less technical) and goal #2 (display values of properties beneath title text): The displayed title can be changed through the Title property. If more room is required to display additional information beneath the title, the TitleHeight property can be increased (ie., override the property and make it return base.TitleHeight + n, where n is some positive integer). Override the OnPaint method and draw additional text in the area reserved through TitleHeight. Open questions: What are the connectors, connections, and connection points used for? They seem to be necessary, but for what purpose? While the drop targets can be got through the GetDropTargets method, it seems that this is not necessarily where the designer will actually place dropped activities. When an activity is dragged across a workflow, the designer displays little green plus signs where activities can be dropped; how does it figure out the locations of these plus signs? How does the designer figure out where to draw connector lines and arrows?

    Read the article

  • ImageMagick on Mac OSX Snow Leopard. Is there any way to get it to compile and run?

    - by ?????
    It seems that I have more trouble getting standard Unix things to run on Snow Leopard than any other platform--including Windows cygwin For the past couple of days, I've been trying to get ImageMagick to run on Snow Leopard. The most obvious way, Mac Ports, fails: tppllc-Mac-Pro:ImageMagick-sl swirsky$ sudo port install imagemagick ---> Computing dependencies for p5-locale-gettext ---> Configuring p5-locale-gettext Error: Target org.macports.configure returned: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_perl_p5-locale-gettext/work/gettext-1.05" && /opt/local/bin/perl Makefile.PL INSTALLDIRS=vendor " returned error 2 Command output: checking for gettext... no checking for gettext in -I/opt/local/include -arch i386 -L/opt/local/lib -lintl...gettext function not found. Please install libintl at Makefile.PL line 18. no Error: Unable to upgrade port: 1 Error: Unable to execute port: upgrade xorg-libXt failed Before reporting a bug, first run the command again with the -d flag to get complete output. tppllc-Mac-Pro:ImageMagick-sl swirsky$ Not wanting to spend another two days figuring out why my libintl doesn't have a "gettext" function, I tried a different route: the script mentioned here: http://github.com/masterkain/ImageMagick-sl This script downloads and installs an ImageMagic independently of MacPorts issues tppllc-Mac-Pro:ImageMagick-sl swirsky$ /usr/local/bin/convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap It downloads everything and compiles fine, but fails when I try to run it, with the message above. So now I'm two steps away from ImageMagick, trying to get a newer libiconv on my machine. I downloaded the latest libiconv, compiled and built it. I put the resulting library in /opt/local/lib, and I still get the same error message: tppllc-Mac-Pro:.libs swirsky$ sudo mv libiconv.2.dylib /opt/local/lib/libiconv.2.dylib tppllc-Mac-Pro:.libs swirsky$ convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap Now here's something interesting. The error message shows it's looking in /opt/local/lib/libiconv.2.dylib. otools -L shows that this does implement 8.0.0: tppllc-Mac-Pro:.libs swirsky$ otool -L /opt/local/lib/libiconv.2.dylib /opt/local/lib/libiconv.2.dylib: /usr/local/lib/libiconv.2.dylib (compatibility version 8.0.0, current version 8.0.0) /usr/lib/libSystem.B.dylib (compatibility version 1.0.0, current version 125.0.0) tppllc-Mac-Pro:.libs swirsky$ And, for good measure, I set the DYLD_LIBRARY_PATH to make sure this directory is the one for dynamic libraries. So even though I do have a library that provides 8.0.0, it's being seen as 7.0.0! Any ideas why this would happen? So here's my question: Is it possible to get ImageMagick to run on OSX Snow Leopard? Are there any binary distributions that have static libraries baked in so I don't have to worry about these issue/

    Read the article

  • Ajax to read updated values from XML

    - by punit
    I am creating file upload progress bar. I have a CGI script which copies the data, and here I increment the progress bar value by ONE after certain iterations. I am storing the incremented value in XML file (I also tried using plain text file). On the other side I have ajax reading incremented value from xml and depending on that it increments the DIV element. However, what happens here is, it seems to me that although the ajax reads all the incremented values but it processes it after the CGI has finished execution. That is progress bar starts execution once the file copying and other stuff in CGI is completed. My code is: AJAX:::: function polling_start() { //GETS CALLED WHEN USER HITS FILE UPLOAD BUTTON intervalID = window.setInterval(send_request,100); } window.onload = function (){ request = initXMLHttpClient(); request.overrideMimeType('text/xml'); progress = document.getElementById('progress'); } function initXMLHttpClient() { if (window.XMLHttpRequest){ // code for IE7+, Firefox, Chrome, Opera, Safari xmlhttp = new XMLHttpRequest(); } else{ // code for IE6, IE5 xmlhttp = new ActiveXObject("Microsoft.XMLHTTP"); } return xmlhttp } function send_request() { request.open("GET","progress_bar.xml",true); request.onreadystatechange = request_handler; request.send(); } function request_handler() { if (request.readyState == 4 && request.status == 200) { var level=request.responseXML.getElementsByTagName('PROGRESS')[0].firstChild; progress.style.width = progress.innerHTML = level.nodeValue + '%'; progress.style.backgroundColor = "green"; } } /****ON SERVER SIDE*********/ char xmlDat1[] = "<DOCUMENT><PROGRESS>"; char xmlDat2[] = "</PROGRESS></DOCUMENT>"; fptr = fopen("progress_bar.xml", "w"); .........OTHER STUFF.............................. ................................. if(i == inc && j<=100) { fprintf(fptr, "%s\n", "\n\n\n]"); //fprintf(fptr, "%s\n", ""); fprintf(fptr, "%s", xmlDat1); // fprintf(fptr, "%d" ,j); fprintf(fptr, "%s" ,xmlDat2); fseek(fptr, 0, SEEK_SET); /*fprintf(fptr, "%d" ,j); fseek(fptr, 0, SEEK_SET);*/ i = 0; //sleep(1); j++; } (I also tried to write in .text, but same response) Any quick response would be appreciable.

