Search Results

Search found 5233 results on 210 pages for 'fulltext searching'.

Page 169/210 | < Previous Page | 165 166 167 168 169 170 171 172 173 174 175 176  | Next Page >

• Cannot install XML::LibXML module on Windows

  - by Deepak Konidena

  I am trying to use XPath to extract some HTML tags and data and for that I need to use XML::LibXML module. I tried installing it from CPAN shell but it doesn't install. I followed the instructions from CPAN site about the installation, that we need to install libxml2, iconv and zlib wrappers before installing XML::LibXML and it didn't work out. Also, if there is any other simpler module that gets my task done, please let me know. The task at hand: I am searching for a specific <dd> tag on a html page which is really big ( around 5000 - 10000) <dd> and <dt> tags. So, I am writing a script which matches the content within <dd> tag and fetches the content within the corresponding (next) <dt> tag. I wish i could i have been a little more clearer. Any help is greatly appreciated.

  Read the article

• SQL Server 2005 Reporting Services and the Report Viewer

  - by Kendra

  I am having an issue embedding my report into an aspx page. Here's my setup: 1 Server running SQL Server 2005 and SQL Server 2005 Reporting Services 1 Workstation running XP and VS 2005 The server is not on a domain. Reporting Services is a default installation. I have one report called TestMe in a folder called TestReports using a shared datasource. If I view the report in Report Manager, it renders fine. If I view the report using the http ://myserver/reportserver url it renders fine. If I view the report using the http ://myserver/reportserver?/TestReports/TestMe it renders fine. If I try to view the report using http ://myserver/reportserver/TestReports/TestMe, it just goes to the folder navigation page of the home directory. My web application is impersonating somebody specific to get around the server not being on a domain. When I call the report from the report viewer using http ://myserver/reportserver as the server and /TestReports/TestMe as the path I get this error: For security reasons DTD is prohibited in this XML document. To enable DTD processing set the ProhibitDtd property on XmlReaderSettings to false and pass the settings into XmlReader.Create method. When I change the server to http ://myserver/reportserver? I get this error when I run the report: Client found response content type of '', but expected 'text/xml'. The request failed with an empty response. I have been searching for a while and haven't found anything that fixes my issue. Please let me know if there is more information needed. Thanks in advance, Kendra

  Read the article

• How do you efficiently implement a document similarity search system?

  - by Björn Lindqvist

  How do you implement a "similar items" system for items described by a set of tags? In my database, I have three tables, Article, ArticleTag and Tag. Each Article is related to a number of Tags via a many-to-many relationship. For each Article i want to find the five most similar articles to implement a "if you like this article you will like these too" system. I am familiar with Cosine similarity and using that algorithm works very well. But it is way to slow. For each article, I need to iterate over all articles, calculate the cosine similarity for the article pair and then select the five articles with the highest similarity rating. With 200k articles and 30k tags, it takes me half a minute to calculate the similar articles for a single article. So I need another algorithm that produces roughly as good results as cosine similarity but that can be run in realtime and which does not require me to iterate over the whole document corpus each time. Maybe someone can suggest an off-the-shelf solution for this? Most of the search engines I looked at does not enable document similarity searching.

  Read the article

• An implementation of Sharir's or Aurenhammer's deterministic algorithm for calculating the intersect

  - by RGrey

  The problem of finding the intersection/union of 'N' discs/circles on a flat plane was first proposed by M. I. Shamos in his 1978 thesis: Shamos, M. I. “Computational Geometry” Ph.D. thesis, Yale Univ., New Haven, CT 1978. Since then, in 1985, Micha Sharir presented an O(n log2n) time and O(n) space deterministic algorithm for the disc intersection/union problem (based on modified Voronoi diagrams): Sharir, M. Intersection and closest-pair problems for a set of planar discs. SIAM .J Comput. 14 (1985), pp. 448-468. In 1988, Franz Aurenhammer presented a more efficient O(n log n) time and O(n) space algorithm for circle intersection/union using power diagrams (generalizations of Voronoi diagrams): Aurenhammer, F. Improved algorithms for discs and balls using power diagrams. Journal of Algorithms 9 (1985), pp. 151-161. Earlier in 1983, Paul G. Spirakis also presented an O(n^2) time deterministic algorithm, and an O(n) probabilistic algorithm: Spirakis, P.G. Very Fast Algorithms for the Area of the Union of Many Circles. Rep. 98, Dept. Comput. Sci., Courant Institute, New York University, 1983. I've been searching for any implementations of the algorithms above, focusing on computational geometry packages, and I haven't found anything yet. As neither appear trivial to put into practice, it would be really neat if someone could point me in the right direction!

