Search Results

Search found 12924 results on 517 pages for 'module pattern'.

Page 166/517 | < Previous Page | 162 163 164 165 166 167 168 169 170 171 172 173  | Next Page >

  • Best practices for setting lm-factor in Squid refresh patterns

    - by Mpentecost
    I am running a Squid (3.1) cache in front of Django. The content of the site does not change very often, so Squid gives our backend much needed breathing room. Currently, this is the refresh pattern that we are using to cache the content: refresh_pattern . 60 100% 60 We basically want to cache everything for at least an hour (and only an hour) before Squid then re-validates the content. My question is on the "100%" parameter, which sets the lm-factor. I'm not sure if setting that to 100% is doing what we want it to. The assumption was that by setting it to 100%, it would ensure that objects stay in the cache for the max cache time. Is this an incorrect assumption? What are the best practices that one should follow when setting up a refresh pattern like this?

    Read the article

  • selecting the first of multiple classes

    - by gleddy
    Not sure if you can do this, but I want to select the first of two classes of an element with jQuery and return it's first class only. <div class="module blue"> I want to return 'module'. tried this: var state = $('body').attr('class').first(); but none of that seems to work, thanks for any advice.

    Read the article

  • AngularJS service returning promise unit test gives error No more request expected

    - by softweave
    I want to test a service (Bar) that invokes another service (Foo) and returns a promise. The test is currently failing with this error: Error: Unexpected request: GET foo.json No more request expected Here are the service definitions: // Foo service returns new objects having get function returning a promise angular.module('foo', []). factory('Foo', ['$http', function ($http) { function FooFactory(config) { var Foo = function (config) { angular.extend(this, config); }; Foo.prototype = { get: function (url, params, successFn, errorFn) { successFn = successFn || function (response) {}; errorFn = errorFn || function (response) {}; return $http.get(url, {}).then(successFn, errorFn); } }; return new Foo(config); }; return FooFactory; }]); // Bar service uses Foo service angular.module('bar', ['foo']). factory('Bar', ['Foo', function (Foo) { var foo = Foo(); return { getCurrentTime: function () { return foo.get('foo.json', {}, function (response) { return Date.parse(response.data.now); }); } }; }]); Here is my current test: 'use strict'; describe('bar tests', function () { var currentTime, currentTimeInMs, $q, $rootScope, mockFoo, mockFooFactory, Foo, Bar, now; currentTime = "March 26, 2014 13:10 UTC"; currentTimeInMs = Date.parse(currentTime); beforeEach(function () { // stub out enough of Foo to satisfy Bar service: // create mock object with function get: function(url, params, successFn, errorFn) // that promises to return a response with this property // { data: { now: "March 26, 2014 13:10 UTC" }}) mockFoo = { get: function (url, params, successFn, errorFn) { successFn = successFn || function (response) {}; errorFn = errorFn || function (response) {}; // setup deferred promise var deferred = $q.defer(); deferred.resolve({data: { now: currentTime }}); return (deferred.promise).then(successFn, errorFn); } }; // create mock Foo service mockFooFactory = function(config) { return mockFoo; }; module(function ($provide) { $provide.value('Foo', mockFooFactory); }); module('bar'); inject(function (_$q_, _$rootScope_, _Foo_, _Bar_) { $q = _$q_; $rootScope = _$rootScope_; Foo = _Foo_; Bar = _Bar_; }); }); it('getCurrentTime should return currentTimeInMs', function () { Bar.getCurrentTime().then(function (serverCurrentTime) { now = serverCurrentTime; }); $rootScope.$apply(); // resolve Bar promise expect(now).toEqual(currentTimeInMs); }); }); The error is being thrown at $rootScope.$apply(). I also tried using $rootScope.$digest(), but it gives the same error. Thanks in advance for any insight you can give me.