    Read the article

  • Looking for Fiddler2 help. connection to gateway refused? Just got rid of a virus

    - by John Mackey
    I use Fiddler2 for facebook game items, and it's been a great success. I accessed a website to download some dat files I needed. I think it was eshare, ziddu or megaupload, one of those. Anyway, even before the rar file had downloaded, I got this weird green shield in the bottom right hand corner of my computer. It said a Trojan was trying to access my computer, or something to that extent. It prompted me to click the shield to begin anti-virus scanning. It turns out this rogue program is called Antivirus System Pro and is pretty hard to get rid of. After discovering the rogue program, I tried using Fiddler and got the following error: [Fiddler] Connection to Gateway failed.Exception Text: No connection could be made because the target machine actively refused it 127.0.0.1:5555 I ended up purchasing SpyDoctor + Antivirus, which I'm told is designed specifically for getting rid of these types of programs. Anyway, I did a quick-scan last night with spydoctor and malware bytes. Malware picked up 2 files, and Spydoctor found 4. Most were insignificant, but it did find a worm called Worm.Alcra.F, which was labeled high-priority. I don’t know if that’s the Anti-Virus Pro or not, but SpyDoctor said it got rid of all of those successfully. I tried to run Fiddler again before leaving home, but was still getting the "gateway failed" error. Im using the newest version of firefox. When I initially set up the Fiddler 2.2.8.6, I couldn’t get it to run at first, so I found this faq on the internet that said I needed to go through ToolsOptionsSettings and set up an HTTP Proxy to 127.0.0.1 and my Port to 8888. Once I set that up and downloaded this fiddler helper as a firefox add-on, it worked fine. When I turn on fiddler, it automatically takes my proxy setting from no proxy (default) to the 127.0.0.1 with Port 8888 set up. It worked fine until my computer detected this virus. Anyway, hopefully I've given you sufficient information to offer me your best advice here. Like I said, Spydoctor says the bad stuff is gone, so maybe the rogue program made some type of change in my fiddler that I could just reset or uncheck or something like that? Or will I need to completely remove fiddler and those dat files and rar files I downloaded? Any help would be greatly appreciated. Thanks for your time.

    Read the article

  • Correct table layout generation with CSS: unexpected cells shift

    - by MrG
    I'm trying to generate a dynamic table using CSS: <html> <head> <style> div.el1, div.el2 { color:white; width:70px;height:70px; border:0px; padding:0px; font-size: 10px; font-family: "Courier"; } div.el1 { background-color: green; } div.el2 { background-color: orange; } div.tablediv { display: table; border:0px; border-spacing:0px; border-collapse:separate; } div.celldiv { display: table-cell; } div.rowdiv { display: table-row; width:auto; } </style> </head> <body> <div class="tablediv"> <div class="rowdiv"> <div class="celldiv"> <div class="el1" id="x1y1">ABC</div> </div> <div class="celldiv"> <div class="el2" id="x1y2"></div> </div> </div> <div class="rowdiv"> <div class="celldiv"> <div class="el1" id="x2y1"></div> </div> <div class="celldiv"> <div class="el1" id="x2y2"></div> </div> </div> </div> </body> </html> The content of body is dynamically generated and should be displayed as a table. Unfortunately, each cell shifts down if it contains data: expected reality --- --- --- --- | | | | | | --- --- |ABC|--- | | | | | | --- --- --- --- | | | --- --- I'm grateful for any help. Many thanks!

    Read the article

  • Why is my Interface Builder wiring so bonkers and what can I do to straighten it out?

    - by editor
    I've been working on an iPhone application in XCode and Interface Builder of the Tab Bar project type. After getting a table view of topics (business sectors) working fine I realized that I would need to add a Navigation Control to allow the user to drill into a subtopics (subsectors) table. As a green Objective-C developer, that was confusing, but I managed to get it working by reading various documentation trying out a few different IB options. My current setup is a Tab Bar Controller with Tab 1 as a Navigation Controller and Tab 2 a plain view with a Table View placed into it. The wiring works: I can log when table rows are selected and I'm ready to push a new View Controller onto the stack so that I can display the subtopics Table View. My problem: For some reason the first tab's Table View is a delegate and dataSource of the second ta. It doesn't make sense to me and I can't figure out why that's the only setup that works. Here is the wiring: Navigation Controller (Sectors) is a delegate of Tab Bar Navigation Bar is a delegate of Navigation Controller (Sectors) View Contoller (Sectors) has a view of Table View Table View (in Navigation Controller (Sectors)) is a delegate of First View Controller (Companies) Table View (in Navigation Controller (Sectors)) is a dataSource outlet of First View Controller (Companies) First View Controller (Companies) First View Contoller (Sectors) has a view of Table View Table View (in First View Controller (Companies)) is not hooked up to a dataSource outlet and is not a delegate When I click the tab buttons and look at the Inspector I see that the first tab is correctly hooked up to my MainWindow.xib and the second tab has selected a nib called SecondView.xib. It's in the File's Owner of MainWindow.xib where I inherit UITableViewDataSource and UITableViewDelegate (and also UITabBarControllerDelegate) in the .h, and in the .m where I implement the delegate methods. Why does this setup only work when the Table View in my first tab (View Controller (Sectors)) is a delegate and dataSource of the second tab? I'm confused: why wouldn't it need to be hooked up to the Navigation Controller-enabled tab in which the Table View is seen (Navigation Controller (Sectors))? The Table View seen on the second tab has neither dataSource and is not a delegate. I'm having trouble getting a pushViewController to fire (self.navigationController is not nil but the new View Controller still doesn't load) and I suspect that I need to work out this IB wiring issue before I can troubleshoot why the Nav Controller won't push a new View Controller onto the stack. if(nil == self.navigationController) { NSLog(@"self.navigationController is nil."); } else { NSLog(@"self.navigationController is not nil."); SectorList *subsectorViewController = [[SectorList alloc] initWithNibName:@"SectorList" bundle:nil]; subsectorViewController.title = @"Subsectors"; [[self navigationController] pushViewController:subsectorViewController animated:YES]; [subsectorViewController release]; }