  Read the article

• How can I call from my PC through my cisco ip phone?

  - by Enjoy coding

  Hi gurus, I am trying to call a telephone number fro my PC through my ip phone once my application completes its work. So I am searching for a way to access my ip phone from my PC. Please correct me if I am wrong or missing the obvious. On my PC in office selecting a phone in Microsoft office communicator and making calls from PC through my Cisco IP Phone is disabled. Is there any way i can programmatically call a external phone or mobile number from my PC as my ip phone is connected to my PC. I tried out etQuickDial and Make/Drop calls. But I am not able to find the appropriate way or setup to make calls. I also googled for any libraries and i saw some TAPI but was not able to get correct way. Please help me out with this. My cisco ip phone is 7940. My environment is Windows XP. Please let me know if you need more details. No problems with me even if you propose a solution involving coding or a non coding way of downloading and installing any applications. Thanks in advance. If you dont want me to post it here and If I need to put it in super user or server fault or some where else please direct me appropriately. I did not use any of these two before so I posted this question here.

  Read the article

• How do you tune Eclipse IDE? How do you use Eclipse IDE?

  - by Kirzilla

  Hello, I've started to read the book "Code Craft" by Pete Goodliffe. The fourth chapter is about instruments that developer uses during his daily work; this chapter made me to review my work and I've seriously decided to make it easier with fully personalized IDE. Eclipse IDE is what I've started my learning from... I've read documentation and found that it's really easy to do tasks routine from Eclipse. We are using Mantis for tracking tasks and it was great surprise for me to find out Mantis Connector for Mylyn. Also I was pretty glad to see SVN client integrated into Eclipse IDE. Also I've found UML2 tool for Eclipse, but was disappointed because there is no any graphic interface for building diagramms. (Or, maybe, I'm was searching in wrong place?) What useful plugins do you use in your daily work? How do you use Eclipse for collaboration in your team? Do you have any links about intergration Eclipse IDE experience in dev. team? Thank you!

  Read the article

• Free solution for automatic updates with a .NET/C# app?

  - by a2h

  Yes, from searching I can see this has been asked time and time again. Here's a backstory. I'm an individual hobbyist developer with zero budget. A program I've been developing has been in need of constant bugfixes, and me and users are getting tired of having to manually update. Me, because my current solution of Manually FTP to my website Update a file "newest.txt" with the newest version Update index.html with a link to the newest version Hope for people to see the "there's an update" message Have them manually download the update sucks, and whenever I screw up an update, I get pitchforks. Users, because, well, "Are you ever going to implement auto-update?" "Will there ever be an auto-update feature?" Over the past I have looked into: WinSparkle - No in-app updates, and the DLL is 500 KB. My current solution is a few KBs in the executable and has no in-app updates. http://windowsclient.net/articles/appupdater.aspx - I can't comprehend the documentation http://www.codeproject.com/KB/vb/Auto_Update_Revisited.aspx - Doesn't appear to support anything other than working with files that aren't in use wyUpdate - wyBuild isn't free, and the file specification is simply too complex. Maybe if I was under a company paying me I could spend the time, but then I may as well pay for wyBuild. http://www.kineticjump.com/update/default.aspx - Ditto the last sentence. ClickOnce - Workarounds for implementing launching on startup are massive, horrendous and not worth it for such a simple feature. Publishing is a pain; manual FTP and replace of all files is required for servers without FrontPage Extensions. I'm pretty much ready to throw in the towel right now and strangle myself. And then I think about Sparkle... EDIT: I came across SparkleDotNET just then. Looks good, though the DLL is 200 KB. Don't know if that's really that big of an issue, though.

