I need to remove all the html tags from a given webpage data. I tried this using regular expressions:
import urllib2
import re
page = urllib2.urlopen("http://www.frugalrules.com")
from bs4 import BeautifulSoup, NavigableString, Comment
soup = BeautifulSoup(page)
link = soup.find('link', type='application/rss+xml')
print link['href']
rss = urllib2.urlopen(link['href']).read()
souprss = BeautifulSoup(rss)
description_tag = souprss.find_all('description')
content_tag = souprss.find_all('content:encoded')
print re.sub('<[^>]*>', '', content_tag)
But the syntax of the re.sub is:
re.sub(pattern, repl, string, count=0)
So, I modified the code as (instead of the print statement above):
for row in content_tag:
print re.sub(ur"<[^>]*>",'',row,re.UNICODE
But it gives the following error:
Traceback (most recent call last):
File "C:\beautifulsoup4-4.3.2\collocation.py", line 20, in <module>
print re.sub(ur"<[^>]*>",'',row,re.UNICODE)
File "C:\Python27\lib\re.py", line 151, in sub
return _compile(pattern, flags).sub(repl, string, count)
TypeError: expected string or buffer
What am I doing wrong?
The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it:
What is the fastest (least execution
time) way to split a text file in to
ALL (overlapping) substrings of size N (bound N, eg 36)
while throwing out newline characters.
I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like.
As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module.
Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do.
My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8
import cStringIO
example_file = cStringIO.StringIO("""\
header
CAGTcag
TFgcACF
""")
for read in parse(example_file):
... print read
...
CAGTCAGTF
AGTCAGTFG
GTCAGTFGC
TCAGTFGCA
CAGTFGCAC
AGTFGCACF
The function that I found had the absolute best performance from the methods I could think of is this:
def parse(file):
size = 8 # of course in my code this is a function argument
file.readline() # skip past the header
buffer = ''
for line in file:
buffer += line.rstrip().upper()
while len(buffer) = size:
yield buffer[:size]
buffer = buffer[1:]
This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community.
Thanks!
Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size.
Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!
I'm looking for a way to compress an ascii-based string, any help?
I need also need to decompress it. I tried zlib but with no help.
What can I do to compress the string into lesser length?
code:
def compress(request):
if request.POST:
data = request.POST.get('input')
if is_ascii(data):
result = zlib.compress(data)
return render_to_response('index.html', {'result': result, 'input':data}, context_instance = RequestContext(request))
else:
result = "Error, the string is not ascii-based"
return render_to_response('index.html', {'result':result}, context_instance = RequestContext(request))
else:
return render_to_response('index.html', {}, context_instance = RequestContext(request))
matrix
is a list of lists. I've to return a dictionary of the form
{i:(l1[i],l2[i],...,lm[i])}
Where the key i is matched with a tuple the i'th elements
from each list.
Say
matrix=[[1,2,3,4],[9,8,7,6],[4,8,2,6]]
so the line:
>>> dict([(i,tuple(matrix[k][i] for k in xrange(len(matrix)))) for i in xrange(len(matrix[0]))])
does the job pretty well and outputs:
{0: (1, 9, 4), 1: (2, 8, 8), 2: (3, 7, 2), 3: (4, 6, 6)}
but fails if the matrix is empty: matrix=[]. The output should be: {}
How can i deal with this?
hi,
i am using cairoplot, to make graphs, however the file from where i am reading the data is growing huge and its taking a long time to process the graph
is there any real-time way to produce cairo graph, or at least store the previous readings..like rrd.
-krisdigitx
First off, I'm relatively new to Google App Engine, so I'm probably doing something silly.
Say I've got a model Foo:
class Foo(db.Model):
name = db.StringProperty()
I want to use name as a unique key for every Foo object. How is this done?
When I want to get a specific Foo object, I currently query the datastore for all Foo objects with the target unique name, but queries are slow (plus it's a pain to ensure that name is unique when each new Foo is created).