    Read the article

  • Getting RGB values for each pixel from a 24bpp Bitmap in C

    - by seven
    Hello, i want to read the RGB values for each pixel from a .bmp file , so i can convert the bmp into a format suitable for gba . so i need to get just the RGB for each pixel and then write this information to a file. i am trying to use the windows.h structures : typedef struct { char signature[2]; unsigned int fileSize; unsigned int reserved; unsigned int offset; }BmpHeader; typedef struct { unsigned int headerSize; unsigned int width; unsigned int height; unsigned short planeCount; unsigned short bitDepth; unsigned int compression; unsigned int compressedImageSize; unsigned int horizontalResolution; unsigned int verticalResolution; unsigned int numColors; unsigned int importantColors; }BmpImageInfo; typedef struct { unsigned char blue; unsigned char green; unsigned char red; unsigned char reserved; }Rgb; typedef struct { BmpHeader header; BmpImageInfo info; Rgb colors[256]; unsigned short image[1]; }BmpFile; but i only need RGB struct. So lets say i read "in.bmp": FILE *inFile, *outFile; inFile = fopen("C://in.bmp", "rb"); Rgb Palette[256]; for(i=0;i<256;i++) { fread(&Palette[i],sizeof(Rgb),1,inFile); } fclose(inFile); is this correct ? how do i write only the RGB information to a file ? can anyone please give me some information please . Thank you.

    Read the article

  • Android - Transforming widgets within transformed widgets and the resulting usability issues.

    - by Ben Rose
    Hello. I'm new to Android application development and I'm currently experimenting with various UI ideas. In the image below, you can see a vertically scrolling list of horizontally scrolling galleries (and also textviews as you can see). I'm also doing some matrix and camera transformations which I will come to in a minute. For the background of the list elements, I use green. Blue is the background of the galleries, and red is the background for the images. These are just for my benefit of learning. The galleries being used are extended classes where I overrode the drawChild method to perform a canvas scale operation in order for the image closest to the center (width) to be larger than the others. The list view going vertically, I overrode the drawChild method and used the camera rotations from lack of depth dimension in the canvas functionality. The items in the list are scaled down and rotated relative to their position's proximity to the center (height). I understood that scrolling and clicking would not necessarily follow along with the image transforms, but it appears as though the parent Gallery class's drawing is constrained to the original coordinates as well (see photo below). I would love to hear any insight any of you have regarding how I can change the coordinates of the galleries in what is rendered via gallery scroll and the touch responsiveness of said gallery. Images in the gallery are not same dimensions, so don't let that throw you in looking at the image below Thanks in advance! Ben link to image (could not embed) -- Update: I was using my test application UI and noticed that when I got the UI to the point of the linked image and then I touched the top portion of the next row in the list, the gallery updated to display the proper representation. So, I added a call to clearFocus() in the drawChild method and that resulted in more accurate drawing. It does seem a tad slower, and since I'm on the Incredible, I'm worried it is a bloated solution. In any event, I would still appreciate any thoughts you have regarding the best way to have the views display properly and how to translate the touch events in the gallery's new displayed area to its touchable coordinates so that scrolling on the actual images works when the gallery has moved. Thanks!

    Read the article

  • EXC_BAD_ACCESS when scrolling table after json data is imported

    - by Michael Robinson
    Hello, I'm having a bear of a time trying to figure out why I'm getting a EXC_BAD ACCESS error. The console is giving me this eror: " -[CFArray objectAtIndex:]: message sent to deallocated instance 0x3b14110", I Can't figure it out...Thanks in advance. // Customize the number of rows in the table view. - (NSInteger)tableView:(UITableView *)tableView numberOfRowsInSection:(NSInteger)section { return [rows count]; } // Customize the appearance of table view cells. - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *CellIdentifier = @"Cell"; UITableViewCell *cell = [tableView dequeueReusableCellWithIdentifier:CellIdentifier]; if (cell == nil) { cell = [[[UITableViewCell alloc] initWithStyle:UITableViewCellStyleSubtitle reuseIdentifier:CellIdentifier] autorelease]; } // Configure the cell. NSDictionary *dict = [rows objectAtIndex: indexPath.row]; cell.textLabel.text = [dict objectForKey:@"name"]; cell.detailTextLabel.text = [dict objectForKey:@"age"]; return cell; } // Implement viewDidLoad to do additional setup after loading the view, typically from a nib. - (void)viewDidLoad { [super viewDidLoad]; self.navigationController.navigationBar.tintColor = [UIColor colorWithRed:0.0/255.0 green:207.0/255.0 blue:255.0/255.0 alpha:1.0]; self.title = NSLocalizedString(@"How Big Now", @"How Big Now"); NSURL *url = [NSURL URLWithString:@"http://10.0.1.8/~imac/iphone/jsontest.php"]; NSString *jsonreturn = [[NSString alloc] initWithContentsOfURL:url]; // NSLog(jsonreturn); // Look at the console and you can see what the restults are NSData *jsonData = [jsonreturn dataUsingEncoding:NSUTF32BigEndianStringEncoding]; NSError *error = nil; // In "real" code you should surround this with try and catch NSDictionary * dict = [[CJSONDeserializer deserializer] deserializeAsDictionary:jsonData error:&error]; if (dict) { rows = [dict objectForKey:@"member"]; } NSLog(@"Array: %@",rows); [jsonreturn release]; } - (void)didReceiveMemoryWarning { // Releases the view if it doesn't have a superview. [super didReceiveMemoryWarning]; // Release any cached data, images, etc that aren't in use. } - (void)viewDidUnload { // Release any retained subviews of the main view. // e.g. self.myOutlet = nil; } - (void)dealloc { [super dealloc]; } @end

