Search Results

Search found 70655 results on 2827 pages for 'python time'.

Page 161/2827 | < Previous Page | 157 158 159 160 161 162 163 164 165 166 167 168  | Next Page >

  • Working with bytes and binary data in Python

    - by ignoramus
    Four consecutive bytes in a byte string together specify some value. However, only 7 bits in each byte are used; the most significant bit is ignored (that makes 28 bits altogether). So... b"\x00\x00\x02\x01" would be 000 0000 000 0000 000 0010 000 0001. Or, for the sake of legibility, 10 000 0001. That's the value the four bytes represent. But I want a decimal, so I do this: >>> 0b100000001 257 I can work all that out myself, but how would I incorporate it into a program?

    Read the article

  • Python metaclass for enforcing immutability of custom types

    - by Mark Lehmacher
    Having searched for a way to enforce immutability of custom types and not having found a satisfactory answer I came up with my own shot at a solution in form of a metaclass: class ImmutableTypeException( Exception ): pass class Immutable( type ): ''' Enforce some aspects of the immutability contract for new-style classes: - attributes must not be created, modified or deleted after object construction - immutable types must implement __eq__ and __hash__ ''' def __new__( meta, classname, bases, classDict ): instance = type.__new__( meta, classname, bases, classDict ) # Make sure __eq__ and __hash__ have been implemented by the immutable type. # In the case of __hash__ also make sure the object default implementation has been overridden. # TODO: the check for eq and hash functions could probably be done more directly and thus more efficiently # (hasattr does not seem to traverse the type hierarchy) if not '__eq__' in dir( instance ): raise ImmutableTypeException( 'Immutable types must implement __eq__.' ) if not '__hash__' in dir( instance ): raise ImmutableTypeException( 'Immutable types must implement __hash__.' ) if _methodFromObjectType( instance.__hash__ ): raise ImmutableTypeException( 'Immutable types must override object.__hash__.' ) instance.__setattr__ = _setattr instance.__delattr__ = _delattr return instance def __call__( self, *args, **kwargs ): obj = type.__call__( self, *args, **kwargs ) obj.__immutable__ = True return obj def _setattr( self, attr, value ): if '__immutable__' in self.__dict__ and self.__immutable__: raise AttributeError( "'%s' must not be modified because '%s' is immutable" % ( attr, self ) ) object.__setattr__( self, attr, value ) def _delattr( self, attr ): raise AttributeError( "'%s' must not be deleted because '%s' is immutable" % ( attr, self ) ) def _methodFromObjectType( method ): ''' Return True if the given method has been defined by object, False otherwise. ''' try: # TODO: Are we exploiting an implementation detail here? Find better solution! return isinstance( method.__objclass__, object ) except: return False However, while the general approach seems to be working rather well there are still some iffy implementation details (also see TODO comments in code): How do I check if a particular method has been implemented anywhere in the type hierarchy? How do I check which type is the origin of a method declaration (i.e. as part of which type a method has been defined)?

    Read the article

  • read a binary file (python)

    - by beratch
    Hi, I cant read a file, and I dont understand why: f = open("test/test.pdf", "r") data = list(f.read()) print data Returns : [] I would like to open a PDF, and extract every bytes, and put it in a List. What's wrong with my code ? :( Thanks,

    Read the article

  • IoC and Design Time

    - by benPearce
    I have a WPF application which I am using to learn MVVM and IoC. The problem is that the Model used by one of the Views expects to pull one of its dependancies in the constructor from an IoC container. When working on this View in the Visual Studio designer it cannot show the design because an exception is being raised in the model. Is there a way around this? Am I pulling my dependancies in the wrong place in code or is there a way I can pass in constructed dependancies, perhaps through Constructor injection. At present the IoC container is setup in code in App.xaml.cs. The IoC container is a roll-your-own taken from this article on MSDN - http://msdn.microsoft.com/en-us/magazine/cc337885.aspx

    Read the article

  • Python dealing with dates and times

    - by randombits
    I'm looking for a solution to the following: Given today's date, figure out what month was before. So 2 should return for today, since it is currently March, the third month of the year. 12 should return for January. Then based on that, I need to be able to iterate through a directory and find all files that were created that month. Bonus points would include finding the most current file created for the previous month.

    Read the article

  • removing pairs of elements from numpy arrays that are NaN (or another value) in Python

    - by user248237
    I have an array with two columns in numpy. For example: a = array([[1, 5, nan, 6], [10, 6, 6, nan]]) a = transpose(a) I want to efficiently iterate through the two columns, a[:, 0] and a[:, 1] and remove any pairs that meet a certain condition, in this case if they are NaN. The obvious way I can think of is: new_a = [] for val1, val2 in a: if val2 == nan or val2 == nan: new_a.append([val1, val2]) But that seems clunky. What's the pythonic numpy way of doing this? thanks.