  Read the article

• edmx - The operation could not be completed - After adding Inheritance

  - by vdh_ant

  Hey guys I have an edmx model which I have draged 2 tables onto - One called 'File' and the other 'ApplicaitonFile'. These two tables have a 1 to 1 relationship in the database. If I stop here everything works fine. But in my model, I want 'ApplicaitonFile' to inherit from 'File'. So I delete the 1 to 1 relationship then configure 'ApplicaitonFile' from 'File' and then remove the FileId from 'ApplicaitonFile' which was the primary key. (Note I am following the instructions from here). If I leave the model open at this point everything is fine, but as soon as I close it, if I try and reopen it again I get the following error "The operation could not be completed". I have been searching for a solution and found this - http://stackoverflow.com/questions/944050/entity-model-does-not-load but as far as I can tell I don't have a duplicate InheritanceConnectors (although I don't know exactly what I'm looking for but I can't see anything out of the ordinary - like 2 connectors with the same name) and the relationship I originally have is a 1 to 1 not a 1 to 0..1 Any ideas???

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• How to import data to SAP

  - by Mehmet AVSAR

  Hi, As a complete stranger in town of SAP, I want to transfer my own application's (mobile salesforce automation) data to SAP. My application has records of customers, stocks, inventory, invoices (and waybills), cheques, payments, collections, stock transfer data etc. I have an additional database which holds matchings of records. ie. A customer with ID 345 in my application has key 120-035-0223 in SAP. Every record, for sure, has to know it's counterpart, including parameters. After searching Google and SAP help site for a day, I covered that it's going to be a bit more pain than I expected. Especially SAP site does not give even a clue on it. Say I couldn't find. We transferred our data to some other ERP systems, some of which wanted XML files, some other exposed their APIs. My point is, is Sql Server's SSIS an option for me? I hope it is, so I can fight on my own territory. Since client requests would vary a lot, I count flexibility as most important criteria. Also, I want to transfer as much data as I could. Any help is appreciated. Regards,

  Read the article

• video streaming over http in blackberry

  - by ysnky

  hi all, while i was searching video player over http, i found the article which is located at this url; http://www.blackberry.com/knowledgecenterpublic/livelink.exe/fetch/2000/348583/800332/1089414/Stream ing_media_-_Start_to_finish.html?nodeid=2456737&ve rnum=0 i can run by adding ";deviceside=true" at the end of url. it works fine in the jde4.5 simulator. it gets 3gp videos from my local server. i tested with 580kb files and works fine. but when i get the same file from my server (not local, real server) i have problems with big files (e.g 580 kb). it plays 180kb files (but sometimes it does not play this file either) but not plays 580kb file. and also i deployed my application to my 9000 device it sometimes plays small file (180kb) but never plays big file (580kb). why it plays if it is on my local file, not play in real world? i ve stucked for days. hope you help me. and also the code at the url given below is not work, the only code i ve found is the above. blackberry.com/knowledgecenterpublic/livelink.exe/fetch/2000/348583/800332/1089414/How_To _-_Play_video_within_a_BlackBerry_smartphone_appli cation.html?nodeid=1383173&vernum=0 btw, there is no method such as resize(long param) of CircularByteBuffer class. so i comment relavent line (buffer.resize(buffer.getSize() + (buffer.getSize() * percent / 100)); as shown below. public void increaseBufferCapacity(int percent) { if(percent < 0){ log(0, "FAILED! SP.setBufferCapacity() - " + percent); throw new IllegalArgumentException("Increase factor must be positive.."); } synchronized(readLock){ synchronized(connectionLock){ synchronized(userSeekLock){ synchronized(mediaIStream){ log(0, "SP.setBufferCapacity() - " + percent); //buffer.resize(buffer.getSize() + (buffer.getSize() * percent / 100)); this.bufferCapacity = buffer.getSize(); } } } } } thanks in advance.