    Read the article

  • Question about DBD::CSB Statement-Functions

    - by sid_com
    From the SQL::Statement::Functions documentation: Function syntax When using SQL::Statement/SQL::Parser directly to parse SQL, functions (either built-in or user-defined) may occur anywhere in a SQL statement that values, column names, table names, or predicates may occur. When using the modules through a DBD or in any other context in which the SQL is both parsed and executed, functions can occur in the same places except that they can not occur in the column selection clause of a SELECT statement that contains a FROM clause. # valid for both parsing and executing SELECT MyFunc(args); SELECT * FROM MyFunc(args); SELECT * FROM x WHERE MyFuncs(args); SELECT * FROM x WHERE y < MyFuncs(args); # valid only for parsing (won't work from a DBD) SELECT MyFunc(args) FROM x WHERE y; Reading this I would expect that the first SELECT-statement of my example shouldn't work and the second should but it is quite the contrary. #!/usr/bin/env perl use warnings; use strict; use 5.010; use DBI; open my $fh, '>', 'test.csv' or die $!; say $fh "id,name"; say $fh "1,Brown"; say $fh "2,Smith"; say $fh "7,Smith"; say $fh "8,Green"; close $fh; my $dbh = DBI->connect ( 'dbi:CSV:', undef, undef, { RaiseError => 1, f_ext => '.csv', }); my $table = 'test'; say "\nSELECT 1"; my $sth = $dbh->prepare ( "SELECT MAX( id ) FROM $table WHERE name LIKE 'Smith'" ); $sth->execute (); $sth->dump_results(); say "\nSELECT 2"; $sth = $dbh->prepare ( "SELECT * FROM $table WHERE id = MAX( id )" ); $sth->execute (); $sth->dump_results(); outputs: SELECT 1 '7' 1 rows SELECT 2 Unknown function 'MAX' at /usr/lib/perl5/site_perl/5.10.0/SQL/Parser.pm line 2893. DBD::CSV::db prepare failed: Unknown function 'MAX' at /usr/lib/perl5/site_perl/5.10.0/SQL/Parser.pm line 2894. [for Statement "SELECT * FROM test WHERE id = MAX( id )"] at ./so_3.pl line 30. DBD::CSV::db prepare failed: Unknown function 'MAX' at /usr/lib/perl5/site_perl/5.10.0/SQL/Parser.pm line 2894. [for Statement "SELECT * FROM test WHERE id = MAX( id )"] at ./so_3.pl line 30. Could someone explaine me this behavior?

    Read the article

  • CSS Rollovers: how to main "hit area" size when hidden image is larger than anchor area

    - by nukefusion
    I have a small problem and I don't think what I want to do can be achieved with just pure CSS, but I figured I'd ask anyway. Basically, I have one DIV which contains a hyperlinked element that is smaller in size to it's parent DIV. So in effect I have a square within a square with the inner square being the "hit area". When I mouse over this inner square I want the background of the outer square to change. I know it's not possible to change the parent DIV's background on a:hover, but I figured I could give the illusion of it happening by nesting a hidden image inside the anchor. This works great until I want to "roll off". The problem is that I want the image to disappear when I leave the area of the anchor tag, not the larger hidden image. Is this possible? For the benefit of everyone I've provided an example to demonstrate what I mean: <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta content="text/html; charset=utf-8" http-equiv="Content-Type" /> <title>Test Rollover</title> <link href="main.css" rel="stylesheet" type="text/css" /> </head> <body> <div id="d1"> <a href="#nogo"> <b id="b1"></b> <b id="b2"></b> </a> </div> </body> And the css: #b1 { width: 200px; height: 200px; top: 100px; left: 100px; background-color:aqua; position: absolute; } #b2 { width: 400px; height: 400px; background-color:lime; position: absolute; display: none; } #d1 { width: 400px; height: 400px; background-color:fuchsia; position: relative; } #d1 a:hover #b2 { display: block; } In this example I want the green outer square to disappear when I leave the bounds of the hidden inner blue square.

    Read the article

  • MATLAB plot moving data points in seperate subplots simutaneously

    - by Nate B.
    I wish to visualize the movement of a data point throughout space across a period of time within MATLAB. However, the way I want my figure to display is such that only a single instant is plotted at any given time. That was easy, I simply created a for loop to update my 3D plot display for every set of coordinates (x,y,z) in my data. However, I wish to display 4 different viewing angles of this plot at all times. I am well aware of how to setup subplots within MATLAB, that is not the issue. My issue is getting all 4 of these subplots to execute simultaneously so that all 4 subplots are always displaying the same point in time. I would appreciate if anyone could suggest how to handle this issue. As requested, my code for a figure with a single plot is shown below: datan = DATA; %data in form of x,y,z,a,b,c by column for row# of time points tib=zeros(size(datan,1),12); tib(:,1:3) = datan(:,1:3); tib_ref=tib(1,1:3); for i=1:size(datan,1) tib(i,1:3)=tib(i,1:3)-tib_ref; end angle_to_dircos close all figure('Name','Directions (Individual Cycles)','NumberTitle','off') for cc=1:2 hold off for bb=1:10:size(tib,1); scatter3(tib(bb,1),tib(bb,2),tib(bb,3),'green','filled'); %z and y axes are flipped in polhemus system hold on p0 = [tib(bb,1),tib(bb,2),tib(bb,3)]; p1 = [tib(bb,1)+10*tib(bb,4),tib(bb,2)+10*tib(bb,5),tib(bb,3)+10*tib(bb,6)]; p2 = [tib(bb,1)+10*tib(bb,7),tib(bb,2)+10*tib(bb,8),tib(bb,3)+10*tib(bb,9)]; p3 = [-(tib(bb,1)+100*tib(bb,10)),-(tib(bb,2)+100*tib(bb,11)),-(tib(bb,3)+100*tib(bb,12))]; vectarrow(p0,p1,1,0,0) hold on vectarrow(p0,p2,0,1,0) hold on vectarrow(p0,p3,0,0,1) hold on az = 90; el = 0; view(az, el); xlim([-50,50]); ylim([-50,50]); zlim([-50,50]); xlabel('distance from center in X'); ylabel('distance from center in Y'); zlabel('distance from center in Z'); title('XYZ Scatter Plots of Tracker Position'); hold on plot3(0,0,0,'sk','markerfacecolor',[0,0,0]); p0 = [0,0,0]; p1 = [10,0,0]; p2 = [0,10,0]; p3 = [0,0,100]; vectarrow(p0,p1,1,0,0) hold on vectarrow(p0,p2,0,1,0) hold on vectarrow(p0,p3,1,0,1) drawnow; end end