    Read the article

  • maya2008 win32api 64 bit python

    - by knishua
    how is it possible to run import win32api successfully on a 64bit maya version 2008 following error occurs Error: No module named win32api Traceback (most recent call last): File "", line 1, in ImportError: No module named win32api # I need to get mouse cursor position in python so that i can place window exactly in that position. Is there any other way to get it Brgds, kNish

    Read the article

  • Use symfony 1.4 without changing apache configuration

    - by aRagnis
    Is it possible to set the /web directory as webroot whithout changing apache configuration file? I tried using the following .htaccess code, but if i go to localhost/module/, it displays 404 error. But if i go to localhost/web/module/ then everything works. <IfModule mod_rewrite.c> RewriteEngine on RewriteRule sf/(.*) lib/vendor/symfony/data/web/sf/$1 [L] RewriteRule ^$ web/ [L] RewriteRule (.*) web/$1 [L] </IfModule>

    Read the article

  • APE engine Mysql push data to channel on insert

    - by Fotis
    Hello, i am working with APE Engine (http://www.ape-project.org) and up until now i had no actual problem. The problem is that i would like to use the MySQL module and push data to a channel each time a row is inserted into a table. I've tried to setup a server side module, i created an SQL query but data is fetched only when the server boots. How can i make this work?

    Read the article

  • Is it possible to add IPTC data to a JPG using python when no such data already exists?

    - by ventolin
    With the IPTCInfo module under Python (http://snippets.dzone.com/posts/show/768 for more info) it's possible to read, modify and write IPTC info to pictures. However, if a JPG doesn't already have IPTC information, the module simply raises an exception. It doesn't seem to be able to create and add this metadata information itself. What alternatives are there? I've googled for the past hour but to no avail whatsoever.

    Read the article

  • Please help to troubleshoot the issue with Inspiron 8600 laptop

    - by user34300
    Hello! I have a Dell Inspiron 8600 laptop which display stopped working all of the sudden. It started to show a purple fog pattern along with some color vertical lines. I talked to Dell support and they told me that is a screen gone bad and I should get a new one which I did. But surprisingly the new display won't work either! The pattern on the screen is different but still no picture. So I tried to connect the old display to another laptop (Lenovo Z61) and it turns out it works just fine with it! So please help me to identify the cause of the issue. I think it could be a video card but the external display works flawlessly. I appreciate your thoughts about it so I won't need to buy spares which I don't need. Thank you! P.S. Please do not suggest to contact Dell support again.

    Read the article

  • Common utility functions for Perl .t tests

    - by zedoo
    Hi I am getting started with Test::More, already have a few .t test scripts. Now I'd like to define a function that will only be used for the tests, but accross different .t files. Where's the best place to put such a function? Define another .t without any tests and require it where needed? (As a sidenote I use the module structure created by Module::Starter)

    Read the article

  • How to restrict code from developers

    - by Kelvin
    My company is planning in hiring outsourcers to work for us, but concerned to give whole existing code to outside world. What is the proper way to deal with security of sharing code in such cases? Is it possible to restrict part of code for developers? So each of them could work on their project without having access to whole repository. P.S. The code we have is very integrated, and its hard to extract "one module", each module can use files from different locations. Thanks in advance

    Read the article

  • How do I create a rule in Outlook 2010 that moves emails without special headers to a folder?

    - by burnersk
    I like to create a rule in Outlook 2010 that moves emails not containing a special string within the email header field message-id to a folder. How to do that? Pattern: not contains "SPECIAL-STRING". Example E-Mail: ... Date: Fri, 1 Sep 2012 11:16:32 +0100 Message-ID: <bla.bla.bla@SPECIAL-NOT-STRING> MIME-Version: 1.0 ... Hi there :) Pattern matches because "SPECIAL-STRING" is not present (note there is a "NOT" between the words). Automatically moves those emails to folder INBOX/other-mails.

    Read the article

  • Replacing python docstrings

    - by tomaz
    I have written a epytext to reST markup converter, and now I want to convert all the docstrings in my entire library from epytext to reST format. Is there a smart way to read the all the docstrings in a module and write back the replacements? ps: ast module perhaps?

    Read the article

  • Getting "uninitialized constant" in Rails app

    - by Robert McCabe
    I'm new to Rails and feeling my way, but this has me stumped. I moved some constants to a separate module ie: module Fns Fclick = "function() { alert(\"You clicked the map.\");}\n" ... end then in my controller added: require "fns" class GeomapController < ApplicationController def index fstring = Fns::Fclick ... end but when I run the server I get: uninitialized constant Fns::Fclick what am I missing?