  Read the article

• Throttling outbound API calls generated by a Rails app

  - by Sharpie

  I am not a professional web developer, but I like to wrench on websites as a hobby. Recently, I have been playing with developing a Rails app as a project to help me learn the framework. The goal of my toy app is to harvest data from another service through their API and make it available for me to query using a search function. However, the service I want to pull data from imposes a rate limit on the number of API calls that may be executed per minute. I plan on having my app run a daily update which may generate a burst of API calls that far exceeds the limit provided by the external service. I wish to respect the performance of the external site and so would like to throttle the rate at which my app executes the calls. I have done a little bit of searching and the overwhelming amount of tutorial material and pre-built libraries I have found cover throttling inbound API calls to a web app and I can find little discussion of controlling the flow of outbound calls. Being both an amateur web developer and a rails newbie, it is entirely possible that I have been executing the wrong searches in the wrong places. Therefore my questions are: Is there a nice website out there aggregating Rails tutorials that has material related to throttling outbound API requests? Are there any ruby gems or other libraries that would help me throttle the requests? I have some ideas of how I might go about writing a throttling system using a queue-based worker like DelayedJob or Resque to manage the API calls, but I would rather spend my weekends building the rest of the site if there is a good pre-built solution out there already.

  Read the article

• Overriding deep functions in javascript

  - by PintSizedCat

  I'm quite new to javascript but have undertaken a task to get better aquainted with it. However, I am running into some problems with jQuery. The following javascript is the code that is in a third party jQuery plugin and I would love to be able to override the funFunction() function here to do my own implementation. Is this possible, if so, how can I do it? I've been doing a fair amount of searching and have tried a number of methods for overriding the function using things like: jQuery.blah.funFunction = funtion() { alert("like this"); }; Main code: (function($) { $.extend( { blah: new function() { this.construct = = function(settings) { //Construct... stuff }; function funFunction() { //Function I want to override } } }); })(jQuery); For those further interested I am trying to override tablesorter so that the only way a user can sort a column is in ascending order only. Edit: There is a wordpress installation that uses WP-Table-Reloaded which in turn uses this plugin. I don't want to change the core code for this plugin because if there was ever an update I would then have to make sure that my predecessor knew exactly what I had done. I've been programming for a long time and feel like I should easily be able to pick up javascript whilst also looking at jQuery. I know exactly what I need to do for this, just not how I can override this function.

  Read the article

• Hibernate: Dirty Checking and Only Update of Dirty Attributes?

  - by jens

  Hello Experts, in "good old JDBC days" I wrote a lot of SQL Queries that did very targeted updates of only the "attributes/members" that were actually changed: For Example having an object with the following members: public String name; public String address; public Date date; If only date was changed in some Business Method I would only issue an SQL UPDATE for the date member. ==It seems however (thats my "impression" of hibernate) that when working with a standard Hibernate mapping (mapping the full class), even updates of only one single member lead to a full update of the object in SQL Statements generated by Hibernate. My Questions are: 1.) Is this observation correct, that hibernate DOES NOT intelligently check (in a fully mapped class), what member(s) where changed and then only issue updates for the specific changed members, but rather always will update (in the generated SQL Update Statement) all mapped members (of a class), even if they were not changed (in case the object is dirty due to one member being dirty...) 2.) What can I do to make Hibernate only update those members, that have been changed? I am searching for a solution to have hibernate only update the member that actually changed. (I know hibernate does some big work on doing dirty-checking, but as far as I know this dirtychecking is only relevant to identify if the object as whole is dirty, not what single member is dirty.) Thank you very much! Jens

  Read the article

• Sql Server Compact - Schema Management

  - by Richard B

  I've been searching for some time for a good solution to implement the idea of managing schema on a Sql Server Compact 3.5 db. I know of several ways of managing schema on Sql Express/std/enterprise, but Compact Edition doesn't support the necessary tools required to use the same methodology. Any suggestions/tips? I should expand this to say that it is for 100+ clients with wrapperware software. As the system changes, I need to publish update scripts alongside the new binaries to the client. I was looking for a decent method by which to publish this without having to just hand the client a script file and say "Run this in SSMSE". Most clients are not capable of doing such a beast. A buddy of mine disclosed a partial script on how to handle the SQL Server piece of my task, but never worked on Compact Edition... It looks like I'll be on my own for this. What I think that I've decided to do, and it's going to need a "geek week" to accomplish, is that I'm going to write some sort of tool much like how WiX and nAnt works, so that I can just write an overzealous Xml document to handle the work. If I think that it is worthwhile, I'll publish it on CodePlex and/or CodeProject because I've used both sites a bit to gain better understanding of concepts for jobs I've done in the past, and I think it is probably worthwhile to give back a little.

  Read the article

• DjangoUnicodeDecodeError while storing pickle'd data.

  - by Jack M.

