Search Results

Search found 10488 results on 420 pages for 'rewrite module'.

Page 157/420 | < Previous Page | 153 154 155 156 157 158 159 160 161 162 163 164  | Next Page >

  • Share java object between two forms using Spring IoC

    - by Vladimir
    I want to share java object between two forms using Spring IoC. It should acts like Registry: Registry.set("key", new Object()); // ... Object o = Registry.get("key"); // ... Registry.set("key", new AnotherObject()); // rewrite old object I tried this code to register bean at runtime: applicationContext.getBeanFactory().registerSingleton("key", object); but it does not allow to rewrite existing object (result code for checking and deleting existing bean is too complicated)... PS I am Java newbie, so mb I am doing it wrong and I should not use IoC at all... any help is appreciated...

    Read the article

  • Is it possible to add IPTC data to a JPG using python when no such data already exists?

    - by ventolin
    With the IPTCInfo module under Python (http://snippets.dzone.com/posts/show/768 for more info) it's possible to read, modify and write IPTC info to pictures. However, if a JPG doesn't already have IPTC information, the module simply raises an exception. It doesn't seem to be able to create and add this metadata information itself. What alternatives are there? I've googled for the past hour but to no avail whatsoever.

    Read the article

  • how to manage the use of both $_SERVER['PHP_SELF'] in action of form and htaccess for urlrewriting t

    - by OM The Eternity
    how to manage the use of both $_SERVER['PHP_SELF'] in action of form and htaccess for url-rewriting? If I submit a form and in the action attribute of it i pass "$_SERVER['PHP_SELF']" and at the same time i am using url rewriting for the same page.. then these two things will contradict each other resulting in the display of action value of form in address bar.. so how can i manage this to get the url rewrited form of $_SERVER['PHP_SELF']? here the rewrite rule is to change the name of url file likewise as if form is submitted to any file say direction.php then rewrite will change it to something 30/redirect.html

    Read the article

  • Common utility functions for Perl .t tests

    - by zedoo
    Hi I am getting started with Test::More, already have a few .t test scripts. Now I'd like to define a function that will only be used for the tests, but accross different .t files. Where's the best place to put such a function? Define another .t without any tests and require it where needed? (As a sidenote I use the module structure created by Module::Starter)

    Read the article

  • How to restrict code from developers

    - by Kelvin
    My company is planning in hiring outsourcers to work for us, but concerned to give whole existing code to outside world. What is the proper way to deal with security of sharing code in such cases? Is it possible to restrict part of code for developers? So each of them could work on their project without having access to whole repository. P.S. The code we have is very integrated, and its hard to extract "one module", each module can use files from different locations. Thanks in advance

    Read the article

  • Parallel CURL function Help .. php

    - by Webby
    Hello.. Firstly let me explain the code below is just a tiny snippet of the code I'm using on the working site. Basically I'm hoping someone can help me rewrite just the function below to enable parallel CURL calls... that way it will fit nicely into the existing code without me having to rewrite the whole from the ground up like some of the samples I've been finding today any ideas? function get_data($url) { $ch = curl_init(); $timeout = 5; curl_setopt($ch,CURLOPT_URL,$url); curl_setopt($ch,CURLOPT_RETURNTRANSFER,1); curl_setopt($ch,CURLOPT_CONNECTTIMEOUT,5); $data = curl_exec($ch); curl_close($ch); return $data; } p.s. $url goes through a huge bunch of urls in a loop already so I'd hole to keep that intact.. Help always appreciated and rewarded

    Read the article

  • Replacing python docstrings

    - by tomaz
    I have written a epytext to reST markup converter, and now I want to convert all the docstrings in my entire library from epytext to reST format. Is there a smart way to read the all the docstrings in a module and write back the replacements? ps: ast module perhaps?

    Read the article

  • Getting "uninitialized constant" in Rails app

    - by Robert McCabe
    I'm new to Rails and feeling my way, but this has me stumped. I moved some constants to a separate module ie: module Fns Fclick = "function() { alert(\"You clicked the map.\");}\n" ... end then in my controller added: require "fns" class GeomapController < ApplicationController def index fstring = Fns::Fclick ... end but when I run the server I get: uninitialized constant Fns::Fclick what am I missing?

    Read the article

  • C++ DLL Export: Decorated/Mangled names

    - by Bob
    Created basic C++ DLL and exported names using Module Definition file (MyDLL.def). After compilation I check the exported function names using dumpbin.exe I expect to see: SomeFunction but I see this instead: SomeFunction = SomeFunction@@@23mangledstuff#@@@@ Why? The exported function appears undecorated (especially compared to not using the Module Def file), but what's up with the other stuff? If I use dumpbin.exe against a DLL from any commercial application, you get the clean: SomeFunction and nothing else......