    Read the article

  • segmented reduction with scattered segments

    - by Christian Rau
    I got to solve a pretty standard problem on the GPU, but I'm quite new to practical GPGPU, so I'm looking for ideas to approach this problem. I have many points in 3-space which are assigned to a very small number of groups (each point belongs to one group), specifically 15 in this case (doesn't ever change). Now I want to compute the mean and covariance matrix of all the groups. So on the CPU it's roughly the same as: for each point p { mean[p.group] += p.pos; covariance[p.group] += p.pos * p.pos; ++count[p.group]; } for each group g { mean[g] /= count[g]; covariance[g] = covariance[g]/count[g] - mean[g]*mean[g]; } Since the number of groups is extremely small, the last step can be done on the CPU (I need those values on the CPU, anyway). The first step is actually just a segmented reduction, but with the segments scattered around. So the first idea I came up with, was to first sort the points by their groups. I thought about a simple bucket sort using atomic_inc to compute bucket sizes and per-point relocation indices (got a better idea for sorting?, atomics may not be the best idea). After that they're sorted by groups and I could possibly come up with an adaption of the segmented scan algorithms presented here. But in this special case, I got a very large amount of data per point (9-10 floats, maybe even doubles if the need arises), so the standard algorithms using a shared memory element per thread and a thread per point might make problems regarding per-multiprocessor resources as shared memory or registers (Ok, much more on compute capability 1.x than 2.x, but still). Due to the very small and constant number of groups I thought there might be better approaches. Maybe there are already existing ideas suited for these specific properties of such a standard problem. Or maybe my general approach isn't that bad and you got ideas for improving the individual steps, like a good sorting algorithm suited for a very small number of keys or some segmented reduction algorithm minimizing shared memory/register usage. I'm looking for general approaches and don't want to use external libraries. FWIW I'm using OpenCL, but it shouldn't really matter as the general concepts of GPU computing don't really differ over the major frameworks.

    Read the article

  • Make Div overlay ENTIRE page (not just viewport)??

    - by Polaris878
    Hello, So I have a problem that I think is quite common but I have yet to find a good solution for. I want to make an overlay div cover the ENTIRE page... NOT just the viewport. I don't understand why this is so hard to do... I've tried setting body, html heights to 100% etc but that isn't working. Here is what I have so far: <html> <head> <style type="text/css"> .OverLay { position: absolute; z-index: 3; opacity: 0.5; filter: alpha(opacity = 50); top: 0; bottom: 0; left: 0; right: 0; width: 100%; height: 100%; background-color: Black; color: White;} body { height: 100%; } html { height: 100%; } </style> </head> <body> <div style="height: 100%; width: 100%; position: relative;"> <div style="height: 100px; width: 300px; background-color: Red;"> </div> <div style="height: 230px; width: 9000px; background-color: Green;"> </div> <div style="height: 900px; width: 200px; background-color: Blue;"></div> <div class="OverLay">TestTest!</div> </div> </body> </html> I'd also be open to a solution in JavaScript if one exists, but I'd much rather just be using some simple CSS.

    Read the article

  • CSS Margin problem

    - by amitairos
    I'm starting out in HTML and CSS. I have a div element on the page, which doesn't fill the whole page. In it- there's a ul element and some list items in it. I want to put the list 227px from the top of the div element, but I can't manage to accomplish this- it pushes it more. Also- between the list items I want a margin of 40 pixels, but it also does more. What's the problem? Here's my code: Html: <body> <div class="Hashta"> <div class="Menu"> <ul id="MenuItems"> <li><a href="#" >ONE</a></li> <li><a href="#" >TWO</a></li> <li><a href="#" >THREE</a></li> <li><a href="#" >FOUR</a></li> </ul> </div> </div> </body> CSS: body { background-color: Gray; } .Hashta{ width:874px; height:650px; background-color:black; margin: auto auto 50px auto; border-radius: 20px; border: 3px solid darkgray; moz-box-shadow: 2px 2px 10px black; webkit-box-shadow: 2px 2px 10px black; box-shadow: 2px 2px 10px black; } .Menu { margin-top: 227px; padding-right: 50px; float:right; } #MenuItems { list-style:none; } #MenuItems li { text-align:center; position:relative; padding: 4px 10px 4px 10px; margin-right:30px; margin-bottom: 40px; border:none; } #MenuItems li a{ width: 280px; height: 70px; background-color: green; color:White; font-family:Arial, Helvetica, sans-serif; font-size:24px; display:block; outline:0; text-decoration:none; text-shadow: 1px 1px 1px #000; line-height: 70px; } If you want to measure the pixels- you can install this: http://www.mioplanet.com/products/pixelruler/ (click to rotate) Thanks!

    Read the article

  • Can you set a gradient brush for a listboxitem background in silverlight?