There's got to be a better way to do this!
Thanks.
I am looking into the unittest package, and I'm not sure of the proper way to structure my test cases when writing a lot of them for the same method. Say I have a fact function which calculates the factorial of a number; would this testing file be OK?
import unittest
class functions_tester(unittest.TestCase):
def test_fact_1(self):
self.assertEqual(1, fact(1))
def test_fact_2(self):
self.assertEqual(2, fact(2))
def test_fact_3(self):
self.assertEqual(6, fact(3))
def test_fact_4(self):
self.assertEqual(24, fact(4))
def test_fact_5(self):
self.assertFalse(1==fact(5))
def test_fact_6(self):
self.assertRaises(RuntimeError, fact, -1)
#fact(-1)
if __name__ == "__main__":
unittest.main()
It seems sloppy to have so many test methods for one method. I'd like to just have one testing method and put a ton of basic test cases (ie 4! ==24, 3!==6, 5!==120, and so on), but unittest doesn't let you do that.
What is the best way to structure a testing file in this scenario?
Thanks in advance for the help.
Hi,
I have some strings that I want to delete some unwanted characters from them.
For example: Adam'sApple ---- AdamsApple.(case insensitive)
Can someone help me, I need the fastest way to do it, cause I have a couple of millions of records that have to be polished.
Thanks
I know that I can dynamically add an instance method to an object by doing something like:
import types
def my_method(self):
# logic of method
# ...
# instance is some instance of some class
instance.my_method = types.MethodType(my_method, instance)
Later on I can call instance.my_method() and self will be bound correctly and everything works.
Now, my question: how to do the exact same thing to obtain the behavior that decorating the new method with @property would give?
I would guess something like:
instance.my_method = types.MethodType(my_method, instance)
instance.my_method = property(instance.my_method)
But, doing that instance.my_method returns a property object.
I have code that uses the BeautifulSoup library for parsing, but it is very slow. The code is written in such a way that threads cannot be used.
Can anyone help me with this?
I am using BeautifulSoup for parsing and than save into a DB. If I comment out the save statement, it still takes a long time, so there is no problem with the database.
def parse(self,text):
soup = BeautifulSoup(text)
arr = soup.findAll('tbody')
for i in range(0,len(arr)-1):
data=Data()
soup2 = BeautifulSoup(str(arr[i]))
arr2 = soup2.findAll('td')
c=0
for j in arr2:
if str(j).find("<a href=") > 0:
data.sourceURL = self.getAttributeValue(str(j),'<a href="')
else:
if c == 2:
data.Hits=j.renderContents()
#and few others...
c = c+1
data.save()
Any suggestions?
Note: I already ask this question here but that was closed due to incomplete information.
Hello everybody,
I have two nested lists of different sizes:
A = [[1, 7, 3, 5], [5, 5, 14, 10]]
B = [[1, 17, 3, 5], [1487, 34, 14, 74], [1487, 34, 3, 87], [141, 25, 14, 10]]
I'd like to gather all nested lists from list B if A[2:4] == B[2:4] and put it into list L:
L = [[1, 17, 3, 5], [141, 25, 14, 10]]
Would you help me with this?
