Search Results

Search found 20092 results on 804 pages for 'python import'.

Page 155/804 | < Previous Page | 151 152 153 154 155 156 157 158 159 160 161 162  | Next Page >

  • Convert alphabet letters to number in python

    - by altin
    Can someone help me finish this characters = ['a''b''c''d''e''f''g''h''i''j''k''l''m''n''o''p''q''r''t''u''v''w''x''y''z'] numbers = ['1''2''3''4''5''6''7''8''9''10''11''12''13''14''15''16''17''18''19''20''21''22''23''24'] text = raw_input(' Write text: ') Ive tryed to many ways but couldnt get to the pint, I want to make exc if i type hello the output to be in numbers lined like in alphabet... example a = 1 < in alphabet Can anyone give ideas ? or help sth ?

    Read the article

  • removing pairs of elements from numpy arrays that are NaN (or another value) in Python

    - by user248237
    I have an array with two columns in numpy. For example: a = array([[1, 5, nan, 6], [10, 6, 6, nan]]) a = transpose(a) I want to efficiently iterate through the two columns, a[:, 0] and a[:, 1] and remove any pairs that meet a certain condition, in this case if they are NaN. The obvious way I can think of is: new_a = [] for val1, val2 in a: if val2 == nan or val2 == nan: new_a.append([val1, val2]) But that seems clunky. What's the pythonic numpy way of doing this? thanks.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Listing all possible values for SOAP enumeration with Python SUDS

    - by bdk
    I'm connecting with a SUDS client to a SOAP Server whose wsdl contains manu enumerations like the following: </simpleType> <simpleType name="FOOENUMERATION"> <restriction base="xsd:string"> <enumeration value="ALPHA"><!-- enum const = 0 --> <enumeration value="BETA"/><!-- enum const = 1 --> <enumeration value="GAMMA"/><!-- enum const = 2 --> <enumeration value="DELTA"/><!-- enum const = 3 --> </restriction> </simpleType> In my client I am receiving sequences which contain elements of these various enumeration types. My need is that given a member variable, I need to know all possible enumeration values. Basically I need a function which takes an instance of one of these enums and returns a list of strings which are all the possible values. When I have an instance, running: print type(foo.enumInstance) I get: <class 'suds.sax.text.Text'> I'm not sure how to get the actual simpleType name from this, and then get the possible values from that short of parsing the WSDL myself.

    Read the article

  • Python learner needs help spotting an error

    - by Protean
    This piece of code gives a syntax error at the colon of "elif process.loop(i, len(list_i) != 'repeat':" and I can't seem to figure out why. class process: def loop(v1, v2): if v1 < v2 - 1: return 'repeat' def isel(chr_i, list_i): for i in range(len(list_i)): if chr_i == list_i[i]: return list_i[i] elif process.loop(i, len(list_i) != 'repeat': return 'error'()

    Read the article

  • Python, a smarter way of string to integer conversion

    - by Hellnar
    Hello I have written this code to convert string in such format "0(532) 222 22 22" to integer such as 05322222222 . class Phone(): def __init__(self,input): self.phone = input def __str__(self): return self.phone #convert to integer. def to_int(self): return int((self.phone).replace(" ","").replace("(","").replace(")","")) test = Phone("0(532) 222 22 22") print test.to_int() It feels very clumsy to use 3 replace methods to solve this. I am curious if there is a better solution?

    Read the article

  • Python: how to enclose strings in a list with < and >

    - by Michael Konietzny
    Hello, i would like to enclose strings inside of list into < (formatted like <%s). The current code does the following: def create_worker (general_logger, general_config): arguments = ["worker_name", "worker_module", "worker_class"] __check_arguments(arguments) def __check_arguments(arguments): if len(sys.argv) < 2 + len(arguments): print "Usage: %s delete-project %s" % (__file__," ".join(arguments)) sys.exit(10) The current output looks like this: Usage: ...\handler_scripts.py delete-project worker_name worker_module worker_class and should look like this: Usage: ...\handler_scripts.py delete-project <worker_name> <worker_module> <worker_class> Is there any short way to do this ? Greetings, Michael

    Read the article

  • Python TKinter connect variable to entry widget

    - by Sano98
    Hi everyone, I'm trying to associate a variable with a Tkinter entry widget, in a way that: Whenever I change the value (the "content") of the entry, mainly by typing something into it, the variable automatically gets assigned the value of what I've typed. Without me having to push a button "Update value " or something like that first. Whenever the variable gets changed (by some other part of the programm), I want the entry value displayed to be adjusted automatically. I believe that this could work via the textvariable. I read the example on http://effbot.org/tkinterbook/entry.htm, but it is not exactly helping me for what I have in mind. I have a feeling that there is a way of ensuring the first condition with using entry's "validate". Any ideas? Thank you for your input! Sano