    Read the article

  • Resolving a Forward Declaration Issue Involving a State Machine in C++

    - by hypersonicninja
    I've recently returned to C++ development after a hiatus, and have a question regarding implementation of the State Design Pattern. I'm using the vanilla pattern, exactly as per the GoF book. My problem is that the state machine itself is based on some hardware used as part of an embedded system - so the design is fixed and can't be changed. This results in a circular dependency between two of the states (in particular), and I'm trying to resolve this. Here's the simplified code (note that I tried to resolve this by using headers as usual but still had problems - I've omitted them in this code snippet): #include <iostream> #include <memory> using namespace std; class Context { public: friend class State; Context() { } private: State* m_state; }; class State { public: State() { } virtual void Trigger1() = 0; virtual void Trigger2() = 0; }; class LLT : public State { public: LLT() { } void Trigger1() { new DH(); } void Trigger2() { new DL(); } }; class ALL : public State { public: ALL() { } void Trigger1() { new LLT(); } void Trigger2() { new DH(); } }; // DL needs to 'know' about DH. class DL : public State { public: DL() { } void Trigger1() { new ALL(); } void Trigger2() { new DH(); } }; class HLT : public State { public: HLT() { } void Trigger1() { new DH(); } void Trigger2() { new DL(); } }; class AHL : public State { public: AHL() { } void Trigger1() { new DH(); } void Trigger2() { new HLT(); } }; // DH needs to 'know' about DL. class DH : public State { public: DH () { } void Trigger1() { new AHL(); } void Trigger2() { new DL(); } }; int main() { auto_ptr<LLT> llt (new LLT); auto_ptr<ALL> all (new ALL); auto_ptr<DL> dl (new DL); auto_ptr<HLT> hlt (new HLT); auto_ptr<AHL> ahl (new AHL); auto_ptr<DH> dh (new DH); return 0; } The problem is basically that in the State Pattern, state transitions are made by invoking the the ChangeState method in the Context class, which invokes the constructor of the next state. Because of the circular dependency, I can't invoke the constructor because it's not possible to pre-define both of the constructors of the 'problem' states. I had a look at this article, and the template method which seemed to be the ideal solution - but it doesn't compile and my knowledge of templates is a rather limited... The other idea I had is to try and introduce a Helper class to the subclassed states, via multiple inheritance, to see if it's possible to specify the base class's constructor and have a reference to the state subclasse's constructor. But I think that was rather ambitious... Finally, would a direct implmentation of the Factory Method Design Pattern be the best way to resolve the entire problem?

    Read the article

  • C++ DLL Export: Decorated/Mangled names

    - by Bob
    Created basic C++ DLL and exported names using Module Definition file (MyDLL.def). After compilation I check the exported function names using dumpbin.exe I expect to see: SomeFunction but I see this instead: SomeFunction = SomeFunction@@@23mangledstuff#@@@@ Why? The exported function appears undecorated (especially compared to not using the Module Def file), but what's up with the other stuff? If I use dumpbin.exe against a DLL from any commercial application, you get the clean: SomeFunction and nothing else......

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Tips for making administration of Drupal site easier

    - by Busk
    I'm creating a Drupal site for a client, and I'd like to make administrating the site as easy as possible for them. Examples of what they'd want to do with the site is: Add/Edit/Remove content which will be displayed on various pages Manage a forum - Just the basic Drupal Forum module Add / Ban Users Respond to comments left using the webforum I see there is an Admin module, that looks pretty promising. But I was wondering if anyone has any other helpful tips. Thanks

    Read the article

  • Some problem with postgres_psycopg2

    - by aatifh
    Last night I upgraded my machine to Ubuntu 10.04 from 9.10. It seems to have cluttered my python module. Whenever I run python manage.py I get this error: ImportError: No module named postgresql_psycopg2.base Can any one throw any light on this?

    Read the article

  • mysql_connect randomly hangs up

    - by sergdev
    I install php 5 (more precisely 5.3.1) as apache module. After this one of my application becomes randomly hang up on mysql_connect - sometimes works, sometimes no, sometimes reload of page helps. How can this be fixed? I use Windows Vista, Apache/2.2.14 (Win32) PHP/5.3.1 with php module, MySql 5.0.67-community-nt.

    Read the article

  • What is the "proper" method for determining if a swf is running within an AIR application?

    - by Michael Prescott
    I've got a Flex Web project and a Flex AIR project that use a common code-base. The common code defines several run-time loaded Flex Modules. I want the Flex Modules to behave differently depending on whether the running base application is WEB or AIR. What is the proper method for determining from the module code whether the module is running in a WEB or AIR application? (I found that Security.sandboxType.toString() returns "application", but I haven't found anything better in the documentation, yet.)

    Read the article

< Previous Page | 162 163 164 165 166 167 168 169 170 171 172 173  | Next Page >