    Read the article

  • use doctest and logging in python program

    - by Luke
    #!/usr/bin/python2.4 import logging import sys import doctest def foo(x): """ foo (0) 0 """ print ("%d" %(x)) _logger.debug("%d" %(x)) def _test(): doctest.testmod() _logger = logging.getLogger() _logger.setLevel(logging.DEBUG) _formatter = logging.Formatter('%(message)s') _handler = logging.StreamHandler(sys.stdout) _handler.setFormatter(_formatter) _logger.addHandler(_handler) _test() I would like to use logger module for all of my print statements. I have looked at the first 50 top google links for this, and they seem to agree that doctest uses it's own copy of the stdout. If print is used it works if logger is used it logs to the root console. Can someone please demonstrate a working example with a code snippet that will allow me to combine. Note running nose to test doctest will just append the log output at the end of the test, (assuming you set the switches) it does not treat them as a print statement.

    Read the article

  • Errno socket error in python

    - by Emma
    i wrote this code : import random import sys import urllib openfile = open(sys.argv[1]).readlines() c = random.choice(openfile) i = 0 while i < 5: i=i+1 c = random.choice(openfile) proxies = {'http': c} opener = urllib.FancyURLopener(proxies).open("http://whatismyip.com.au/").read() ::: I put 3 proxy in a txt file . : http://211.161.159.74:8080 http://119.70.40.101:8080 http://124.42.10.119:8080 but when execute it i get this error : IOError: [Errno socket error] (10054, 'Connection reset by peer') what am i going to do ? please help me .

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Convert alphabet letters to number in python

    - by altin
    Can someone help me finish this characters = ['a''b''c''d''e''f''g''h''i''j''k''l''m''n''o''p''q''r''t''u''v''w''x''y''z'] numbers = ['1''2''3''4''5''6''7''8''9''10''11''12''13''14''15''16''17''18''19''20''21''22''23''24'] text = raw_input(' Write text: ') Ive tryed to many ways but couldnt get to the pint, I want to make exc if i type hello the output to be in numbers lined like in alphabet... example a = 1 < in alphabet Can anyone give ideas ? or help sth ?

    Read the article

  • serializing JSON files with newlines in Python

    - by user248237
    I am using json and jsonpickle sometimes to serialize objects to files, using the following function: def json_serialize(obj, filename, use_jsonpickle=True): f = open(filename, 'w') if use_jsonpickle: import jsonpickle json_obj = jsonpickle.encode(obj) f.write(json_obj) else: simplejson.dump(obj, f) f.close() The problem is that if I serialize a dictionary for example, using "json_serialize(mydict, myfilename)" then the entire serialization gets put on one line. This means that I can't grep the file for entries to be inspected by hand, like I would a CSV file. Is there a way to make it so each element of an object (e.g. each entry in a dict, or each element in a list) is placed on a separate line in the JSON output file? thanks.

    Read the article

  • Opening SSL URLs with Python

    - by RadiantHex
    Hi folks, I'm using mechanize to navigate pages, it works pretty well. Unfortunately I have a random error come up, by random I mean it occasionally appears. URLError at /test/ urlopen error [Errno 1] _ssl.c:1325: error:140943FC:SSL routines:SSL3_READ_BYTES:sslv3 alert bad record mac I really need help on this one :) any ideas?

    Read the article

  • Documenting module/class/function bodies in python sphinx docs

    - by perrierism
    Is there a way with Sphinx documentation to output a function or class body (the code itself) with the autodoc feature? I'm using autodoc to much success. In addition to the docstrings getting pulled in to the documentation I want like a link to click for each function where it will show you the source... is that possible? This is about what most of my documentation looks like now: .. module:`foo.mymodule` Title =================== .. automodule:: foo.mymodule .. autoclass:: MyModulesClass :members: :undoc-members:

    Read the article

  • Python, a smarter way of string to integer conversion

    - by Hellnar
    Hello I have written this code to convert string in such format "0(532) 222 22 22" to integer such as 05322222222 . class Phone(): def __init__(self,input): self.phone = input def __str__(self): return self.phone #convert to integer. def to_int(self): return int((self.phone).replace(" ","").replace("(","").replace(")","")) test = Phone("0(532) 222 22 22") print test.to_int() It feels very clumsy to use 3 replace methods to solve this. I am curious if there is a better solution?

    Read the article

  • Python fit polynomial, power law and exponential from data

    - by Nadir
    I have some data (x and y coordinates) coming from a study and I have to plot them and to find the best curve that fits data. My curves are: polynomial up to 6th degree; power law; and exponential. I am able to find the best fit for polynomial with while(i < 6): coefs, val = poly.polyfit(x, y, i, full=True) and I take the degree that minimizes val. When I have to fit a power law (the most probable in my study), I do not know how to do it correctly. This is what I have done. I have applied the log function to all x and y and I have tried to fit it with a linear polynomial. If the error (val) is lower than the others polynomial tried before, I have chosen the power law function. Am I correct? Now how can I reconstruct my power law starting from the line y = mx + q in order to draw it with the original points? I need also to display the function found. I have tried with: def power_law(x, m, q): return q * (x**m) using x_new = np.linspace(x[0], x[-1], num=len(x)*10) y1 = power_law(x_new, coefs[0], coefs[1]) popt, pcov = curve_fit(power_law, x_new, y1) but it seems not to work well.