    Read the article

  • python search replace using wildcards

    - by tom smith
    hi somewhat confused.. but trying to do a search/repace using wildcards if i have something like: <blah.... ssf ff> <bl.... ssf dfggg ff> <b.... ssf ghhjj fhf> and i want to replace all of the above strings with say, <hh >t any thoughts/comments on how this can be accomplished? thanks update (thanks for the comments!) i'm missing something... my initial sample text are: Soo Choi</span>LONGEDITBOX">Apryl Berney Soo Choi</span>LONGEDITBOX">Joel Franks Joel Franks</span>GEDITBOX">Alexander Yamato and i'm trying to get Soo Choi foo Apryl Berney Soo Choi foo Joel Franks Joel Franks foo Alexander Yamato i've tried derivations of name=re.sub("</s[^>]*\">"," foo ",name) but i'm missing something... thoughts... thanks

    Read the article

  • Using Python and Mechanize with ASP Forms

    - by tchaymore
    I'm trying to submit a form on an .asp page but Mechanize does not recognize the name of the control. The form code is: <form id="form1" name="frmSearchQuick" method="post"> .... <input type="button" name="btSearchTop" value="SEARCH" class="buttonctl" onClick="uf_Browse('dledir_search_quick.asp');" > My code is as follows: br = mechanize.Browser() br.open(BASE_URL) br.select_form(name='frmSearchQuick') resp = br.click(name='btSearchTop') I've also tried the last line as: resp = br.submit(name='btSearchTop') The error I get is: raise ControlNotFoundError("no control matching "+description) ControlNotFoundError: no control matching name 'btSearchTop', kind 'clickable' If I print br I get this: IgnoreControl(btSearchTop=) But I don't see that anywhere in the HTML. Any advice on how to submit this form?

    Read the article

  • Python turtle module confusion

    - by John
    Hi, I'm trying to to add more lines to the triangle, so instead of 3 leading off there will be 5 depending on the parameter given but I really have no idea what to do at this stage and any help would be very welcome. Thanks in advance!:) def draw_sierpinski_triangle(tracer_on, colour, initial_modulus, line_width, initial_heading,initial_x, initial_y, steps): turtle=Turtle() turtle.name = 'Mother of all turtles' turtle.reset () turtle.tracer (tracer_on) turtle.speed ('fastest') turtle.color (colour) turtle.width (line_width) turtle.up() turtle.goto (initial_x, initial_y) turtle.down() turtle.set_heading (initial_heading) draw_sub_pattern (tracer_on, turtle, initial_modulus, 0, steps) def draw_sub_pattern (tracer_on, turtle, modulus, depth, steps): if (depth >= steps): return; x, y = turtle.position () heading = turtle.heading () # draw the pattern turtle.up() turtle.down() turtle.forward (modulus) draw_sub_pattern(tracer_on, turtle, modulus * 0.5, depth + 1, steps) turtle.up() turtle.goto(x, y) turtle.down() turtle.set_heading (heading + 120) turtle.forward (modulus) draw_sub_pattern(tracer_on, turtle, modulus * 0.5, depth + 1, steps) turtle.up() turtle.goto(x, y) turtle.down() turtle.set_heading (heading + 240) turtle.forward (modulus) draw_sub_pattern(tracer_on, turtle, modulus * 0.5, depth + 1, steps)

    Read the article

  • how to send file via http with python

    - by ep45
    Hello, I have a problem. I use Apache with mod_wsgi and webpy, and when i send a file on http, a lot packets are lost. This is my code : web.header('Content-Type','video/x-flv') web.header('Content-length',sizeFile) f = file(FILE_PATH, 'rb') while True: buffer = f.read(4*1024) if buffer : yield buffer else : break f.close() What in my code is wrong ? thanks.

    Read the article

  • mouse rollover event in Python (VPython)

    - by kame
    Is there something similar to scene.mouse.getclick in the visual module (VPython)? I need it for a rollover. Thanks in advance. EDIT: I need a function for doing something when the mouse moves inside a special area without clicking.

    Read the article

  • Text-based game graphics in Python

    - by Jasper
    Hi, i'm pretty new 2 programming, and I'm creating a simple text-based game I'm wondering if there is a simple way to create my own terminal-type window with which I can place coloured input etc. Is there a graphics module well suited to this? I'm using Mac, but I would like it to work on Windows as well Thanks

    Read the article

  • In python, changing MySQL query based on function variables

    - by ensnare
    I'd like to be able to add a restriction to the query if user_id != None ... for example: "AND user_id = 5" but I am not sure how to add this into the below function? Thank you. def get(id, user_id=None): query = """SELECT * FROM USERS WHERE text LIKE %s AND id = %s """ values = (search_text, id) results = DB.get(query, values) This way I can call: get(5) get(5,103524234) (contains user_id restriction)

    Read the article

< Previous Page | 151 152 153 154 155 156 157 158 159 160 161 162  | Next Page >