Search Results

Search found 4204 results on 169 pages for 'green computing'.

Page 155/169 | < Previous Page | 151 152 153 154 155 156 157 158 159 160 161 162  | Next Page >

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • DataTriggered animation is triggered only in the first time

    - by Pavel
    I just wanted to create very simple example of DataTriggers and animation. Two checkboxes and Rectangle. Checking the first cb makes the rectangle fade away. (CodeBehind var is true) Checking the second cb makes the rectangle come back. (var is false) App is loading - the rectangle is showing (true) Firs cb is checked by default. I'm checking second cb - rect is dissapearing. It's OK. But when I then check the first cb rect isn't showing up. But checking the second cb still makes rect show up and fade away. here's my xaml and code behind: <StackPanel> <RadioButton IsChecked="True" Checked="RadioButton_Checked"></RadioButton> <RadioButton Checked="RadioButton_Checked_1"></RadioButton> <Rectangle Name="r1" Width="100" Height="300" Fill="Green"> <Rectangle.Style> <Style TargetType="Rectangle"> <Style.Triggers> <DataTrigger Binding="{Binding Active}" Value="True"> <DataTrigger.EnterActions> <BeginStoryboard> <Storyboard> <DoubleAnimation Storyboard.TargetProperty="Opacity" From="0" To="1" Duration="0:0:1" /> </Storyboard> </BeginStoryboard> </DataTrigger.EnterActions> </DataTrigger> <DataTrigger Binding="{Binding Active}" Value="False"> <DataTrigger.EnterActions> <BeginStoryboard> <Storyboard> <DoubleAnimation Storyboard.TargetProperty="Opacity" From="1" To="0" Duration="0:0:1" /> </Storyboard> </BeginStoryboard> </DataTrigger.EnterActions> </DataTrigger> </Style.Triggers> </Style> </Rectangle.Style> </Rectangle> </StackPanel> public bool Active { get { return (bool) GetValue(ActiveProperty); } set { SetValue(ActiveProperty, value); } } public static readonly DependencyProperty ActiveProperty = DependencyProperty.Register("Active", typeof(bool), typeof(MainWindow), new UIPropertyMetadata(false)); private void RadioButton_Checked(object sender, RoutedEventArgs e) { Active = true; } private void RadioButton_Checked_1(object sender, RoutedEventArgs e) { Active = false; }

    Read the article

  • Macports 1.8.2 fails to build db46 on os x 1.6.3

    - by themoch
    i'm trying to put a dev environment on my mac, and to do so i need to install several packages which require db46 when running sudo port install db46 i get the following error: ---> Computing dependencies for db46 ---> Fetching db46 ---> Attempting to fetch patch.4.6.21.1 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.2 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.3 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.4 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch db-4.6.21.tar.gz from http://distfiles.macports.org/db4/4.6.21_6 ---> Verifying checksum(s) for db46 ---> Extracting db46 ---> Applying patches to db46 ---> Configuring db46 ---> Building db46 Error: Target org.macports.build returned: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_databases_db46/work/db-4.6.21/build_unix" && /usr/bin/make -j2 all " returned error 2 Command output: ../dist/../libdb_java/db_java_wrap.c:9464: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9487: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9509: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9532: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9563: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9588: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9613: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9638: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9666: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9691: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9716: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9739: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9771: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9796: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9819: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9842: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9867: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jobject' ../dist/../libdb_java/db_java_wrap.c:9899: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9920: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9943: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9966: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jstring' ../dist/../libdb_java/db_java_wrap.c:9991: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:10010: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10046: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10071: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' make: *** [db_java_wrap.lo] Error 1 make: *** Waiting for unfinished jobs.... Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. cd ./classes && jar cf ../db.jar ./com/sleepycat Error: Status 1 encountered during processing. i have removed my /usr/local folder completely and it does not seem to help

    Read the article

  • ServeletException, Property <variable name> not found

    - by k9yosh
    What i'm trying to do is add a new variable to this previously created Managed Bean Hello.java and use it in my xhtml file binding to a text field. But it seems that it is not being found when i run it on the server. So it throws a "ServeletException" and says that the "property 'lname'(my variable) is not found". How do i solve this and why is this happening? This is my managed bean, package stack.tute.malinda.model; import javax.faces.bean.ManagedBean; import javax.faces.bean.RequestScoped; @ManagedBean @RequestScoped public class Hello { private String fname; private String message; private String lname; //trying to add this new variable and use it in my xhtml file in a text field. public String getLname() { return lname; } public void setLname(String lname) { this.lname = lname; } public String getName() { return fname; } public String createMessage() { message="Hello " + fname + ""+ lname +"!"; return null; } public void setName(String fname) { this.fname=fname; } public String getMessage() { return message; } } This is my xhtml code, <h:body> <fieldset style="padding: 1em; float:left; margin-right:0.5em; padding-top:0.2em; text-align:left; border:1px solid green; font-weight:bold;"> <legend>Personal Details</legend> <h:form> <h:outputLabel for="name" value="First Name :" required="true"/> <h:inputText id="name" value="#{hello.name}"/> <br/> //Trying to access that variable here. <h:outputLabel for="name1" value="Last Name :" required="true"/> <h:inputText id="name1" value="#{hello.lname}"/> <h:message for="name"/> <br/> <h:commandButton value="Say hello" action="#{hello.createMessage}"> <f:ajax execute="@form" render="@form"/> </h:commandButton> <br/> <h:outputText value="#{hello.message}"/> </h:form> </fieldset>

    Read the article

  • UITableViewCell separator line disappears on scroll

    - by iconso
    I'm trying to have a separator cell with a custom image. I did try something like that: In my cellForRowAtIndexPath: NSString *cellIdentifier = [NSString stringWithFormat:@"identifier"]; UITableViewCell *cell = [tableView dequeueReusableCellWithIdentifier:cellIdentifier]; if (cell == nil) { cell = [[UITableViewCell alloc] initWithStyle:UITableViewCellStyleSubtitle reuseIdentifier:cellIdentifier]; } cell.textLabel.font = [UIFont fontWithName:@"Helvetica" size:19]; cell.textLabel.text = [self.menuItems objectAtIndex:indexPath.row]; cell.textLabel.textColor = [UIColor colorWithRed:128/255.0f green:129/255.0f blue:132/255.0f alpha:1.0f]; cell.backgroundColor = [UIColor whiteColor]; UIImageView *imagView = [[UIImageView alloc] initWithImage:[UIImage imageNamed:@"reaL.png"]]; imagView.frame = CGRectMake(0, cellHeight, cellWidth, 1); [cell.contentView addSubview:imagView]; switch (indexPath.row) { case 0: cell.imageView.image = [self imageWithImage:[UIImage imageNamed:@"img1.png"] scaledToSize:CGSizeMake(27, 27)]; cell.imageView.highlightedImage = [self imageWithImage:[UIImage imageNamed:@"route.png"] scaledToSize:CGSizeMake(27, 27)]; break; case 1: cell.imageView.image = [self imageWithImage:[UIImage imageNamed:@"img.png"] scaledToSize:CGSizeMake(27, 27)]; cell.imageView.highlightedImage = [self imageWithImage:[UIImage imageNamed:@"money.png"] scaledToSize:CGSizeMake(27, 27)]; break; case 2: cell.imageView.image = [self imageWithImage:[UIImage imageNamed:@"auto.png"] scaledToSize:CGSizeMake(27, 27)]; cell.imageView.highlightedImage = [self imageWithImage:[UIImage imageNamed:@"cars.png"] scaledToSize:CGSizeMake(27, 27)]; break; case 3: cell.imageView.image = [self imageWithImage:[UIImage imageNamed:@"impostazioni.png"] scaledToSize:CGSizeMake(27, 27)]; cell.imageView.highlightedImage = [self imageWithImage:[UIImage imageNamed:@"impostazioni.png"] scaledToSize:CGSizeMake(27, 27)]; // cell.imageView.contentMode = UIViewContentModeScaleAspectFill; break; case 4: cell.imageView.image = [self imageWithImage:[UIImage imageNamed:@"info.png"] scaledToSize:CGSizeMake(27, 27)]; cell.imageView.highlightedImage = [self imageWithImage:[UIImage imageNamed:@"info.png"] scaledToSize:CGSizeMake(27, 27)]; break; default: break; } return cell; When I lunch the app everything is good, but when I scroll the the table, or when I select a cell the separator lines disappear. How I can have a permanent custom line separator?