    - by Michael
    I am looking for a way to set a gradientbrush as the background for a listbox item. I have a DataTemplate defined and have specified a gradient brush but it always appears as the listbox background (i.e. it never shows as a gradient brush). I have been able to set the background of the listbox itself, and I can set the listboxitem's background to a standard color using the "setter" object....but none of these are what I am after. I really want the background on each list item to be a gradient brush. Below is the datatemplate that I have constructed. <ListBox Name="MyListBox" Margin="12,67,12,169"> <ListBox.ItemTemplate> <DataTemplate> <Grid Height="51" VerticalAlignment="Bottom"> <Grid.Background> <LinearGradientBrush EndPoint="0.5,1" StartPoint="0.5,0"> <GradientStop Color="#FFC9F4D0"/> <GradientStop Color="#FF2AC12A" Offset="0.333"/> <GradientStop Color="#FF35DE35" Offset="1"/> </LinearGradientBrush> </Grid.Background> <Canvas > <dataInput:Label Width="227" Foreground="Yellow" Canvas.Left="158" Canvas.Top="8" Content="{Binding Place}"/> <dataInput:Label Width="146" Foreground="Yellow" Canvas.Left="8" Canvas.Top="8" Content="{Binding Date}"/> <dataInput:Label Content="{Binding People}" Width="346" FontSize="9.333" Foreground="Black" Canvas.Left="166" Canvas.Top="28"/> <!-- <dataInput:Label Width="45" Content="Accept" Foreground="White" Canvas.Left="8" Canvas.Top="28"/> <dataInput:Label Width="45" Content="Decline" Foreground="White" Canvas.Left="57" Canvas.Top="28"/> --> <dataInput:Label Content="SomeText" Width="101" FontSize="9.333" Foreground="White" Canvas.Left="389" Canvas.Top="10"/> <Image Height="21" Width="21" Canvas.Left="500" Canvas.Top="8" Source="Green Button.png"/> </Canvas> </Grid> </DataTemplate> </ListBox.ItemTemplate> </ListBox> Any Thoughts?

    Read the article

  • How can I scroll my custom view? I want to see the shapes drawn over the bounds of the screen

    - by antonio Musella
    I have a Custom view ... package nan.salsa.goal.customview; import android.R; import android.content.Context; import android.graphics.Canvas; import android.graphics.drawable.ShapeDrawable; import android.graphics.drawable.shapes.RectShape; import android.util.AttributeSet; import android.util.Log; import android.view.View; public class DayView extends View { private static String TAG="DayView"; private ShapeDrawable mDrawable; public DayView(Context context) { super(context); } public DayView(Context context, AttributeSet attrs) { super(context, attrs); init(); } public DayView(Context context, AttributeSet attrs, int defStyle) { super(context, attrs, defStyle); init(); } public void init() { int x = 10; int y = 10; mDrawable = new ShapeDrawable(new RectShape()); mDrawable.getPaint().setColor(Color.GREEN); mDrawable.setBounds(x, y, x + (width - (x * 2)), y + (height - (y*2))); mDrawable.draw(canvas); for (int i = 1; i < 30; i++) { boxDrawable = new ShapeDrawable(new RectShape()); boxDrawable.setBounds(x + x , y + (100 * i) , x + (width - ((x + x) * 2)), y + (100 * i) + 50); boxDrawable.getPaint().setColor(Color.RED); boxDrawable.draw(canvas); } } @Override protected void onDraw(Canvas canvas) { // TODO Auto-generated method stub super.onDraw(canvas); setBackgroundColor(R.color.black); mDrawable.draw(canvas); } } with this simple configuration file : <?xml version="1.0" encoding="utf-8"?> <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" android:orientation="vertical" android:layout_width="fill_parent" android:layout_height="fill_parent" android:background="#E06F00"> <nan.salsa.goal.customview.DayView android:id="@+id/dayView" android:layout_height="match_parent" android:layout_width="fill_parent" /> </LinearLayout> In my view I want to scroll to see the shapes drawn over the bounds of the screen .. How I can do it? Regards, Antonio Musella

    Read the article

  • java double buffering problem

    - by russell
    Whats wrong with my applet code which does not render double buffering correctly.I am trying and trying.But failed to get a solution.Plz Plz someone tell me whats wrong with my code. import java.applet.* ; import java.awt.* ; import java.awt.event.* ; public class Ball extends Applet implements Runnable { // Initialisierung der Variablen int x_pos = 10; // x - Position des Balles int y_pos = 100; // y - Position des Balles int radius = 20; // Radius des Balles Image buffer=null; //Graphics graphic=null; int w,h; public void init() { Dimension d=getSize(); w=d.width; h=d.height; buffer=createImage(w,h); //graphic=buffer.getGraphics(); setBackground (Color.black); } public void start () { // Schaffen eines neuen Threads, in dem das Spiel l?uft Thread th = new Thread (this); // Starten des Threads th.start (); } public void stop() { } public void destroy() { } public void run () { // Erniedrigen der ThreadPriority um zeichnen zu erleichtern Thread.currentThread().setPriority(Thread.MIN_PRIORITY); // Solange true ist l?uft der Thread weiter while (true) { // Ver?ndern der x- Koordinate repaint(); x_pos++; y_pos++; //x2--; //y2--; // Neuzeichnen des Applets if(x_pos>410) x_pos=20; if(y_pos>410) y_pos=20; try { Thread.sleep (30); } catch (InterruptedException ex) { // do nothing } Thread.currentThread().setPriority(Thread.MAX_PRIORITY); } } public void paint (Graphics g) { Graphics screen=null; screen=g; g=buffer.getGraphics(); g.setColor(Color.red); g.fillOval(x_pos - radius, y_pos - radius, 2 * radius, 2 * radius); g.setColor(Color.green); screen.drawImage(buffer,0,0,this); } public void update(Graphics g) { paint(g); } } what change should i make.When offscreen image is drawn the previous image also remain in screen.How to erase the previous image from the screen??