    Read the article

  • Listing all possible values for SOAP enumeration with Python SUDS

    - by bdk
    I'm connecting with a SUDS client to a SOAP Server whose wsdl contains manu enumerations like the following: </simpleType> <simpleType name="FOOENUMERATION"> <restriction base="xsd:string"> <enumeration value="ALPHA"><!-- enum const = 0 --> <enumeration value="BETA"/><!-- enum const = 1 --> <enumeration value="GAMMA"/><!-- enum const = 2 --> <enumeration value="DELTA"/><!-- enum const = 3 --> </restriction> </simpleType> In my client I am receiving sequences which contain elements of these various enumeration types. My need is that given a member variable, I need to know all possible enumeration values. Basically I need a function which takes an instance of one of these enums and returns a list of strings which are all the possible values. When I have an instance, running: print type(foo.enumInstance) I get: <class 'suds.sax.text.Text'> I'm not sure how to get the actual simpleType name from this, and then get the possible values from that short of parsing the WSDL myself.

    Read the article

  • python raw_input odd behavior with accents containing strings

    - by Ryan
    I'm writing a program that asks the user for input that contains accents. The user input string is tested to see if it matches a string declared in the program. As you can see below, my code is not working: code # -*- coding: utf-8 -*- testList = ['má'] myInput = raw_input('enter something here: ') print myInput, repr(myInput) print testList[0], repr(testList[0]) print myInput in testList output in eclipse with pydev enter something here: má mv° 'm\xe2\x88\x9a\xc2\xb0' má 'm\xc3\xa1' False output in IDLE enter something here: má má u'm\xe1' má 'm\xc3\xa1' Warning (from warnings module): File "/Users/ryanculkin/Desktop/delete.py", line 8 print myInput in testList UnicodeWarning: Unicode equal comparison failed to convert both arguments to Unicode - interpreting them as being unequal False How can I get my code to print True when comparing the two strings? Additionally, I note that the result of running this code on the same input is different depending on whether I use eclipse or IDLE. Why is this? My eventual goal is to put my program on the web; is there anything that I need to be aware of, since the result seems to be so volatile?

    Read the article

  • Python learner needs help spotting an error

    - by Protean
    This piece of code gives a syntax error at the colon of "elif process.loop(i, len(list_i) != 'repeat':" and I can't seem to figure out why. class process: def loop(v1, v2): if v1 < v2 - 1: return 'repeat' def isel(chr_i, list_i): for i in range(len(list_i)): if chr_i == list_i[i]: return list_i[i] elif process.loop(i, len(list_i) != 'repeat': return 'error'()

    Read the article

  • Python web scraping involving HTML tags with attributes

    - by rohanbk
    I'm trying to make a web scraper that will parse a web-page of publications and extract the authors. The skeletal structure of the web-page is the following: <html> <body> <div id="container"> <div id="contents"> <table> <tbody> <tr> <td class="author">####I want whatever is located here ###</td> </tr> </tbody> </table> </div> </div> </body> </html> I've been trying to use BeautifulSoup and lxml thus far to accomplish this task, but I'm not sure how to handle the two div tags and td tag because they have attributes. In addition to this, I'm not sure whether I should rely more on BeautifulSoup or lxml or a combination of both. What should I do? At the moment, my code looks like what is below: import re import urllib2,sys import lxml from lxml import etree from lxml.html.soupparser import fromstring from lxml.etree import tostring from lxml.cssselect import CSSSelector from BeautifulSoup import BeautifulSoup, NavigableString address='http://www.example.com/' html = urllib2.urlopen(address).read() soup = BeautifulSoup(html) html=soup.prettify() html=html.replace('&nbsp', '&#160') html=html.replace('&iacute','&#237') root=fromstring(html) I realize that a lot of the import statements may be redundant, but I just copied whatever I currently had in more source file. EDIT: I suppose that I didn't make this quite clear, but I have multiple tags in page that I want to scrape.

    Read the article

  • Python TKinter connect variable to entry widget

    - by Sano98
    Hi everyone, I'm trying to associate a variable with a Tkinter entry widget, in a way that: Whenever I change the value (the "content") of the entry, mainly by typing something into it, the variable automatically gets assigned the value of what I've typed. Without me having to push a button "Update value " or something like that first. Whenever the variable gets changed (by some other part of the programm), I want the entry value displayed to be adjusted automatically. I believe that this could work via the textvariable. I read the example on http://effbot.org/tkinterbook/entry.htm, but it is not exactly helping me for what I have in mind. I have a feeling that there is a way of ensuring the first condition with using entry's "validate". Any ideas? Thank you for your input! Sano

    Read the article

< Previous Page | 157 158 159 160 161 162 163 164 165 166 167 168  | Next Page >