  I've got a simple dict object I'm trying to store in the database after it has been run through pickle. It seems that Django doesn't like trying to encode this error. I've checked with MySQL, and the query isn't even getting there before it is throwing the error, so I don't believe that is the problem. The dict I'm storing looks like this: { 'ordered': [ { 'value': u'First\xd1ame Last\xd1ame', 'label': u'Full Name' }, { 'value': u'123-456-7890', 'label': u'Phone Number' }, { 'value': u'[email protected]', 'label': u'Email Address' } ], 'cleaned_data': { u'Phone Number': u'123-456-7890', u'Full Name': u'First\xd1ame Last\xd1ame', u'Email Address': u'[email protected]' }, 'post_data': <QueryDict: { u'Phone Number': [u'1234567890'], u'Full Name_1': [u'Last\xd1ame'], u'Full Name_0': [u'First\xd1ame'], u'Email Address': [u'[email protected]'] }>, 'user': <User: itis> } The error that gets thrown is: 'utf8' codec can't decode bytes in position 52-53: invalid data. Position 52-53 is the first instance of \xd1 (Ñ) in the pickled data. So far, I've dug around StackOverflow and found a few questions where the database encoding for the objects was wrong. This doesn't help me because there is no MySQL query yet. This is happening before the database. Google also didn't help much when searching for unicode errors on pickled data. It is probably worth mentioning that if I don't use the Ñ, this code works fine.

  Read the article

• crawl websites out of java web application without using bin/nutch

  - by Marcel

  hi :) i am trying to using nutch (1.1) without bin/nutch from my (java) mojarra 2.0.2 webapp... i am searching at google for examples, but there are no examples how i can realize this :/ ... i get an exception and the job fails :/ (i think of cause something with hadoop)... here is my code: public void run() throws Exception { final String[] args = new String[] { String.format("%s%s%s%s", JSFUtils.getWebAppRoot(), "nutch", File.separator, DIRECTORY_URLS), "-dir", String.format("%s%s%s%s", JSFUtils.getWebAppRoot(), "nutch", File.separator, DIRECTORY_CRAWL), "-threads", this.preferences.get("threads"), "-depth", this.preferences.get("depth"), "-topN", this.preferences.get("topN"), "-solr", this.preferences.get("solr") }; Crawl.main(args); } and a part of the logging: 10/05/17 10:42:54 INFO jvm.JvmMetrics: Initializing JVM Metrics with processName=JobTracker, sessionId= 10/05/17 10:42:54 WARN mapred.JobClient: Use GenericOptionsParser for parsing the arguments. Applications should implement Tool for the same. 10/05/17 10:42:54 INFO mapred.FileInputFormat: Total input paths to process : 1 10/05/17 10:42:54 INFO mapred.JobClient: Running job: job_local_0001 10/05/17 10:42:54 INFO mapred.FileInputFormat: Total input paths to process : 1 10/05/17 10:42:55 INFO mapred.MapTask: numReduceTasks: 1 10/05/17 10:42:55 INFO mapred.MapTask: io.sort.mb = 100 java.io.IOException: Job failed! at org.apache.hadoop.mapred.JobClient.runJob(JobClient.java:1232) at org.apache.nutch.crawl.Injector.inject(Injector.java:211) at org.apache.nutch.crawl.Crawl.main(Crawl.java:124) at lan.localhost.process.NutchCrawling.run(NutchCrawling.java:108) at lan.localhost.main.Index.indexing(Index.java:71) at lan.localhost.bean.FeedingBean.actionStart(FeedingBean.java:25) .... can someone help me or tell me how i can crawling from a java application? i have increased the Xms to 256m and Xmx to 768m, but nothing changed... best regards marcel