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Most common software development mistakes

    - by hgulyan
    Inspired by Dealing with personal failure, I remembered my own failed software development experience. Finally I agreed to rewrite existing application. It took me less than a week to rewrite existing app and more up to 2 months to write from zero my own. That 2 months were really hard and interesting. It was my first big software development process. I researched almost everything concerning to my application. Read Code Complete. Even some articles on how to create user interface. Some psychology stuff. Typography, Colors. DAL, DB Structure, SOA, Patterns, UML, Load testing etc. I hope, that after a month or 2 I would get opportunity to continue working on my failed project, but before that, I would like to ask: What are common mistakes in software development? What you shouldn't do in any case?

    Read the article

  • Passenger, Apache and avoiding page caching

    - by Michael Guterl
    I'm hosting a rack application with passenger and apache. The application is setup to cache the content of each request to the public directory after each request. This allows apache to serve the content directly as a static page for future requests. I would like to tell Apache, presumably through some rewrite rules that any requests with query parameters should not be cached, but instead passed down to the rack application. With a mongrel setup I would just redirect it to the balancer if it meets my rewrite conditions. How do you do the same with passenger?

    Read the article

  • Tips for making administration of Drupal site easier

    - by Busk
    I'm creating a Drupal site for a client, and I'd like to make administrating the site as easy as possible for them. Examples of what they'd want to do with the site is: Add/Edit/Remove content which will be displayed on various pages Manage a forum - Just the basic Drupal Forum module Add / Ban Users Respond to comments left using the webforum I see there is an Admin module, that looks pretty promising. But I was wondering if anyone has any other helpful tips. Thanks

    Read the article

  • Some problem with postgres_psycopg2

    - by aatifh
    Last night I upgraded my machine to Ubuntu 10.04 from 9.10. It seems to have cluttered my python module. Whenever I run python manage.py I get this error: ImportError: No module named postgresql_psycopg2.base Can any one throw any light on this?

    Read the article

  • mysql_connect randomly hangs up

    - by sergdev
    I install php 5 (more precisely 5.3.1) as apache module. After this one of my application becomes randomly hang up on mysql_connect - sometimes works, sometimes no, sometimes reload of page helps. How can this be fixed? I use Windows Vista, Apache/2.2.14 (Win32) PHP/5.3.1 with php module, MySql 5.0.67-community-nt.

    Read the article

  • How to read the file

    - by muruga
    I want to get the file from one host to another host. We can get the file using the NET::FTP module. In that module we can use the get method to get the file.But I want the file content instead of the file. I know that using the read method we can read the file content. But how to call the read function and how to get the file content. Please help me.

    Read the article

  • Choosing between assembler and COBOL

    - by Azares Cob
    I have to rewrite and greatly modify parts of a legacy COBOL application. The COBOL source-code is available (around 100.000 lines of copy & pasted code mixed with GOTOs). Some more details on the system: It is a general management system controlling transactions, bank management, customer data and employees of the company I work for. The COBOL-powered database is about 4 Terabytes distributed over 50 old HDDs. (But messing around with them is the sysadmins job) They are using COBOL85 only. Now I have two options: Rewrite and refactor 50% of the old COBOL system, or use X86 assembly. Should I use X86 assembler or COBOL?

    Read the article

  • Drupal 7: Create a taxonomy term for each node and use the node title as the term name

    - by Spre3
    Is there anyway of doing this by using rules or by some custom code? I did try using rules but I can't find a way of adding a new term and set the name as the node title because the [node:title] token is not avilable. I know this is possible using the NAT module but the way this module changes the taxonomy terms hierarchy if you add a term reference field that uses the same taxonomy vocabulary which ruins the whole purpose of what I am trying to do.

    Read the article

  • Behaviour difference Dim oDialog1 as Dialog1 = New Dialog1 VS Dim oDialog1 as Dialog1 = Dialog1

    - by user472722
    VB.Net 2005 I have a now closed Dialog1. To get information from the Dialog1 from within a module I need to use Dim oDialog1 as Dialog1 = New Dialog1. VB.Net 2008 I have a still open Dialog1. To get information from the Dialog1 from within a module I need to use Dim oDialog1 as Dialog1 = Dialog1. VB.Net 2005 does not compile using Dim oDialog1 as Dialog1 = Dialog1 and insists on NEW What is going on and why do I need the different initialisation syntax?

    Read the article

  • What is the "proper" method for determining if a swf is running within an AIR application?

    - by Michael Prescott
    I've got a Flex Web project and a Flex AIR project that use a common code-base. The common code defines several run-time loaded Flex Modules. I want the Flex Modules to behave differently depending on whether the running base application is WEB or AIR. What is the proper method for determining from the module code whether the module is running in a WEB or AIR application? (I found that Security.sandboxType.toString() returns "application", but I haven't found anything better in the documentation, yet.)

    Read the article

< Previous Page | 153 154 155 156 157 158 159 160 161 162 163 164  | Next Page >