    Read the article

  • Header Guard Issues - Getting Swallowed Alive

    - by gjnave
    I'm totally at wit's end: I can't figure out how my dependency issues. I've read countless posts and blogs and reworked my code so many times that I can't even remember what almost worked and what didnt. I continually get not only redefinition errors, but class not defined errors. I rework the header guards and remove some errors simply to find others. I somehow got everything down to one error but then even that got broke while trying to fix it. Would you please help me figure out the problem? card.cpp #include <iostream> #include <cctype> #include "card.h" using namespace std; // ====DECL====== Card::Card() { abilities = 0; flavorText = 0; keywords = 0; artifact = 0; classType = new char[strlen("Card") + 1]; classType = "Card"; } Card::~Card (){ delete name; delete abilities; delete flavorText; artifact = NULL; } // ------------ Card::Card(const Card & to_copy) { name = new char[strlen(to_copy.name) +1]; // creating dynamic array strcpy(to_copy.name, name); type = to_copy.type; color = to_copy.color; manaCost = to_copy.manaCost; abilities = new char[strlen(to_copy.abilities) +1]; strcpy(abilities, to_copy.abilities); flavorText = new char[strlen(to_copy.flavorText) +1]; strcpy(flavorText, to_copy.flavorText); keywords = new char[strlen(to_copy.keywords) +1]; strcpy(keywords, to_copy.keywords); inPlay = to_copy.inPlay; tapped = to_copy.tapped; enchanted = to_copy.enchanted; cursed = to_copy.cursed; if (to_copy.type != ARTIFACT) artifact = to_copy.artifact; } // ====DECL===== int Card::equipArtifact(Artifact* to_equip){ artifact = to_equip; } Artifact * Card::unequipArtifact(Card * unequip_from){ Artifact * to_remove = artifact; artifact = NULL; return to_remove; // put card in hand or in graveyard } int Card::enchant( Card * to_enchant){ to_enchant->enchanted = true; cout << "enchanted" << endl; } int Card::disenchant( Card * to_disenchant){ to_disenchant->enchanted = false; cout << "Enchantment Removed" << endl; } // ========DECL===== Spell::Spell() { currPower = basePower; currToughness = baseToughness; classType = new char[strlen("Spell") + 1]; classType = "Spell"; } Spell::~Spell(){} // --------------- Spell::Spell(const Spell & to_copy){ currPower = to_copy.currPower; basePower = to_copy.basePower; currToughness = to_copy.currToughness; baseToughness = to_copy.baseToughness; } // ========= int Spell::attack( Spell *& blocker ){ blocker->currToughness -= currPower; currToughness -= blocker->currToughness; } //========== int Spell::counter (Spell *& to_counter){ cout << to_counter->name << " was countered by " << name << endl; } // ============ int Spell::heal (Spell *& to_heal, int amountOfHealth){ to_heal->currToughness += amountOfHealth; } // ------- Creature::Creature(){ summoningSick = true; } // =====DECL====== Land::Land(){ color = NON; classType = new char[strlen("Land") + 1]; classType = "Land"; } // ------ int Land::generateMana(int mana){ // ... // } card.h #ifndef CARD_H #define CARD_H #include <cctype> #include <iostream> #include "conception.h" class Artifact; class Spell; class Card : public Conception { public: Card(); Card(const Card &); ~Card(); protected: char* name; enum CardType { INSTANT, CREATURE, LAND, ENCHANTMENT, ARTIFACT, PLANESWALKER}; enum CardColor { WHITE, BLUE, BLACK, RED, GREEN, NON }; CardType type; CardColor color; int manaCost; char* abilities; char* flavorText; char* keywords; bool inPlay; bool tapped; bool cursed; bool enchanted; Artifact* artifact; virtual int enchant( Card * ); virtual int disenchant (Card * ); virtual int equipArtifact( Artifact* ); virtual Artifact* unequipArtifact(Card * ); }; // ------------ class Spell: public Card { public: Spell(); ~Spell(); Spell(const Spell &); protected: virtual int heal( Spell *&, int ); virtual int attack( Spell *& ); virtual int counter( Spell*& ); int currToughness; int baseToughness; int currPower; int basePower; }; class Land: public Card { public: Land(); ~Land(); protected: virtual int generateMana(int); }; class Forest: public Land { public: Forest(); ~Forest(); protected: int generateMana(); }; class Creature: public Spell { public: Creature(); ~Creature(); protected: bool summoningSick; }; class Sorcery: public Spell { public: Sorcery(); ~Sorcery(); protected: }; #endif conception.h -- this is an "uber class" from which everything derives class Conception{ public: Conception(); ~Conception(); protected: char* classType; }; conception.cpp Conception::Conception{ Conception(){ classType = new char[11]; char = "Conception"; } game.cpp -- this is an incomplete class as of this code #include <iostream> #include <cctype> #include "game.h" #include "player.h" Battlefield::Battlefield(){ card = 0; } Battlefield::~Battlefield(){ delete card; } Battlefield::Battlefield(const Battlefield & to_copy){ } // =========== /* class Game(){ public: Game(); ~Game(); protected: Player** player; // for multiple players Battlefield* root; // for battlefield getPlayerMove(); // ask player what to do addToBattlefield(); removeFromBattlefield(); sendAttack(); } */ #endif game.h #ifndef GAME_H #define GAME_H #include "list.h" class CardList(); class Battlefield : CardList{ public: Battlefield(); ~Battlefield(); protected: Card* card; // make an array }; class Game : Conception{ public: Game(); ~Game(); protected: Player** player; // for multiple players Battlefield* root; // for battlefield getPlayerMove(); // ask player what to do addToBattlefield(); removeFromBattlefield(); sendAttack(); Battlefield* field; }; list.cpp #include <iostream> #include <cctype> #include "list.h" // ========== LinkedList::LinkedList(){ root = new Node; classType = new char[strlen("LinkedList") + 1]; classType = "LinkedList"; }; LinkedList::~LinkedList(){ delete root; } LinkedList::LinkedList(const LinkedList & obj) { // code to copy } // --------- // ========= int LinkedList::delete_all(Node* root){ if (root = 0) return 0; delete_all(root->next); root = 0; } int LinkedList::add( Conception*& is){ if (root == 0){ root = new Node; root->next = 0; } else { Node * curr = root; root = new Node; root->next=curr; root->it = is; } } int LinkedList::remove(Node * root, Node * prev, Conception* is){ if (root = 0) return -1; if (root->it == is){ root->next = root->next; return 0; } remove(root->next, root, is); return 0; } Conception* LinkedList::find(Node*& root, const Conception* is, Conception* holder = NULL) { if (root==0) return NULL; if (root->it == is){ return root-> it; } holder = find(root->next, is); return holder; } Node* LinkedList::goForward(Node * root){ if (root==0) return root; if (root->next == 0) return root; else return root->next; } // ============ Node* LinkedList::goBackward(Node * root){ root = root->prev; } list.h #ifndef LIST_H #define LIST_H #include <iostream> #include "conception.h" class Node : public Conception { public: Node() : next(0), prev(0), it(0) { it = 0; classType = new char[strlen("Node") + 1]; classType = "Node"; }; ~Node(){ delete it; delete next; delete