Search Results

Search found 11543 results on 462 pages for 'kernel module'.

Page 166/462 | < Previous Page | 162 163 164 165 166 167 168 169 170 171 172 173  | Next Page >

  • Automatically detecting temperature sensors on startup (Ubuntu 10.10)

    - by dpitch40
    I am very close to achieving my goal of setting up a CPU temperature graph that is displayed in the top panel of my desktop. I have the applet and have gotten it to graph temperatures, which appear to be being sensed correctly. However, my machine doesn't find its temperature sensors by default; I have to run sudo modprobe coretemp for the sensors command to work, then log off and back in before the graph applet starts displaying my temperatures. I am wondering if I can somehow tell the kernel to load the coretemp module on startup so I don't have to keep doing these extra steps. I have tried putting this command in my startup applications, but I think its need for root permission is keeping this from working. Is there a way to set up startup applications with root permission, or some other way to ensure that this module is loaded at startup? If anyone is curious, I'm running 64-bit Ubuntu 10.10 on a Lenovo G770 laptop with a Core i5 processor and the 2.6.35 kernel.

    Read the article

  • selecting the first of multiple classes

    - by gleddy
    Not sure if you can do this, but I want to select the first of two classes of an element with jQuery and return it's first class only. <div class="module blue"> I want to return 'module'. tried this: var state = $('body').attr('class').first(); but none of that seems to work, thanks for any advice.

    Read the article

  • pg.so problem with Ruby in Windows

    - by Alexander
    I have installed the pg module with help of gem install pg Which returned Successfully installed pg-0.8.0-x86-mswin32-60 When a .rb-file looks like this require 'rubygems' require 'pg' I get an LoadError (exception 126) which tells me that it can't find the module C:/Ruby/lib/ruby/gems/1.8/gems/pg-0.8.0-x86-mswin32-60/lib/pg.so. I heard something about that it is a Linux compilation. I'm really stuck so I really welcome suggestions. I have also installed PostgreSQL, I use Windows XP.

    Read the article

  • How to check use of userva boot option on Win 2K3 server

    - by Tim Sylvester
    I have some 32-bit Win2K3 servers running an application that fails now and then apparently due to heap fragmentation. (Process virtual bytes grows, private bytes does not) I do not have access to the source code or build process of this application. I have modified the boot.ini file on one of these servers to include /userva=2560, half way between the normal mode of operation and the /3GB option. Normally it takes weeks to reach the point of failure, but I'd like to see right away whether this has actually had any effect. As I understand it, this option limits the kernel to the remaining address space (1536MB instead of 2048), but does not necessarily give an application the extra address space, depending on the flags in the application's PE header. How can I determine whether the O/S is allowing a particular application, running in production, to access address space above 2GB? Additionally, what's the best way to monitor the system to ensure that the kernel is not starved for address space, and more generally how should I go about finding the optimal value for this setting?

    Read the article

  • maya2008 win32api 64 bit python

    - by knishua
    how is it possible to run import win32api successfully on a 64bit maya version 2008 following error occurs Error: No module named win32api Traceback (most recent call last): File "", line 1, in ImportError: No module named win32api # I need to get mouse cursor position in python so that i can place window exactly in that position. Is there any other way to get it Brgds, kNish

    Read the article

  • Replacing python docstrings

    - by tomaz
    I have written a epytext to reST markup converter, and now I want to convert all the docstrings in my entire library from epytext to reST format. Is there a smart way to read the all the docstrings in a module and write back the replacements? ps: ast module perhaps?

    Read the article

  • eTrayz: Replace base system with a bootstrapped Debian

    - by knoopx
    I bought an eTrayz NAS time ago. The device is more or less good but it ships with a closed-source custom linux and a bunch of broken web-apps. I wanted to replace the whole system with a raw Debian installation. I successfully bootstrapped a Lenny Debian into a chroot and I'm able to use use it. However I would like it to be the default system and to boot automatically at login. The device itself ships with a bundled 2.6.24.4 kernel. I think the kernel is on a dedicated flash memory so I would prefere not to re-flash it. What do you think is the best way to accomplish it?

    Read the article

  • Common utility functions for Perl .t tests

    - by zedoo
    Hi I am getting started with Test::More, already have a few .t test scripts. Now I'd like to define a function that will only be used for the tests, but accross different .t files. Where's the best place to put such a function? Define another .t without any tests and require it where needed? (As a sidenote I use the module structure created by Module::Starter)