  Read the article

• Creating nodes porgramatically in Drupal 6

  - by John

  Hey, I have been searching for how to create nodes in Drupal 6. I found some entries here on stackoverflow, but the questions seemed to either be for older versions or the solutions did not work for me. Ok, so here is my current process for trying to create $node = new stdClass(); $node->title = "test title"; $node->body = "test body"; $node->type= "story"; $node->created = time(); $node->changed = $node->created; $node->status = 1; $node->promote = 1; $node->sticky = 0; $node->format = 1; $node->uid = 1; node_save( $node ); When I execute this code, the node is created, but when I got the administration page, it throws the following errors: warning: Invalid argument supplied for foreach() in C:\wamp\www\steelylib\includes\menu.inc on line 258. warning: Invalid argument supplied for foreach() in C:\wamp\www\steelylib\includes\menu.inc on line 258. user warning: Duplicate entry '36' for key 1 query: INSERT INTO node_comment_statistics (nid, last_comment_timestamp, last_comment_name, last_comment_uid, comment_count) VALUES (36, 1269980590, NULL, 1, 0) in C:\wamp\www\steelylib\sites\all\modules\nodecomment\nodecomment.module on line 409. warning: Invalid argument supplied for foreach() in C:\wamp\www\steelylib\includes\menu.inc on line 258. warning: Invalid argument supplied for foreach() in C:\wamp\www\steelylib\includes\menu.inc on line 258. I've looked at different tutorials, and all seem to follow the same process. I'm not sure what I am doing wrong. I am using Drupal 6.15. When I roll back the database (to right before I made the changes) the errors are gone. Any help is appreciated!

  Read the article

• Add new language to existing Xcode project localization

  - by leolobato

  Hey guys, I'm working on an existing Xcode 3.2.2 Universal iPhone OS project which is already localized for 4 languages (EN, IT, DE and FR). We are now adding a new language (JA) into this project. Each existing .lproj folder (en.lproj, it.lproj, de.lproj and fr.lproj) has almost 60 files - including PNGs, HTMLs and the Localizable.strings file. Each one of those files appear as localized groups inside Groups & Files in Xcode. They're spread all over the tree. If I right-click one of those groups (say, Localizable.strings) inside Xcode, Get Info, click on "Add Localization" and type "ja" - as the Xcode docs suggest, nothing happens. From what I read in this newgroup, it's possibly because of the way those folders are named. If they were named like English.lproj and Italian.lproj, this was supposed to work. So, for me to actually import a new language localized file into the existing group, I have to: Right-click the localized group file. Choose "Add Existing File". Select the corresponding file inside the ja.lproj folder. I'm about to get a new ja.lproj folder with those 60 localized files and would love to import them in the project in a way that doesn't involve searching for every single file in Groups & Trees and performing those steps... for every one of those 60 files. Is that possible? Is there a right (or better) way to import a new language into this Xcode project?

  Read the article

• SQL Server - Multi-Column substring matching

  - by hamlin11

  One of my clients is hooked on multi-column substring matching. I understand that Contains and FreeText search for words (and at least in the case of Contains, word prefixes). However, based upon my understanding of this MSDN book, neither of these nor their variants are capable of searching substrings. I have used LIKE rather extensively (Select * from A where A.B Like '%substr%') Sample table A: ID | Col1 | Col2 | Col3 | ------------------------------------- 1 | oklahoma | colorado | Utah | 2 | arkansas | colorado | oklahoma | 3 | florida | michigan | florida | ------------------------------------- The following code will give us row 1 and row 2: select * from A where Col1 like '%klah%' or Col2 like '%klah%' or Col3 like '%klah%' This is rather ugly, probably slow, and I just don't like it very much. Probably because the implementations that I'm dealing with have 10+ columns that need searched. The following may be a slight improvement as code readability goes, but as far as performance, we're still in the same ball park. select * from A where (Col1 + ' ' + Col2 + ' ' + Col3) like '%klah%' I have thought about simply adding insert, update, and delete triggers that simply add the concatenated version of the above columns into a separate table that shadows this table. Sample Shadow_Table: ID | searchtext | --------------------------------- 1 | oklahoma colorado Utah | 2 | arkansas colorado oklahoma | 3 | florida michigan florida | --------------------------------- This would allow us to perform the following query to search for '%klah%' select * from Shadow_Table where searchtext like '%klah%' I really don't like having to remember that this shadow table exists and that I'm supposed to use it when I am performing multi-column substring matching, but it probably yields pretty quick reads at the expense of write and storage space. My gut feeling tells me there there is an existing solution built into SQL Server 2008. However, I don't seem to be able to find anything other than research papers on the subject. Any help would be appreciated.