Trying to integrate openmeetings with django website, but can't understand how properly configure ImportDoctor:
(here :// replaced with __ 'cause spam protection)
print url
http://sovershenstvo.com.ua:5080/openmeetings/services/UserService?wsdl
imp = Import('http__schemas.xmlsoap.org/soap/encoding/')
imp.filter.add('http__services.axis.openmeetings.org')
imp.filter.add('http__basic.beans.hibernate.app.openmeetings.org/xsd')
imp.filter.add('http__basic.beans.data.app.openmeetings.org/xsd')
imp.filter.add('http__services.axis.openmeetings.org')
d = ImportDoctor(imp)
client = Client(url, doctor = d)
client.service.getSession()
Traceback (most recent call last):
File "", line 1, in
File "/usr/lib/python2.6/site-packages/suds/client.py", line 539, in call
return client.invoke(args, kwargs)
File "/usr/lib/python2.6/site-packages/suds/client.py", line 598, in invoke
result = self.send(msg)
File "/usr/lib/python2.6/site-packages/suds/client.py", line 627, in send
result = self.succeeded(binding, reply.message)
File "/usr/lib/python2.6/site-packages/suds/client.py", line 659, in succeeded
r, p = binding.get_reply(self.method, reply)
File "/usr/lib/python2.6/site-packages/suds/bindings/binding.py", line 159, in get_reply
resolved = rtypes[0].resolve(nobuiltin=True)
File "/usr/lib/python2.6/site-packages/suds/xsd/sxbasic.py", line 63, in resolve
raise TypeNotFound(qref)
suds.TypeNotFound: Type not found: '(Sessiondata, http__basic.beans.hibernate.app.openmeetings.org/xsd, )'
what i'm doing wrong? please help and sorry for my english, but you are my last chance to save position :(
need webinars at morning (2.26 am now)
from google.appengine.ext import db
class Log(db.Model):
content = db.StringProperty(multiline=True)
class MyThread(threading.Thread):
def run(self,request):
#logs_query = Log.all().order('-date')
#logs = logs_query.fetch(3)
log=Log()
log.content=request.POST.get('content',None)
log.put()
def Log(request):
thr = MyThread()
thr.start(request)
return HttpResponse('')
error is :
Exception in thread Thread-1:
Traceback (most recent call last):
File "D:\Python25\lib\threading.py", line 486, in __bootstrap_inner
self.run()
File "D:\zjm_code\helloworld\views.py", line 33, in run
log.content=request.POST.get('content',None)
NameError: global name 'request' is not defined
unique.txt file contains: 2 columns with columns separated by tab. total.txt file contains: 3 columns each column separated by tab.
I take each row from unique.txt file and find that in total.txt file. If present then extract entire row from total.txt and save it in new output file.
###Total.txt
column a column b column c
interaction1 mitochondria_205000_225000 mitochondria_195000_215000
interaction2 mitochondria_345000_365000 mitochondria_335000_355000
interaction3 mitochondria_345000_365000 mitochondria_5000_25000
interaction4 chloroplast_115000_128207 chloroplast_35000_55000
interaction5 chloroplast_115000_128207 chloroplast_15000_35000
interaction15 2_10515000_10535000 2_10505000_10525000
###Unique.txt
column a column b
mitochondria_205000_225000 mitochondria_195000_215000
mitochondria_345000_365000 mitochondria_335000_355000
mitochondria_345000_365000 mitochondria_5000_25000
chloroplast_115000_128207 chloroplast_35000_55000
chloroplast_115000_128207 chloroplast_15000_35000
mitochondria_185000_205000 mitochondria_25000_45000
2_16595000_16615000 2_16585000_16605000
4_2785000_2805000 4_2775000_2795000
4_11395000_11415000 4_11385000_11405000
4_2875000_2895000 4_2865000_2885000
4_13745000_13765000 4_13735000_13755000
My program:
file=open('total.txt')
file2 = open('unique.txt')
all_content=file.readlines()
all_content2=file2.readlines()
store_id_lines = []
ff = open('match.dat', 'w')
for i in range(len(all_content)):
line=all_content[i].split('\t')
seq=line[1]+'\t'+line[2]
for j in range(len(all_content2)):
if all_content2[j]==seq:
ff.write(seq)
break
Problem:
but istide of giving desire output (values of those 1st column that fulfile the if condition). i nead somthing like if jth of unique.txt == ith of total.txt then write ith row of total.txt into new file.
I have used the 2to3 utility to convert code from the command line. What I would like to do is run it basically as a unittest. Even if it tests the file rather than parts(funtions, methods...) as would be normal for a unittest.
It does not need to be a unittest and I don't what to automatically convert the files I just want to monitor the py3 compliance of files in a unittest like manor. I can't seem to find any documentation or examples for this.