prev; } Node* next; Node* prev; Conception* it; // generic object }; // ---------------------- class LinkedList : public Conception { public: LinkedList(); ~LinkedList(); LinkedList(const LinkedList&); friend bool operator== (Conception& thing_1, Conception& thing_2 ); protected: virtual int delete_all(Node*); virtual int add( Conception*& ); // virtual Conception* find(Node *&, const Conception*, Conception* ); // virtual int remove( Node *, Node *, Conception* ); // removes question with keyword int display_all(node*& ); virtual Node* goForward(Node *); virtual Node* goBackward(Node *); Node* root; // write copy constrcutor }; // ============= class CircularLinkedList : public LinkedList { public: // CircularLinkedList(); // ~CircularLinkedList(); // CircularLinkedList(const CircularLinkedList &); }; class DoubleLinkedList : public LinkedList { public: // DoubleLinkedList(); // ~DoubleLinkedList(); // DoubleLinkedList(const DoubleLinkedList &); protected: }; // END OF LIST Hierarchy #endif player.cpp #include <iostream> #include "player.h" #include "list.h" using namespace std; Library::Library(){ root = 0; } Library::~Library(){ delete card; } // ====DECL========= Player::~Player(){ delete fname; delete lname; delete deck; } Wizard::~Wizard(){ delete mana; delete rootL; delete rootH; } // =====Player====== void Player::changeName(const char[] first, const char[] last){ char* backup1 = new char[strlen(fname) + 1]; strcpy(backup1, fname); char* backup2 = new char[strlen(lname) + 1]; strcpy(backup1, lname); if (first != NULL){ fname = new char[strlen(first) +1]; strcpy(fname, first); } if (last != NULL){ lname = new char[strlen(last) +1]; strcpy(lname, last); } return 0; } // ========== void Player::seeStats(Stats*& to_put){ to_put->wins = stats->wins; to_put->losses = stats->losses; to_put->winRatio = stats->winRatio; } // ---------- void Player::displayDeck(const LinkedList* deck){ } // ================ void CardList::findCard(Node* root, int id, NodeCard*& is){ if (root == NULL) return; if (root->it.id == id){ copyCard(root->it, is); return; } else findCard(root->next, id, is); } // -------- void CardList::deleteAll(Node* root){ if (root == NULL) return; deleteAll(root->next); root->next = NULL; } // --------- void CardList::removeCard(Node* root, int id){ if (root == NULL) return; if (root->id = id){ root->prev->next = root->next; // the prev link of root, looks back to next of prev node, and sets to where root next is pointing } return; } // --------- void CardList::addCard(Card* to_add){ if (!root){ root = new Node; root->next = NULL; root->prev = NULL; root->it = &to_add; return; } else { Node* original = root; root = new Node; root->next = original; root->prev = NULL; original->prev = root; } } // ----------- void CardList::displayAll(Node*& root){ if (root == NULL) return; cout << "Card Name: " << root->it.cardName; cout << " || Type: " << root->it.type << endl; cout << " --------------- " << endl; if (root->classType == "Spell"){ cout << "Base Power: " << root->it.basePower; cout << " || Current Power: " << root->it.currPower << endl; cout << "Base Toughness: " << root->it.baseToughness; cout << " || Current Toughness: " << root->it.currToughness << endl; } cout << "Card Type: " << root->it.currPower; cout << " || Card Color: " << root->it.color << endl; cout << "Mana Cost" << root->it.manaCost << endl; cout << "Keywords: " << root->it.keywords << endl; cout << "Flavor Text: " << root->it.flavorText << endl; cout << " ----- Class Type: " << root->it.classType << " || ID: " << root->it.id << " ----- " << endl; cout << " ******************************************" << endl; cout << endl; // ------- void CardList::copyCard(const Card& to_get, Card& put_to){ put_to.type = to_get.type; put_to.color = to_get.color; put_to.manaCost = to_get.manaCost; put_to.inPlay = to_get.inPlay; put_to.tapped = to_get.tapped; put_to.class = to_get.class; put_to.id = to_get.id; put_to.enchanted = to_get.enchanted; put_to.artifact = to_get.artifact; put_to.class = to_get.class; put.to.abilities = new char[strlen(to_get.abilities) +1]; strcpy(put_to.abilities, to_get.abilities); put.to.keywords = new char[strlen(to_get.keywords) +1]; strcpy(put_to.keywords, to_get.keywords); put.to.flavorText = new char[strlen(to_get.flavorText) +1]; strcpy(put_to.flavorText, to_get.flavorText); if (to_get.class = "Spell"){ put_to.baseToughness = to_get.baseToughness; put_to.basePower = to_get.basePower; put_to.currToughness = to_get.currToughness; put_to.currPower = to_get.currPower; } } // ---------- player.h #ifndef player.h #define player.h #include "list.h" // ============ class CardList() : public LinkedList(){ public: CardList(); ~CardList(); protected: virtual void findCard(Card&); virtual void addCard(Card* ); virtual void removeCard(Node* root, int id); virtual void deleteAll(); virtual void displayAll(); virtual void copyCard(const Conception*, Node*&); Node* root; } // --------- class Library() : public CardList(){ public: Library(); ~Library(); protected: Card* card; int numCards; findCard(Card&); // get Card and fill empty template } // ----------- class Deck() : public CardList(){ public: Deck(); ~Deck(); protected: enum deckColor { WHITE, BLUE, BLACK, RED, GREEN, MIXED }; char* deckName; } // =============== class Mana(int amount) : public Conception { public: Mana() : displayTotal(0), classType(0) { displayTotal = 0; classType = new char[strlen("Mana") + 1]; classType = "Mana"; }; protected: int accrued; void add(); void remove(); int displayTotal(); } inline Mana::add(){ accrued += 1; } inline Mana::remove(){ accrued -= 1; } inline Mana::displayTotal(){ return accrued; } // ================ class Stats() : public Conception { public: friend class Player; friend class Game; Stats() : wins(0), losses(0), winRatio(0) { wins = 0; losses = 0; if ( (wins + losses != 0) winRatio = wins / (wins + losses); else winRatio = 0; classType = new char[strlen("Stats") + 1]; classType = "Stats"; } protected: int wins; int losses; float winRatio; void int getStats(Stats*& ); } // ================== class Player() : public Conception{ public: Player() : wins(0), losses(0), winRatio(0) { fname = NULL; lname = NULL; stats = NULL; CardList = NULL; classType = new char[strlen("Player") + 1]; classType = "Player"; }; ~Player(); Player(const Player & obj); protected: // member variables char* fname; char* lname; Stats stats; // holds previous game statistics CardList* deck[]; // hold multiple decks that player might use - put ll in this private: // member functions void changeName(const char[], const char[]); void shuffleDeck(int); void seeStats(Stats*& ); void displayDeck(int); chooseDeck(); } // -------------------- class Wizard(Card) : public Player(){ public: Wizard() : { mana = NULL; rootL = NULL; rootH = NULL}; ~Wizard(); protected: playCard(const Card &); removeCard(Card &); attackWithCard(Card &); enchantWithCard(Card &); disenchantWithCard(Card &); healWithCard(Card &); equipWithCard(Card &); Mana* mana[]; Library* rootL; // Library Library* rootH; // Hand } #endif