    Read the article

  • Hyper-V Ubuntu Networking Problems Copying Large Amounts of Data

    - by Anonymous
    I am trying to copy a large amount (about 50 GB) of data over my network from a Hyper-V-hosted virtual machine running Ubuntu 11.04 (Natty Narwhal) to another (non-virtual) Ubuntu host that I plan to use for testing upgrades to one of our web applications. The problem I am having is with the virtual machine, which I shall refer to in what follows as "source.host". This machine is running 64-bit Ubuntu Server with the 2.6.38-8-server kernel and the Microsoft Linux Integration Components for Hyper-V kernel modules (hv_utils, hv_timesource, hv_netvsc, hv_blkvsc, hv_storvsc, and hv_vmbus) loaded. It uses a Hyper-V "synthetic network adapter" for its networking interface. To do the copy, I log on to the machine with the data and run the following commands (Call the remote machine "destination.host".): $ cd /path/to/data $ tar -cvf - datafolder/ | ssh [email protected] "cat > ~/data.tar" This runs for a while and then suddenly stops after transferring somewhere from 2-6 GB. The terminal on the source.host machine displays a Write failed: broken pipe error. The odd part is this: after this occurs, the "source.host" machine is no longer able to talk to the rest of the network. I cannot ping any other hosts on the network from the "source.host" machine, and I cannot ping the "source.host" machine from any other host on the network. I am equally unable to access the any of the web services hosted on "source.host". Running ifconfig on "source.host" shows the network adapter to be up and running as usual with the correct IP address and everything. I tried restarting the networking service with $ /etc/init.d/networking restart but the problem does not go away. Restarting the machine makes it capable of talking to the network again -- it can ping and be pinged by other hosts, and the web services are also accessible and usable as normal -- but attempting the copy operation again results in the same failure, requiring another restart. As an experiment, I tried replacing the tar -- ssh pipeline above with a straight scp: $ scp -r datafolder/ [email protected]:~ but to no avail Thinking that the issue might have to do with the kernel packet-send buffers filling up, I tried increasing the buffer size to 12 MB (up from the 128 KB default) with # echo 12582911 > /proc/sys/net/core/wmem_max but this also had no effect. I'm guessing at this point that it might be a problem with the Microsoft synthetic network driver, but I don't really know. Does anyone have any suggestions? Thank you very much in advance!

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Getting "uninitialized constant" in Rails app

    - by Robert McCabe
    I'm new to Rails and feeling my way, but this has me stumped. I moved some constants to a separate module ie: module Fns Fclick = "function() { alert(\"You clicked the map.\");}\n" ... end then in my controller added: require "fns" class GeomapController < ApplicationController def index fstring = Fns::Fclick ... end but when I run the server I get: uninitialized constant Fns::Fclick what am I missing?

    Read the article

  • how to reduce time of git pulling each time when you do a make world on Xen source

    - by Registered User
    I am compiling xen from source and each time I do a make world it basically gives some or the other error my problem are not those errors ( I am trying to debug them) but the problem is each time when I do a make world Xen basically pulls things from git repository + rm -rf linux-2.6-pvops.git linux-2.6-pvops.git.tmp + mkdir linux-2.6-pvops.git.tmp + rmdir linux-2.6-pvops.git.tmp + git clone -o xen -n git://git.kernel.org/pub/scm/linux/kernel/git/jeremy/xen.git linux-2.6-pvops.git.tmp Initialized empty Git repository in /usr/src/xen-4.0.1/linux-2.6-pvops.git.tmp/.git/ remote: Counting objects: 1941611, done. remote: Compressing objects: 100% (319127/319127), done. remote: Total 1941611 (delta 1614302), reused 1930655 (delta 1604595) **Receiving objects: 20% (1941611/1941611), 98.17 MiB | 87 KiB/s, done.** and if you notice the last line it is still consuming my bandwidth pulling things from internet.How can I stop this step each time and use existing git repository?

    Read the article

  • modprobe not found at all

    - by timmeyh
    I know that a lot of people had problems finding modprobe which was mostely due to an unconfigured $PATH. This time however I logged into a machine (Linux mymachine 2.6.32-6-pve #1 SMP Mon Jan 23 08:27:52 CET 2012 i686 GNU/Linux with root rights) and modprobe wasn't found at all. This are the steps I have taken so far: - which modprobe => no results - locate modprobe => no results - my $PATH = /usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/bin/X11: - find / -name "modprobe*" => /proc/sys/kernel/modprobe - cat /proc/sys/kernel/modprobe => /sbin/modprobe - /sbin/modprobe => no such file or directory Ass you can see no modprobe at all. Does anyone else has a suggestion/ sollution so I can use modprobe?

    Read the article

  • Tracing out going connections

    - by Tiffany Walker
    Jan 24 07:00:49 HOST kernel: [875997.380464] Firewall: *TCP_OUT Blocked* IN= OUT=eth0 SRC=108.60.11.15 DST=74.80.225.32 LEN=52 TOS=0x00 PREC=0x00 TTL=64 ID=18789 DF PROTO=TCP SPT=64823 DPT=81 WINDOW=14600 RES=0x00 SYN URGP=0 Jan 24 07:00:50 HOST kernel: [875998.378321] Firewall: *TCP_OUT Blocked* IN= OUT=eth0 SRC=108.60.11.15 DST=74.80.225.32 LEN=52 TOS=0x00 PREC=0x00 TTL=64 ID=18790 DF PROTO=TCP SPT=64823 DPT=81 WINDOW=14600 RES=0x00 SYN URGP=0 I run fcgid so everything runs as a user. But is there a way to trace and figure out who is running an out going script? The sites all share the same IP so it's hard to know which site it is or where the script is located at.