An example and/or documentation would be great.
Thanks
Implement this loop: total up the product of the numbers from 1 to x.
Implement this loop: total up the product of the numbers from a to b.
Implement this loop: total up the sum of the numbers from a to b.
Implement this loop: total up the sum of the numbers from 1 to x.
Implement this loop: count the number of characters in a string s.
i'm very lost on implementing loops these are just some examples that i am having trouble with-- if someone could help me understand how to do them that would be awesome
I'm trying to use reserved words in my grammar:
reserved = {
'if' : 'IF',
'then' : 'THEN',
'else' : 'ELSE',
'while' : 'WHILE',
}
tokens = [
'DEPT_CODE',
'COURSE_NUMBER',
'OR_CONJ',
'ID',
] + list(reserved.values())
t_DEPT_CODE = r'[A-Z]{2,}'
t_COURSE_NUMBER = r'[0-9]{4}'
t_OR_CONJ = r'or'
t_ignore = ' \t'
def t_ID(t):
r'[a-zA-Z_][a-zA-Z_0-9]*'
if t.value in reserved.values():
t.type = reserved[t.value]
return t
return None
However, the t_ID rule somehow swallows up DEPT_CODE and OR_CONJ. How can I get around this? I'd like those two to take higher precedence than the reserved words.
Here's the deal. I'm trying to write an arkanoid clone game and the thing is that I need a window menu like you get in pyGTK. For example File-(Open/Save/Exit) .. something like that and opening an "about" context where the author should be written.
I'm already using pyGame for writting the game logic. I've tried pgu to write the GUI but that doesn't help me, altough it has those menu elements I'm taking about, you can't include the screen of the game in it's container.
Does anybody know how to include such window menus with the usage of pyGame ?
I'm trying to write a script to import a database file. I wrote the script to export the file like so:
import sqlite3
con = sqlite3.connect('../sqlite.db')
with open('../dump.sql', 'w') as f:
for line in con.iterdump():
f.write('%s\n' % line)
Now I want to be able to import that database. I tried:
import sqlite3
con = sqlite3.connect('../sqlite.db')
f = open('../dump.sql','r')
str = f.read()
con.execute(str)
but I'm not allowed to execute more than one statement. Is there a way to get it to run a .sql script directly?
So I have a list that I want to convert to a list that contains a list for each group of objects.
ie
['objA.attr1', 'objC', 'objA.attr55', 'objB.attr4']
would return
[['objA.attr1', 'objA.attr55'], ['objC'], ['objB.attr4']]
currently this is what I use:
givenList = ['a.attr1', 'b', 'a.attr55', 'c.attr4']
trgList = []
objNames = []
for val in givenList:
obj = val.split('.')[0]
if obj in objNames:
id = objNames.index(obj)
trgList[id].append(val)
else:
objNames.append(obj)
trgList.append([val])
#print trgList
It seems to run a decent speed when the original list has around 100,000 ids... but I am curious if there is a better way to do this. Order of the objects or attributes does not matter. Any ideas?
I'm having a new problem here ..
CODE 1:
try:
urlParams += "%s=%s&"%(val['name'], data.get(val['name'], serverInfo_D.get(val['name'])))
except KeyError:
print "expected parameter not provided - "+val["name"]+" is missing"
exit(0)
CODE 2:
try:
urlParams += "%s=%s&"%(val['name'], data.get(val['name'], serverInfo_D[val['name']]))
except KeyError:
print "expected parameter not provided - "+val["name"]+" is missing"
exit(0)
see the diffrence in serverInfo_D[val['name']] & serverInfo_D.get(val['name'])
code 2 fails but code 1 works
the data
serverInfo_D:{'user': 'usr', 'pass': 'pass'}
data: {'par1': 9995, 'extraparam1': 22}
val: {'par1','user','pass','extraparam1'}
exception are raised for for data dict .. and all code in for loop which iterates over val