    Read the article

  • Exception showing a erroneous web page in a WPF frame

    - by H4mm3rHead
    I have a small application where i need to navigate to an url, I use this method to get the Frame: public override System.Windows.UIElement GetPage(System.Windows.UIElement container) { XmlDocument doc = new XmlDocument(); doc.Load(Location); string webSiteUrl = doc.SelectSingleNode("website").InnerText; Frame newFrame = new Frame(); if (!webSiteUrl.StartsWith("http://")) { webSiteUrl = "http://" + webSiteUrl; } newFrame.Source = new Uri(webSiteUrl); return newFrame; } My problem is now that the page im trying to show generates a error (or so i think), when i load the page in a browser it never fully loads, keeps saying "loading1 element" in the load bar and the green progress line (IE 8) keeps showing. When i attach my debugger i get this error: System.ArgumentException was unhandled Message="Parameter and value pair is not valid. Expected form is parameter=value." Source="WindowsBase" StackTrace: at MS.Internal.ContentType.ParseParameterAndValue(String parameterAndValue) at MS.Internal.ContentType..ctor(String contentType) at MS.Internal.WpfWebRequestHelper.GetContentType(WebResponse response) at System.Windows.Navigation.NavigationService.GetObjectFromResponse(WebRequest request, WebResponse response, Uri destinationUri, Object navState) at System.Windows.Navigation.NavigationService.HandleWebResponse(IAsyncResult ar) at System.Windows.Navigation.NavigationService.<>c__DisplayClassc.<HandleWebResponseOnRightDispatcher>b__8(Object unused) at System.Windows.Threading.ExceptionWrapper.InternalRealCall(Delegate callback, Object args, Boolean isSingleParameter) at System.Windows.Threading.ExceptionWrapper.TryCatchWhen(Object source, Delegate callback, Object args, Boolean isSingleParameter, Delegate catchHandler) at System.Windows.Threading.DispatcherOperation.InvokeImpl() at System.Threading.ExecutionContext.runTryCode(Object userData) at System.Runtime.CompilerServices.RuntimeHelpers.ExecuteCodeWithGuaranteedCleanup(TryCode code, CleanupCode backoutCode, Object userData) at System.Threading.ExecutionContext.Run(ExecutionContext executionContext, ContextCallback callback, Object state) at System.Windows.Threading.DispatcherOperation.Invoke() at System.Windows.Threading.Dispatcher.ProcessQueue() at System.Windows.Threading.Dispatcher.WndProcHook(IntPtr hwnd, Int32 msg, IntPtr wParam, IntPtr lParam, Boolean& handled) at MS.Win32.HwndWrapper.WndProc(IntPtr hwnd, Int32 msg, IntPtr wParam, IntPtr lParam, Boolean& handled) at MS.Win32.HwndSubclass.DispatcherCallbackOperation(Object o) at System.Windows.Threading.ExceptionWrapper.InternalRealCall(Delegate callback, Object args, Boolean isSingleParameter) at System.Windows.Threading.ExceptionWrapper.TryCatchWhen(Object source, Delegate callback, Object args, Boolean isSingleParameter, Delegate catchHandler) ved System.Windows.Threading.Dispatcher.InvokeImpl(DispatcherPriority priority, TimeSpan timeout, Delegate method, Object args, Boolean isSingleParameter) at MS.Win32.HwndSubclass.SubclassWndProc(IntPtr hwnd, Int32 msg, IntPtr wParam, IntPtr lParam) at MS.Win32.UnsafeNativeMethods.DispatchMessage(MSG& msg) at System.Windows.Threading.Dispatcher.TranslateAndDispatchMessage(MSG& msg) at System.Windows.Threading.Dispatcher.PushFrameImpl(DispatcherFrame frame) at System.Windows.Application.RunInternal(Window window) at GreenWebPlayerWPF.App.Main() i C:\Development\Hvarregaard\GWDS\GreenWeb\GreenWebPlayerWPF\obj\Debug\App.g.cs:linje 0 at System.AppDomain._nExecuteAssembly(Assembly assembly, String[] args) at Microsoft.VisualStudio.HostingProcess.HostProc.RunUsersAssembly() at System.Threading.ExecutionContext.Run(ExecutionContext executionContext, ContextCallback callback, Object state) at System.Threading.ThreadHelper.ThreadStart() InnerException: Anyone? Or any way to capture it and respond to it, tried a try/catch around my code, but its not caught - seems something deep inside the guts of the CLR is failing.

    Read the article

  • Swapping two jQuery draggable list items not working properly (with jsFiddle example)

    - by Tony_Henrich
    The minimalist working example below swaps the two boxes when box 'one' is dragged and dropped on box 'two'. The problem is that when box 'one' is dropped, its style has 'top' & 'left' values causing it to be placed away from where it should drop. Its class includes 'ui-draggable-dragging'. It seems the top & left values are related to the amount the elements were dragged before the drop. And the dragging was 'interrupted' hence the residual 'ui-draggable-dragging' class? What am I missing to make the swap work seamlessly? full jsfiddle example here <html> <head> <script type="text/javascript" src="includes/jquery-1.4.2.min.js"></script> <script type="text/javascript" src="includes/jquery-ui-1.8.2.custom.min.js"></script> <script type="text/javascript"> jQuery.fn.swapWith = function(to) { return this.each(function() { var copy_to = $(to).clone(true); var copy_from = $(this).clone(true); $(to).replaceWith(copy_from); $(this).replaceWith(copy_to); }); }; $(document).ready(function() { options = {revert: true}; $("li").draggable(options) $('#wrapper').droppable({ drop: function(event, ui) { $(ui.draggable).swapWith($('#two')); } }); }); </script> </head> <body> <form> <ul id="wrapper"> <li id='one'> <div style="width: 100px; height: 100px; border: 1px solid green"> one<br /></div> </li> <li id='two'> <div style="width: 110px; height: 110px; border: 1px solid red"> two<br /></div> </li> </ul> <br /> </form> </body> </html>