    Read the article

  • [Android] Show default selection color for custom listview

    - by Diego
    Hello, I have a listview with a custom BaseAdapter. Each row of the listview has a TextView and a CheckBox. The problem is when I click (or touch) any row, the textview foreground becomes gray, instead of the default behavior (background - green, textview foreground - white). Here is the code: row.xml: <?xml version="1.0" encoding="utf-8"?> <RelativeLayout xmlns:android="http://schemas.android.com/apk/res/android" style="@style/layout"> <TextView android:id="@+id/main_lv_item_textView" style="@style/textViewBig" android:layout_alignParentLeft="true"/> <CheckBox android:id="@+id/main_lv_item_checkBox" style="@style/checkBox" android:layout_width="wrap_content" android:layout_alignParentRight="true"/> </RelativeLayout> Custom Adapter: public class CustomAdapter extends BaseAdapter { private List<Profile> profiles; private LayoutInflater inflater; private TextView tvName; private CheckBox cbEnabled; public CustomAdapter(List<Profile> profiles) { this.profiles = profiles; inflater = (LayoutInflater) context.getSystemService(Context.LAYOUT_INFLATER_SERVICE); } public int getCount() { return profiles.size(); } public Object getItem(int position) { return profiles.get(position); } public long getItemId(int position) { return position; } public View getView(final int position, View convertView, ViewGroup parent) { View row = inflater.inflate(R.layout.main_lv_item, null); final Profile profile = profiles.get(position); tvName = (TextView) row.findViewById(R.id.main_lv_item_textView); registerForContextMenu(tvName); cbEnabled = (CheckBox) row.findViewById(R.id.main_lv_item_checkBox); tvName.setText(profile.getName()); if (profile.isEnabled()) { cbEnabled.setChecked(true); } tvName.setOnClickListener(new OnClickListener() { public void onClick(View v) { Bundle bundle = new Bundle(); bundle.putString(PROFILE_NAME_KEY, profile.getName()); Intent intent = new Intent(context, GuiProfile.class); intent.putExtras(bundle); startActivity(intent); } }); tvName.setOnLongClickListener(new OnLongClickListener() { public boolean onLongClick(View v) { selectedProfileName = ((TextView) v).getText().toString(); return false; } }); cbEnabled.setOnCheckedChangeListener(new CompoundButton.OnCheckedChangeListener() { public void onCheckedChanged(CompoundButton buttonView, boolean isChecked) { if (!profile.isEnabled()) { for (Profile profile : profiles) { if (profile.isEnabled()) { profile.setEnabled(false); Database.getInstance().storeProfile(profile); } } } profile.setEnabled(isChecked); Database.getInstance().storeProfile(profile); updateListView(); } }); return row; } } Any help would be appreciated.

    Read the article

  • Not allowing characters after Space. Mysql Insert With PHP

    - by Jake
    Ok so I think this is easy but I dont know (I'm a novice to PHP and MySQL). I have a select that is getting data from a table in the database. I am simply taking whatever options the user selects and putting it into a separate table with a php mysql insert statement. But I am having a problem. When I hit submit, everything is submitted properly except for any select options that have spaces don't submit after the first space. For example if the option was COMPUTER REPAIR, all that would get sent is COMPUTER. I will post code if needed, and any help would be greatly appreciated. Thanks! Ok here is my select code: <?php include("./config.php"); $query="SELECT id,name FROM category_names ORDER BY name"; $result = mysql_query ($query); echo"<div style='overflow:auto;width:100%'><label>Categories (Pick three that describe your business)</label><br/><select name='select1'><option value='0'>Please Select A Category</option>"; // printing the list box select command while($catinfo=mysql_fetch_array($result)){//Array or records stored in $nt echo "<option>$catinfo[name]</option><br/> "; } echo"</select></div>"; ?> And here is my insert code ( Just to let you know its got everything not just the select!) ?php require("./config.php"); $companyname = mysql_real_escape_string(addslashes(trim($_REQUEST['name']))); $phone = mysql_real_escape_string(addslashes($_REQUEST['phone'])); $zipcode = mysql_real_escape_string(addslashes($_REQUEST['zipcode'])); $city = mysql_real_escape_string(addslashes($_REQUEST['city'])); $description = mysql_real_escape_string(addslashes($_REQUEST['description'])); $website = mysql_real_escape_string(addslashes($_REQUEST['website'])); $address = mysql_real_escape_string(addslashes($_REQUEST['address'])); $other = mysql_real_escape_string(addslashes($_REQUEST['other'])); $payment = mysql_real_escape_string(addslashes($_REQUEST['payment'])); $products = mysql_real_escape_string(addslashes($_REQUEST['products'])); $email = mysql_real_escape_string(addslashes($_REQUEST['email'])); $select1 = mysql_real_escape_string(addslashes($_REQUEST['select1'])); $select2 = mysql_real_escape_string(addslashes($_REQUEST['select2'])); $select3 = mysql_real_escape_string(addslashes($_REQUEST['select3'])); $save=$_POST['save']; if(!empty($save)){ $sql="INSERT INTO gj (name, phone, city, zipcode, description, dateadded, website, address1, other2, payment_options, Products, email,cat1,cat2,cat3) VALUES ('$companyname','$phone','$city','$zipcode','$description',curdate(),'$website','$address','$other','$payment','$products','$email','$select1','$select2','$select3')"; if (!mysql_query($sql,$link)) { die('Error: ' . mysql_error()); } echo "<br/><h2><font color='green' style='font-size:15px'>1 business added</font></h2>"; mysql_close($link); } ?>

    Read the article

  • Tab Bar and Nav Controller: Where did I go wrong in my Interface Builder wiring?

    - by editor
    Even if you don't know how I've shot myself in the foot, a story which I've tried to lay out below, if you think I've done a good job showing the parameters of my problem I'd appreciate an upvote so that I might be able to grab some attention for my question. I've been working on an iPhone application in XCode and Interface Builder of the Tab Bar project type. After getting a table view of topics (business sectors) working fine I realized that I would need to add a Navigation Control to allow the user to drill into a subtopics (subsectors) table. As a green Objective-C developer, that was confusing, but I managed to get it working by reading various documentation trying out a few different IB options. My current setup is a Tab Bar Controller with Tab 1 as a Navigation Controller and Tab 2 a plain view with a Table View placed into it. The wiring works: I can log when table rows are selected and I'm ready to push a new View Controller onto the stack so that I can display the subtopics Table View. My problem: For some reason the first tab's Table View is a delegate and dataSource of the second ta. It doesn't make sense to me and I can't figure out why that's the only setup that works. Here is the wiring: Navigation Controller (Sectors) is a delegate of Tab Bar Navigation Bar is a delegate of Navigation Controller (Sectors) View Contoller (Sectors) has a view of Table View Table View (in Navigation Controller (Sectors)) is a delegate of First View Controller (Companies) Table View (in Navigation Controller (Sectors)) is a dataSource outlet of First View Controller (Companies) First View Controller (Companies) First View Contoller (Sectors) has a view of Table View Table View (in First View Controller (Companies)) is not hooked up to a dataSource outlet and is not a delegate When I click the tab buttons and look at the Inspector I see that the first tab is correctly hooked up to my MainWindow.xib and the second tab has selected a nib called SecondView.xib. It's in the File's Owner of MainWindow.xib where I inherit UITableViewDataSource and UITableViewDelegate (and also UITabBarControllerDelegate) in the .h, and in the .m where I implement the delegate methods. Why does this setup only work when the Table View in my first tab (View Controller (Sectors)) is a delegate and dataSource of the second tab? I'm confused: why wouldn't it need to be hooked up to the Navigation Controller-enabled tab in which the Table View is seen (Navigation Controller (Sectors))? The Table View seen on the second tab has neither dataSource and is not a delegate. I'm having trouble getting a pushViewController to fire (self.navigationController is not nil but the new View Controller still doesn't load) and I suspect that I need to work out this IB wiring issue before I can troubleshoot why the Nav Controller won't push a new View Controller onto the stack. if(nil == self.navigationController) { NSLog(@"self.navigationController is nil."); } else { NSLog(@"self.navigationController is not nil."); SectorList *subsectorViewController = [[SectorList alloc] initWithNibName:@"SectorList" bundle:nil]; subsectorViewController.title = @"Subsectors"; [[self navigationController] pushViewController:subsectorViewController animated:YES]; [subsectorViewController release]; }

    Read the article

  • Unit Testing - Am I doing it right?