    Read the article

  • Is it possible to add IPTC data to a JPG using python when no such data already exists?

    - by ventolin
    With the IPTCInfo module under Python (http://snippets.dzone.com/posts/show/768 for more info) it's possible to read, modify and write IPTC info to pictures. However, if a JPG doesn't already have IPTC information, the module simply raises an exception. It doesn't seem to be able to create and add this metadata information itself. What alternatives are there? I've googled for the past hour but to no avail whatsoever.

    Read the article

  • Opencart SEO URL

    - by user2483877
    My question is, I have installed the SEO component successfully, and its working well but; On homepage, the Latest Products module shows the url like http://www.domain.com/product-21.html On category page, the product shows the url like http://www.domain.com/category/product-21.html I want to put the category URL in the latest products module so it will be the same as on category page. Does anybody have any ideas about this?

    Read the article

  • Deactivate GPU and use IGP

    - by squelos
    I am having some trouble with my Sony Vaio SVE1511W1e laptop. It has an ATI Radeon and the i5 has an IGP (i5 2450m). I don't often use my GPU, and the IGP would be just enough for most usage I do. Therefore, in order to improve the battery life, I wish to deactivate the GPU and use only the IGP. The problem is that my BIOS doesnt allow me to do so. But I believe it is possible to deactivate the GPU 'programatically'. I'm running Debian Wheezy on the 3.2.0.4 AMD64 kernel. The first problem I'm running into is that when I run lspci, my IGP doesnt show up. Could this be because im lacking a kernel module? (I chose a targeted installation). What are the solutions to deactivating a GPU and using an IGP on a Linux System such as debian?

    Read the article

  • How to restrict code from developers

    - by Kelvin
    My company is planning in hiring outsourcers to work for us, but concerned to give whole existing code to outside world. What is the proper way to deal with security of sharing code in such cases? Is it possible to restrict part of code for developers? So each of them could work on their project without having access to whole repository. P.S. The code we have is very integrated, and its hard to extract "one module", each module can use files from different locations. Thanks in advance

    Read the article

  • Drupal 7: Create a taxonomy term for each node and use the node title as the term name

    - by Spre3
    Is there anyway of doing this by using rules or by some custom code? I did try using rules but I can't find a way of adding a new term and set the name as the node title because the [node:title] token is not avilable. I know this is possible using the NAT module but the way this module changes the taxonomy terms hierarchy if you add a term reference field that uses the same taxonomy vocabulary which ruins the whole purpose of what I am trying to do.

    Read the article

  • C++ DLL Export: Decorated/Mangled names

    - by Bob
    Created basic C++ DLL and exported names using Module Definition file (MyDLL.def). After compilation I check the exported function names using dumpbin.exe I expect to see: SomeFunction but I see this instead: SomeFunction = SomeFunction@@@23mangledstuff#@@@@ Why? The exported function appears undecorated (especially compared to not using the Module Def file), but what's up with the other stuff? If I use dumpbin.exe against a DLL from any commercial application, you get the clean: SomeFunction and nothing else......

    Read the article

  • Disable IPv6 on Debian VPS

    - by chris_l
    I have a Debian Lenny VPS, that's running virtualized by Parallels/Virtuozzo. Currently, the network interface doesn't have an IPv6 address - and that's good, because I don't have an ip6tables configuration. But I assume, that I could wake up one day, and ifconfig will show me an ipv6 address for the interface - because I have no control over the kernel or its modules - they're under the control of the hosting company. That would leave the server completely vulnerable to attacks from IPv6 addresses. What would be the best way to disable IPv6 (for the interface or maybe for the entire host)? Usually I would simply disable the kernel module, but that's not possible in this case.

    Read the article

  • Failing RAM, or something else?

    - by Thanatos
    I have a IBM Thinkpad T43, currently running Windows XP. Programs were crashing, XP was blue-screen-of-deathing, (more than usual) - it was basically unusable, but I couldn't get any informative error out of XP. I booted Ubuntu off a thumbdrive, which made it to the desktop, but as soon as I started to try to do anything, X segfaulted, along with several other services, followed quickly by kernel warnings and a kernel panic. I'm currently running Memtest86+ on this machine, which is spitting out numerous errors. (16k over 3 passes, and counting) The failing areas are numerous, and look something like this: 0001055da4 - XX.X MB, etc. The addresses that fail seem to cluster around 0-20 MB, 250MB, and, more rarely, 750MB, 1000MB, and 1200MB. However, a lot (but not all) of the failing addresses that I've seen end in XXXXXXX?da4 where the ? is a 1 or a 5. The machine has two sticks of RAM, one 512MB, one 1024 MB, the 512MB mapped to the lower addresses, the 1024 MB stick following. Is this indeed RAM failure, or should I consider other things before purchasing more RAM?

    Read the article

< Previous Page | 162 163 164 165 166 167 168 169 170 171 172 173  | Next Page >