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • UITableViewCell separator line disappears on scroll

    - by iconso
    I'm trying to have a separator cell with a custom image. I did try something like that: In my cellForRowAtIndexPath: NSString *cellIdentifier = [NSString stringWithFormat:@"identifier"]; UITableViewCell *cell = [tableView dequeueReusableCellWithIdentifier:cellIdentifier]; if (cell == nil) { cell = [[UITableViewCell alloc] initWithStyle:UITableViewCellStyleSubtitle reuseIdentifier:cellIdentifier]; } cell.textLabel.font = [UIFont fontWithName:@"Helvetica" size:19]; cell.textLabel.text = [self.menuItems objectAtIndex:indexPath.row]; cell.textLabel.textColor = [UIColor colorWithRed:128/255.0f green:129/255.0f blue:132/255.0f alpha:1.0f]; cell.backgroundColor = [UIColor whiteColor]; UIImageView *imagView = [[UIImageView alloc] initWithImage:[UIImage imageNamed:@"reaL.png"]]; imagView.frame = CGRectMake(0, cellHeight, cellWidth, 1); [cell.contentView addSubview:imagView]; switch (indexPath.row) { case 0: cell.imageView.image = [self imageWithImage:[UIImage imageNamed:@"img1.png"] scaledToSize:CGSizeMake(27, 27)]; cell.imageView.highlightedImage = [self imageWithImage:[UIImage imageNamed:@"route.png"] scaledToSize:CGSizeMake(27, 27)]; break; case 1: cell.imageView.image = [self imageWithImage:[UIImage imageNamed:@"img.png"] scaledToSize:CGSizeMake(27, 27)]; cell.imageView.highlightedImage = [self imageWithImage:[UIImage imageNamed:@"money.png"] scaledToSize:CGSizeMake(27, 27)]; break; case 2: cell.imageView.image = [self imageWithImage:[UIImage imageNamed:@"auto.png"] scaledToSize:CGSizeMake(27, 27)]; cell.imageView.highlightedImage = [self imageWithImage:[UIImage imageNamed:@"cars.png"] scaledToSize:CGSizeMake(27, 27)]; break; case 3: cell.imageView.image = [self imageWithImage:[UIImage imageNamed:@"impostazioni.png"] scaledToSize:CGSizeMake(27, 27)]; cell.imageView.highlightedImage = [self imageWithImage:[UIImage imageNamed:@"impostazioni.png"] scaledToSize:CGSizeMake(27, 27)]; // cell.imageView.contentMode = UIViewContentModeScaleAspectFill; break; case 4: cell.imageView.image = [self imageWithImage:[UIImage imageNamed:@"info.png"] scaledToSize:CGSizeMake(27, 27)]; cell.imageView.highlightedImage = [self imageWithImage:[UIImage imageNamed:@"info.png"] scaledToSize:CGSizeMake(27, 27)]; break; default: break; } return cell; When I lunch the app everything is good, but when I scroll the the table, or when I select a cell the separator lines disappear. How I can have a permanent custom line separator?

    Read the article

  • How to change button's image in visual c++ at run time?

    - by karikari
    After trying and error for many times, I decided to ask here. My objective is I wanted to change the feature of my IE toolbar button. The button is firstly setup by IE at IE startup using the function CRebarHandler::onSetRedraw and CRebarHandler::setButtonMenu2(). And then, I create a call from another cpp file, to call CRebarHandler::setButtonMenu2(). I intent to change just the button's image. I assigned the ID of the image correctly. But somehow it does not work. When I put other code inside this function,like a code for writing to file, it is proven work. Means, it is properly being called from the other file. But the thing is, the code for the button inside CRebarHandler::setButtonMenu2() seems does not work. Need help. Here is the code I am working on (I modify John Lister's button code): LRESULT CRebarHandler::onSetRedraw(UINT uMsg, WPARAM wParam, LPARAM lParam, BOOL& bHandled){ bHandled=false; if (m_ieVer==6){ if (!m_hWndToolbar) scanForToolbarSlow(); if (m_hWndToolbar){ findButton(m_hWndToolbar); if (m_buttonID>0) setButtonMenu(); } } return S_OK; } void CRebarHandler::setButtonMenu(){ HIMAGELIST hImageList = ImageList_Create(32, 32,ILC_COLOR16 | ILC_MASK,1, 0); HINSTANCE module = _AtlBaseModule.GetResourceInstance(); TBBUTTONINFO inf; inf.cbSize=sizeof(inf); inf.dwMask = TBIF_IMAGE; char psBuffer[128]; FILE *pPipe; float f = 0; pPipe = _popen("javaw -jar c:\\simmetrics.jar c:\\chtml.txt c:\\thtml.txt", "rt" ); char* p = fgets(psBuffer, 128, pPipe); std::istringstream iss(p); iss >> f; if (f > 0.9) { inf.iImage = 1; SendMessage(m_hWndToolbar, TB_SETBUTTONINFO, m_buttonID, (LPARAM)(&inf)); iss.clear(); f = 0; } else { inf.iImage = 2; SendMessage(m_hWndToolbar, TB_SETBUTTONINFO, m_buttonID, (LPARAM)(&inf)); iss.clear(); f = 0; } iss.clear(); f = 0; } void CRebarHandler::setButtonMenu2(){ TBBUTTONINFO inf; inf.cbSize=sizeof(inf); inf.dwMask = TBIF_IMAGE; inf.iImage = 1; //green SendMessage(NULL, TB_SETBUTTONINFO, m_buttonID, (LPARAM)(&inf)); }

    Read the article

< Previous Page | 150 151 152 153 154 155 156 157 158 159 160 161  | Next Page >