    - by baron
    Hi everyone, Basically I have been programing for a little while and after finishing my last project can fully understand how much easier it would have been if I'd have done TDD. I guess I'm still not doing it strictly as I am still writing code then writing a test for it, I don't quite get how the test becomes before the code if you don't know what structures and how your storing data etc... but anyway... Kind of hard to explain but basically lets say for example I have a Fruit objects with properties like id, color and cost. (All stored in textfile ignore completely any database logic etc) FruitID FruitName FruitColor FruitCost 1 Apple Red 1.2 2 Apple Green 1.4 3 Apple HalfHalf 1.5 This is all just for example. But lets say I have this is a collection of Fruit (it's a List<Fruit>) objects in this structure. And my logic will say to reorder the fruitids in the collection if a fruit is deleted (this is just how the solution needs to be). E.g. if 1 is deleted, object 2 takes fruit id 1, object 3 takes fruit id2. Now I want to test the code ive written which does the reordering, etc. How can I set this up to do the test? Here is where I've got so far. Basically I have fruitManager class with all the methods, like deletefruit, etc. It has the list usually but Ive changed hte method to test it so that it accepts a list, and the info on the fruit to delete, then returns the list. Unit-testing wise: Am I basically doing this the right way, or have I got the wrong idea? and then I test deleting different valued objects / datasets to ensure method is working properly. [Test] public void DeleteFruit() { var fruitList = CreateFruitList(); var fm = new FruitManager(); var resultList = fm.DeleteFruitTest("Apple", 2, fruitList); //Assert that fruitobject with x properties is not in list ? how } private static List<Fruit> CreateFruitList() { //Build test data var f01 = new Fruit {Name = "Apple",Id = 1, etc...}; var f02 = new Fruit {Name = "Apple",Id = 2, etc...}; var f03 = new Fruit {Name = "Apple",Id = 3, etc...}; var fruitList = new List<Fruit> {f01, f02, f03}; return fruitList; }

    Read the article

  • I'm having trouble traversing a newly appended DOM element with jQuery

    - by culov
    I have a form that I want to be used to add entries. Once an entry is added, the original form should be reset to prepare it for the next entry, and the saved form should be duplicated prior to resetting and appended onto a div for 'storedEntries.' This much is working (for the most part), but Im having trouble accessing the newly created form... I need to change the value attribute of the submit button from 'add' to 'edit' so properly communicate what clicking that button should do. heres my form: <div class="newTruck"> <form id="addNewTruck" class='updateschedule' action="javascript:sub(sTime.value, eTime.value, lat.value, lng.value, street.value);"> <b style="color:green;">Opening at: </b> <input id="sTime" name="sTime" title="Opening time" value="Click to set opening time" class="datetimepicker"/> <b style="color:red;">Closing at: </b> <input id="eTime" name= "eTime" title="Closing time" value="Click to set closing time" class="datetimepicker"/> <label for='street'>Address</label> <input type='text' name='street' id='street' class='text' autocomplete='off'/> <input id='submit' class='submit' style="cursor: pointer; cursor: hand;" type="submit" value='Add new stop'/> <div id='suggests' class='auto_complete' style='display:none'></div> <input type='hidden' name='lat' id='lat'/> <input type='hidden' name='lng' id='lng'/> ive tried using a hundred different selectors with jquery to no avail... heres my script as it stands: function cloneAndClear(){ var id = name+now; $j("#addNewTruck").clone(true).attr("id",id).appendTo(".scheduledTrucks"); $j('#'+id).filter('#submit').attr('value', 'Edit'); $j("#addNewTruck")[0].reset(); createPickers(); } the element is properly cloned and inserted into the div, but i cant find a way to access this element... the third line in the script never works. Another problem i am having is that the 'values' in the cloned form revert back to the value in the source of the html rather than what the user inputs. advice on how to solve either of these issues is greatly appreciated!

    Read the article

  • Akka framework support for finding duplicate messages

    - by scala_is_awesome
    I'm trying to build a high-performance distributed system with Akka and Scala. If a message requesting an expensive (and side-effect-free) computation arrives, and the exact same computation has already been requested before, I want to avoid computing the result again. If the computation requested previously has already completed and the result is available, I can cache it and re-use it. However, the time window in which duplicate computation can be requested may be arbitrarily small. e.g. I could get a thousand or a million messages requesting the same expensive computation at the same instant for all practical purposes. There is a commercial product called Gigaspaces that supposedly handles this situation. However there seems to be no framework support for dealing with duplicate work requests in Akka at the moment. Given that the Akka framework already has access to all the messages being routed through the framework, it seems that a framework solution could make a lot of sense here. Here is what I am proposing for the Akka framework to do: 1. Create a trait to indicate a type of messages (say, "ExpensiveComputation" or something similar) that are to be subject to the following caching approach. 2. Smartly (hashing etc.) identify identical messages received by (the same or different) actors within a user-configurable time window. Other options: select a maximum buffer size of memory to be used for this purpose, subject to (say LRU) replacement etc. Akka can also choose to cache only the results of messages that were expensive to process; the messages that took very little time to process can be re-processed again if needed; no need to waste precious buffer space caching them and their results. 3. When identical messages (received within that time window, possibly "at the same time instant") are identified, avoid unnecessary duplicate computations. The framework would do this automatically, and essentially, the duplicate messages would never get received by a new actor for processing; they would silently vanish and the result from processing it once (whether that computation was already done in the past, or ongoing right then) would get sent to all appropriate recipients (immediately if already available, and upon completion of the computation if not). Note that messages should be considered identical even if the "reply" fields are different, as long as the semantics/computations they represent are identical in every other respect. Also note that the computation should be purely functional, i.e. free from side-effects, for the caching optimization suggested to work and not change the program semantics at all. If what I am suggesting is not compatible with the Akka way of doing things, and/or if you see some strong reasons why this is a very bad idea, please let me know. Thanks, Is Awesome, Scala

    Read the article

  • jQuery: Giving each matched element an unique ID

    - by AnGafraidh
    I am writing an 'inline translator' application to be used with a cloud computing platform to extend non-supported languages. The majority of this uses jQuery to find the text value, replace it with the translation, then append the element with a span tag that has an unique ID, to be used elsewhere within the application. The problem arises however, when there are more than one element, say , that have the exact same value to be translated (matched elements). What happens in the function in question is that it puts all matched elements in the same span, taking the second, third, fourth, etc. out of their parent tags. My code is pretty much like this example: <script src='jquery-1.4.2.js'></script> <script> jQuery.noConflict(); var uniqueID='asdfjkl'; jQuery(window).ready(function() { var myQ1 = jQuery("input[id~=test1]"); myClone=myQ1.clone(); myClone.val('Replaced this button'); myQ1.replaceWith('<span id='+uniqueID+'></span>'); jQuery('#'+uniqueID).append(myClone); }); </script> <table> <tr><td> <input id='test1' type='button' value="I'm a button!"></input> &nbsp; <input id='test2' type='button' value="And so am I"></input> </tr></td> <tr><td> <input id='test1' type='button' value="I'm a button!"></input> </tr></td> </table> As a workaround, I've experimented with using a loop to create a class for each span, rising in increment until jQuery("input[id~=test1]").length, but I can't seem to get anything I do to work. Is there any way to give each matched element an unique ID? My fluency in jQuery is being put to the test! Thanks for any help in advance. Aaron

    Read the article

  • How do I change the visual style of a listitem based on its bound value?

    - by Rodd
    I have a listbox (here's the xaml): <ListBox MinWidth="300" ItemsSource="{Binding Relationships, Mode=OneWay}" SelectedItem="{Binding SelectedRelationship, Mode=TwoWay}" SelectionMode="Single" HorizontalAlignment="Left" > <ListBox.ItemTemplate> <DataTemplate> <Grid> <Grid.ColumnDefinitions> <ColumnDefinition Width="Auto"/> <ColumnDefinition/> </Grid.ColumnDefinitions> <Grid.RowDefinitions> <RowDefinition/> <RowDefinition/> <RowDefinition/> <RowDefinition/> <RowDefinition/> <RowDefinition/> </Grid.RowDefinitions> <CheckBox IsChecked = "{Binding IsPrimary}" IsHitTestVisible="False" /> <StackPanel Orientation="Horizontal" Grid.Column="1"> <TextBlock Text="{Binding RelationshipType}" FontWeight="Bold" Margin="0,0,5,0" /> <TextBlock Text="{Binding Status}" FontStyle="Italic" /> </StackPanel> <TextBlock Text="{Binding UnitName}" Grid.Row="1" Grid.Column="1" /> <TextBlock Text="{Binding StartDate, Converter={StaticResource DateConverter}}" Grid.Row="2" Grid.Column="1"/> <TextBlock Text="{Binding RetireDate}" Grid.Row="3" Grid.Column="1" /> <TextBlock Text="{Binding EndDate}" Grid.Row="4" Grid.Column="1" /> <TextBlock Text="{Binding ReasonForLeaving}" Grid.Row="5" Grid.Column="1" /> </Grid> </DataTemplate> </ListBox.ItemTemplate> </ListBox> What I want to do is have each item in the listbox have one of 3 backgrounds (green if the value of IsPrimary = true, Orange if the EndDate value is empty and grey if the EndDate value is not empty. Is there a way to template the listbox items so that they evaluate bound items to determine a view state or to have each listbox item bind to a value that I can set for each item in my viewmodel? Thanks for your help.

    Read the article

  • Wordpress post query php custom field conditional

    - by Andy
    Here's the situation: In wordpress I'm trying to reset a post WP_Query so that I can rewrite the post link based on whether or not a custom field exists in the post. I'm trying to give the post a NEW link in the custom field. All I've managed to do here is kill the link entirely. Any and all help is greatly appreciated, I'm pretty green to php. Here's my WP_Query: <?php $recentPosts = new WP_Query(); $recentPosts->query('showposts=3'); ?> <?php while ($recentPosts->have_posts()) : $recentPosts->the_post(); ?> <div <?php post_class() ?> id="post-<?php the_ID(); ?>"> <?php $attribute = the_title_attribute(); $title = the_title(); $key = 'NewPostLink'; $newLink = get_post_meta( $post->ID, $key, TRUE ); if ($newLink != '') { $theLink = get_permalink ($post->ID ); if (has_post_thumbnail()) { $image = get_the_post_thumbnail( $post->ID ); echo '<div class="thumbnailbox"><div class="thumbnail"><a href="'.$theLink.'">'.$image.'</a></div></div>'; echo '<h2><a href="'.$theLink.'" rel="bookmark" title="Permanent Link to '.$attribute.'">'.$title.'</a></h2>'; } else { echo '<h2><a href="'.$theLink.'" rel="bookmark" title="Permanent Link to '.$attribute.'">'.$title.'</a></h2>'; } } else { $theLink = $newLink; if (has_post_thumbnail()) { $image = get_the_post_thumbnail( $post->ID ); echo '<div class="thumbnailbox"><div class="thumbnail"><a href="'.$theLink.'">'.$image.'</a></div></div>'; echo '<h2><a href="'.$theLink.'" rel="bookmark" title="Permanent Link to '.$attribute.'">'.$title.'</a></h2>'; } else { echo '<h2><a href="'.$theLink.'" rel="bookmark" title="Permanent Link to '.$attribute.'">'.$title.'</a></h2>'; } } ?> <small><?php the_time('F jS, Y') ?></small> <div class="entry"> <?php the_excerpt(); ?> </div> </div> <?php endwhile; ?>

    Read the article

  • Draw rectangle-like objects on a bitmap

    - by _simon_
    I am performing OCR (optical character recognition) on a bunch of images. Images are grouped into different projects (tickets, credit cards, insurance cards etc). Each image represents an actual product (for instance, if we have images of credit cards, picture1.jpg is image of my credit card, picture2.jpg is image of your credit card,... you get it). I have a settings.xml file, which contains regions of the image, where OCR should be performed. Example: <Project Name="Ticket1" TemplateImage="...somePath/templateTicket1.jpg"> <Region Name="Prefix" NumericOnly="false" Rotate="0"> <x>470</x> <y>395</y> <width>31</width> <height>36</height> </Region> <Region Name="Num1" NumericOnly="true" Rotate="0"> <x>555</x> <y>402</y> <width>123</width> <height>35</height> </Region> </Project> </Project Name="CreditCard" TemplateImage="...somePath/templateCreditCard1.jpg"> <Region Name="SerialNumber" NumericOnly="false" Rotate="90"> <x>332</x> <y>12</y> <width>20</width> <height>98</height> </Project> I would like to set these parameters through GUI (now I just write them into xml file). So, first I load a template image for a project (an empty credit card). Then I would like to draw a rectangle around a text, where OCR should be performed. I guess this isn't hard, but it would be great if I could also move and resize this rectangle object in the picture. I have to display all regions (rectangles) on the picture also. Also - there will probably be a list of regions in a listview, so when you click a region in this listview, it should mark it on the picture in a green color for example. Do you know for a library, which I could use? Or a link with some tips how to create such objects?

    Read the article

  • MySQL search for user and their roles

    - by Jenkz
    I am re-writing the SQL which lets a user search for any other user on our site and also shows their roles. An an example, roles can be "Writer", "Editor", "Publisher". Each role links a User to a Publication. Users can take multiple roles within multiple publications. Example table setup: "users" : user_id, firstname, lastname "publications" : publication_id, name "link_writers" : user_id, publication_id "link_editors" : user_id, publication_id Current psuedo SQL: SELECT * FROM ( (SELECT user_id FROM users WHERE firstname LIKE '%Jenkz%') UNION (SELECT user_id FROM users WHERE lastname LIKE '%Jenkz%') ) AS dt JOIN (ROLES STATEMENT) AS roles ON roles.user_id = dt.user_id At the moment my roles statement is: SELECT dt2.user_id, dt2.publication_id, dt.role FROM ( (SELECT 'writer' AS role, link_writers.user_id, link_writers.publication_id FROM link_writers) UNION (SELECT 'editor' AS role, link_editors.user_id, link_editors.publication_id FROM link_editors) ) AS dt2 The reason for wrapping the roles statement in UNION clauses is that some roles are more complex and require a table join to find the publication_id and user_id. As an example "publishers" might be linked accross two tables "link_publishers": user_id, publisher_group_id "link_publisher_groups": publisher_group_id, publication_id So in that instance, the query forming part of my UNION would be: SELECT 'publisher' AS role, link_publishers.user_id, link_publisher_groups.publication_id FROM link_publishers JOIN link_publisher_groups ON lpg.group_id = lp.group_id I'm pretty confident that my table setup is good (I was warned off the one-table-for-all system when researching the layout). My problem is that there are now 100,000 rows in the users table and upto 70,000 rows in each of the link tables. Initial lookup in the users table is fast, but the joining really slows things down. How can I only join on the relevant roles? -------------------------- EDIT ---------------------------------- Explain above (open in a new window to see full resolution). The bottom bit in red, is the "WHERE firstname LIKE '%Jenkz%'" the third row searches WHERE CONCAT(firstname, ' ', lastname) LIKE '%Jenkz%'. Hence the large row count, but I think this is unavoidable, unless there is a way to put an index accross concatenated fields? The green bit at the top just shows the total rows scanned from the ROLES STATEMENT. You can then see each individual UNION clause (#6 - #12) which all show a large number of rows. Some of the indexes are normal, some are unique. It seems that MySQL isn't optimizing to use the dt.user_id as a comparison for the internal of the UNION statements. Is there any way to force this behaviour? Please note that my real setup is not publications and writers but "webmasters", "players", "teams" etc.

    Read the article

  • Returning the Name of a column header

    - by Jason Kelly
    I need your help, Given the html table below, how can I create a javascript function that will, at the click of a mouse, alert me the name of the column header? Ie. if I click on the COLORS header, a javascript box will popup and alert("COLORS")? <html> <head> </head> <body> <table border="1" cellspacing="1" width="500"> <tr> <td>FRUITS</td> <td>COLORS</td> <td>VEGGIES</td> <td>NUMBERS</td> </tr> <tr> <td>apples</td> <td>red</td> <td>carrots</td> <td>123</td> </tr> <tr> <td>oranges</td> <td>blue</td> <td>celery</td> <td>456</td> </tr> <tr> <td>pears</td> <td>green</td> <td>brocoli</td> <td>789</td> </tr> <tr> <td>mangos</td> <td>yellow</td> <td>lettuce</td> <td>098</td> </tr> </table> </body> </html>

    Read the article

  • php parse error always on the last line

    - by is0lated
    I'm trying to read a comment that is stored in a mysql table. For some reason I always get a parse error on the last line of the file even if the last line is blank. I'm not sure if it's relevant but the connect.php works for putting the comment into the database. I'm using wampserver to host it and coding it by hand. I think that's it's something to do with the while loop, when I comment out the while(){ and the } near the end I just get a few missing variable errors as you would expect. I'm quite new to php coding so I'm pretty sure the problem will be something simple that I've either missed or not understood properly. Anyway, here's my code: <?php include "connect.php"; ?> <?php $sql = "SELECT * FROM main"; $result = mysql_query($sql) or die("Could not get posts from table"); while($rows=mysql_fetch_array($result)){ ?> <table bgcolor="green" align="center"> <tr> <td></td> </tr> <tr> <td><strong> <? echo $rows['name']; ?> </strong></td> </tr> <tr> <td> <? echo $rows['email']; ?> </td> </tr> <tr> <td> <? echo $rows['comment']; ?> </td> </tr> </table> <? } ?> Thanks for the help. :)

    Read the article

  • CSS: right wrapper dropping off the end of the page

    - by user310606
    I have an issue with a site I am working on where the right wrapper keeps dropping down below the site. Obviously I want it to stay on the right hand side. I've coded up a test case which shows my issue (I think) and I'm wondering if there is a better way to do things. The website url is http://www.musicworkshop.co.nz/ Below is the test case which (I think) is the cause of my issue, however it may not be. The pink box drops down if it does not fit within the page width. Is there a better way to do this? John <html> <head> <title> Test page </title> <link rel="stylesheet" href="test.css" type="text/css" /> </head> <body> <div id="superbox"> <div id="box1"> </div> <div id="box2"> </div> <div id="box3"> </div> <div id="box4"> </div> <div id="box5"> </div> <div id="box6"> </div> </div> </body> </html> #outsidebox{ width: 100%; } #superbox{ width: 1000px; height: 100px; margin: 0 auto; } #box1{ height: 100px; width: 200px; background: red; float: left; } #box2{ height: 100px; width: 200px; background: yellow; float: left; } #box3{ height: 100px; width: 200px; background: blue; float: left; } #box4{ height: 100px; width: 200px; background: green; float: left; } #box5{ height: 100px; width: 200px; background: grey; float: left; } #box6{ height: 100px; width: 200px; background: pink; float: left; }

    Read the article

  • Solve a maze using multicores?

    - by acidzombie24
    This question is messy, i dont need a working solution, i need some psuedo code. How would i solve this maze? This is a homework question. I have to get from point green to red. At every fork i need to 'spawn a thread' and go that direction. I need to figure out how to get to red but i am unsure how to avoid paths i already have taken (finishing with any path is ok, i am just not allowed to go in circles). Heres an example of my problem, i start by moving down and i see a fork so one goes right and one goes down (or this thread can take it, it doesnt matter). Now lets ignore the rest of the forks and say the one going right hits the wall, goes down, hits the wall and goes left, then goes up. The other thread goes down, hits the wall then goes all the way right. The bottom path has been taken twice, by starting at different sides. How do i mark this path has been taken? Do i need a lock? Is this the only way? Is there a lockless solution? Implementation wise i was thinking i could have the maze something like this. I dont like the solution because there is a LOT of locking (assuming i lock before each read and write of the haveTraverse member). I dont need to use the MazeSegment class below, i just wrote it up as an example. I am allowed to construct the maze however i want. I was thinking maybe the solution requires no connecting paths and thats hassling me. Maybe i could split the map up instead of using the format below (which is easy to read and understand). But if i knew how to split it up i would know how to walk it thus the problem. How do i walk this maze efficiently? The only hint i receive was dont try to conserve memory by reusing it, make copies. However that was related to a problem with ordering a list and i dont think the hint was a hint for this. class MazeSegment { enum Direction { up, down, left, right} List<Pair<Direction, MazeSegment*>> ConnectingPaths; int line_length; bool haveTraverse; } MazeSegment root; class MazeSegment { enum Direction { up, down, left, right} List<Pair<Direction, MazeSegment*>> ConnectingPaths; bool haveTraverse; } void WalkPath(MazeSegment segment) { if(segment.haveTraverse) return; segment.haveTraverse = true; foreach(var v in segment) { if(v.haveTraverse == false) spawn_thread(v); } } WalkPath(root);

    Read the article

  • Painting component inside another component

    - by mike_hornbeck
    I've got a task to display painted 'eyes' with menu buttons to change their colors, and background color. Next animate them. But currently I'm stuck at painting, sinc in my JFrame I've Created JPanel containing panels with drawn eyes and buttons. Buttons are rendered properly but my eyes canvas is not shown. I've tried changing paint to paintComponent, setting contentPane differently but still nothing works. import java.awt.*; import javax.swing.*; public class Main extends JFrame { public static void main(String[] args) { final JFrame frame = new JFrame("Eyes"); frame.setPreferredSize(new Dimension(600, 450)); frame.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); JPanel players = new JPanel(new GridLayout(1, 3)); players.add(new JButton("Eyes color")); players.add(new JButton("Eye pupil")); players.add(new JButton("Background color")); JPanel eyes = new JPanel(); Eyes e = new Eyes(); eyes.add(e); eyes.setPreferredSize(new Dimension(600, 400)); JPanel content = new JPanel(); content.setLayout(new BoxLayout(content, BoxLayout.Y_AXIS)); frame.setContentPane(content); content.add(players); content.add(eyes); // frame.getContentPane().add(content); frame.pack(); frame.setVisible(true); } } class Eyes extends JPanel { public Eyes(){ } public void paint(Graphics g) { super.paintComponent(g); Graphics2D g2d = (Graphics2D) g; g2d.setRenderingHint(RenderingHints.KEY_ANTIALIASING,RenderingHints.VALUE_ANTIALIAS_ON); BasicStroke bs = new BasicStroke(3.0f); g2d.setBackground(Color.green); g2d.setStroke(bs); g2d.setColor(Color.yellow); g2d.fillOval(50, 150, 200, 200); g2d.fillOval( 350, 150, 200, 200); g2d.setColor(Color.BLACK); g2d.drawOval(49, 149, 201, 201); g2d.drawOval(349, 149, 201, 201); g2d.fillOval(125, 225, 50, 50); g2d.fillOval(425, 225, 50, 50); } } This is what I should get : This is what I have : When I've tried painting it directly in JFrame it works almost perfect, apart of background not being set. Why setBackgroundColor doesn't influence my drawing in any way ?

    Read the article

  • How to validate if all check boxes are ticked in jQuery?

    - by Jude
    I am a beginner in jQuery and I was wondering how to validate the form before submission specifically for check boxes. I am creating a simple check list form where my user would tick a check box if he finished that step. What I am planning to do is that, the script would prevent the form submission if there is an "unticked" checkbox and highlight it with a color. Here's my code : <!doctype html> <html> <head> <meta charset="utf-8"> <title>checkbox</title> <style> .error { background-color:#F00; } .valid { background-color:#0F0; } </style> <script type="application/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"> </script> <script type="application/javascript"> function validateAll() { $(".tick").change(function(){ if ($('.tick:checked').length == $('.tick').length) { $('#container').removeClass(); $('#container').addClass('error'); } else { $('#container').removeClass(); $('#container').addClass('valid'); } }); } </script> </head> <body> <div id="container"><input class="tick" id="option1" type="checkbox"></div> <div id="container"><input class="tick" id="option1" type="checkbox"></div> <input id="button" type="button" onClick="validateAll();" value="check"> </body> </html> So what I am trying to do here is when the user clicks the button, the script will highlight all the unchecked check box with red and highlight all checked with green. However, my script is not functioning. What is wrong with my script? Any suggestions on a more efficient way to do this?

    Read the article

  • SCOM 2012 DNS Forwarder Availability Monitor

    - by Massimo
    Background: I have an environment with two different AD domains, each in its own forest, each with two Windows Server 2008 R2 domain controllers acting as DNS servers. There is no trust between the domains. Each DNS server manages the main DNS zone for its AD domain, and then some other zones, including the reverse lookup zone for its IP subnets; all zones are AD-integrated; all DNS servers which manages a zone are correctly listed as authoritative name servers for that zone. So, the situation is like this (using fake names and IP addresses): Domain A: DNS domain: a.dom IP subnet: 192.168.1.X DC/DNS Servers: serverA1.a.dom (192.168.1.1) and serverA2.a.dom (192.168.1.2) Authoritative zones: a.dom, 1.168.192.in-addr.arpa, somezone.local Domain B: DNS domain: b.dom IP subnet: 10.0.0.X DC/DNS Servers: serverB1.b.dom (10.0.0.1) and serverB2.b.dom (10.0.0.2) Authoritative zones: b.dom, 0.0.10.in-addr.arpa, someotherzone.local DNS servers in domain A have conditional forwarders defined for each zone managed by DNS servers in domain B, forwarding to both domain B's DNS servers; DNS servers in domain B have the opposite configuration. All forwarders are stored in Active Directory. All is working perfectly, and computers in each domain can resolve forward and reverse DNS queries for both domains, using their domain's DNS servers. The problem: I have SCOM 2012 deployed in domain A, with the SCOM agent installed on both DCs; the management packs for Active Directory and DNS Server are installed and up-to-date. I have a series of alerts like the following ones on both domain controllers; each alert is generated for each forwarded zone and for each forwarded server: Forwarder someotherzone.local (10.0.0.1) cannot resolve the host name 192.168.1.1,someotherzone.local for serverA1.a.dom Forwarder someotherzone.local (10.0.0.2) cannot resolve the host name 192.168.1.1,someotherzone.local for serverA1.a.dom Forwarder someotherzone.local (10.0.0.1) cannot resolve the host name 192.168.1.2,someotherzone.local for serverA2.a.dom Forwarder someotherzone.local (10.0.0.2) cannot resolve the host name 192.168.1.2,someotherzone.local for serverA2.a.dom Forwarder 0.0.10.in-addr.arpa (10.0.0.1) cannot resolve the host name 192.168.1.1,0.0.10.in-addr.arpa for serverA1.a.dom Forwarder 0.0.10.in-addr.arpa (10.0.0.2) cannot resolve the host name 192.168.1.1,0.0.10.in-addr.arpa for serverA1.a.dom Forwarder 0.0.10.in-addr.arpa (10.0.0.1) cannot resolve the host name 192.168.1.2,0.0.10.in-addr.arpa for serverA2.a.dom Forwarder 0.0.10.in-addr.arpa (10.0.0.2) cannot resolve the host name 192.168.1.2,0.0.10.in-addr.arpa for serverA2.a.dom The only exception is the main AD DNS zone managed by domain B's DNS servers (b.dom): for that conditional forwarder, no alert is generated and the forwarder availability monitor is green. Ok, what does this mean? What are those monitors trying to tell me? What are they checking? What's actually wrong? And why there is no error for the "b.dom" zone, which is configured in the exact same way as the other ones, both as a zone in domain B's DNS servers and as a forwarder in domain A's DNS servers?

    Read the article

  • Error installing pkgconfig via macports

    - by Greg K
    I installed Macports 1.8.2 from a DMG. That seemed to install fine. I ran sudo port selfupdate to make sure my ports tree was current. I then tried to install bindfs as I want to mount some directories in my OS X file system (like you can do with mount --bind in linux). pkgconfig and macfuse are two dependencies of bindfs. I had trouble installing bindfs due to errors installing pkgconfig, so I tried to just install pkgconfig, here's the debug output from sudo port install pkgconfig: $ sudo port -d install pkgconfig DEBUG: Found port in file:///opt/local/var/macports/sources/rsync.macports.org/release/ports/devel/pkgconfig DEBUG: Changing to port directory: /opt/local/var/macports/sources/rsync.macports.org/release/ports/devel/pkgconfig DEBUG: OS Platform: darwin DEBUG: OS Version: 10.3.0 DEBUG: Mac OS X Version: 10.6 DEBUG: System Arch: i386 DEBUG: setting option os.universal_supported to yes DEBUG: org.macports.load registered provides 'load', a pre-existing procedure. Target override will not be provided DEBUG: org.macports.unload registered provides 'unload', a pre-existing procedure. Target override will not be provided DEBUG: org.macports.distfiles registered provides 'distfiles', a pre-existing procedure. Target override will not be provided DEBUG: adding the default universal variant DEBUG: Reading variant descriptions from /opt/local/var/macports/sources/rsync.macports.org/release/ports/_resources/port1.0/variant_descriptions.conf DEBUG: Requested variant darwin is not provided by port pkgconfig. DEBUG: Requested variant i386 is not provided by port pkgconfig. DEBUG: Requested variant macosx is not provided by port pkgconfig. ---> Computing dependencies for pkgconfig DEBUG: Executing org.macports.main (pkgconfig) DEBUG: Skipping completed org.macports.fetch (pkgconfig) DEBUG: Skipping completed org.macports.checksum (pkgconfig) DEBUG: Skipping completed org.macports.extract (pkgconfig) DEBUG: Skipping completed org.macports.patch (pkgconfig) ---> Configuring pkgconfig DEBUG: Using compiler 'Mac OS X gcc 4.2' DEBUG: Executing org.macports.configure (pkgconfig) DEBUG: Environment: CFLAGS='-O2 -arch x86_64' CPPFLAGS='-I/opt/local/include' CXXFLAGS='-O2 -arch x86_64' MACOSX_DEPLOYMENT_TARGET='10.6' CXX='/usr/bin/g++-4.2' F90FLAGS='-O2 -m64' LDFLAGS='-L/opt/local/lib' OBJC='/usr/bin/gcc-4.2' FCFLAGS='-O2 -m64' INSTALL='/usr/bin/install -c' OBJCFLAGS='-O2 -arch x86_64' FFLAGS='-O2 -m64' CC='/usr/bin/gcc-4.2' DEBUG: Assembled command: 'cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_devel_pkgconfig/work/pkg-config-0.23" && ./configure --prefix=/opt/local --enable-indirect-deps --with-pc-path=/opt/local/lib/pkgconfig:/opt/local/share/pkgconfig' checking for a BSD-compatible install... /usr/bin/install -c checking whether build environment is sane... yes checking for gawk... no checking for mawk... no checking for nawk... no checking for awk... awk checking whether make sets $(MAKE)... no checking whether to enable maintainer-specific portions of Makefiles... no checking build system type... i386-apple-darwin10.3.0 checking host system type... i386-apple-darwin10.3.0 checking for style of include used by make... none checking for gcc... /usr/bin/gcc-4.2 checking for C compiler default output file name... configure: error: C compiler cannot create executables See `config.log' for more details. Error: Target org.macports.configure returned: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_devel_pkgconfig/work/pkg-config-0.23" && ./configure --prefix=/opt/local --enable-indirect-deps --with-pc-path=/opt/local/lib/pkgconfig:/opt/local/share/pkgconfig " returned error 77 DEBUG: Backtrace: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_devel_pkgconfig/work/pkg-config-0.23" && ./configure --prefix=/opt/local --enable-indirect-deps --with-pc-path=/opt/local/lib/pkgconfig:/opt/local/share/pkgconfig " returned error 77 while executing "$procedure $targetname" Warning: the following items did not execute (for pkgconfig): org.macports.activate org.macports.configure org.macports.build org.macports.destroot org.macports.install Error: Status 1 encountered during processing. I have only recently installed Xcode 3.2.2 (prior to installing macports). Am I right in thinking this the issue here: configure: error: C compiler cannot create executables

    Read the article

< Previous Page | 151 152 153 154 155 156 157 158 159 160 161 162  | Next Page >