  Read the article

• SOLR phrase query

  - by Alex

  I have a slight problem when searching with SOLR 4.0 and attempting a phrase query. I have a field called "idx_text_general_ci" which is a case insensitive (all lowercased) field made up of all fields. When I try and search for a phrase (marine fitter) my SOLR refuses to search for the phrase instead splitting the phrase into 2 words - /select?defType=edismax&q=idx_text_general_ci:marine%20fitter&debugQuery=true debugQuery=true output below: <lst name="debug"> <str name="rawquerystring">idx_text_general_ci:marine fitter</str> <str name="querystring">idx_text_general_ci:marine fitter</str> <str name="parsedquery"> (+(idx_text_general_ci:marine DisjunctionMaxQuery((id:fitter))))/no_coord </str> <str name="parsedquery_toString">+(idx_text_general_ci:marine (id:fitter))</str> As you can see above it splits the query into 2 parts (idx_text_general_ci:marine then id:fitter). THe problem I have is that I have an exact match for "marine fitter" that appears twice in the idx_text_general_ci field yet it's ranked with a lesser score than a document with the word "marine" appearing 3 times. I know this will not be the case if my SOLR was to search the field with the phrase as expected. If I wrap the phrase in quotes I get zero results. Any help or a nudge in the right direction would be much appreciated. Thanks in advance Alex

  Read the article

• Embedding a CMS in an MVC Web App

  - by Mr Snuffle

  I'm working on a website for searching for businesses, then displaying a listing page. We've been toying with the idea of letting the clients manage their listing page using an external CMS. I'm not sure how often this is done, or if it's even best practice. Ideally, we want to be able to setup a listing on our website, then give the clients access to an external CRM when they can manage their listing page. We then want to embed this custom page within our website, possibly using an iframe (which will come along with it's own set of complications). We'd like this integration to be as seamless as possible. I'd personally prefer it if we could directly inject the HTML into our own page and bypass an iframe all together, but I don't know of any CMS hosting services that provide the interface for such a thing. We've experimented a little with Squarespace, and we can get a fairly clean version of someone's page which would be well suited for an iframe. I'm wondering if anyone else has looked and integrating an external hosting CMS into a website (in this case, we're using ASP.NET MVC). We'd also want to automate the creation of accounts on this external CMS, so when a user signed up we could just point them to the website with some login details. I have no idea if anyone offers a service like this, but any recommendations would be greatly appreciated. We could host a service ourself too, but the aim is to have an external system that clients can use to manage their pages. Cheers, James

  Read the article

• Fuzzy Search on Material Descriptions including numerical sizes & general descriptions of material t

  - by Kyle

  We're looking to provide a fuzzy search on an electrical materials database (i.e. conduit, cable, etc.). The problem is that, because of a lack of consistency across all material types, we could not split sizes into separate fields from the text description because some materials are rated by things other than size. I've attempted a combination of a full text search & a SQL CLR implementation of the Levenshtein search algorithm (for assistance in ranking), but my results are a little funky (i.e. they are not sorting correctly due to improper ranking). For example, if the search term is "3/4" ABCD Conduit", I'll might get back several irrelevant results in the following order: 1/2" Conduit 1/4" X 3/4" Cable 1/4" Cable Ties 3/4" DFC Conduit Tees 3/4" ABCD Conduit 3/4" Conduit I believe I've nailed the problem down to the fact that these two search algorithms do not factor in the relevance of punctuation & numeric. That is, in such a search, I'd expect the size to take precedence over any fuzzy match on the rest of the description, but my results don't reflect that. My question is: Can anyone recommend better search algorithms or different approaches that may be better suited for searching a combination of alphanumerics & punctuation characters?

  Read the article

• Adding a guideline to the editor in Visual Studio

  - by xsl

  Introduction I've always been searching for a way to make Visual Studio draw a line after a certain amount of characters: Below is a guide to enable these so called guidelines for various versions of Visual Studio. Visual Studio 2010 Install Paul Harrington's Editor Guidelines extension. Open the registry at HKEY_CURRENT_USER\Software\Microsoft\VisualStudio\10.0\Text Editor and add a new string called Guides with the value RGB(100,100,100), 80. The first part specifies the color, while the other one (80) is the column the line will be displayed. Or install the Guidelines UI extension, which will add entries to the editor's context menu for adding/removing the entries without needing to edit the registry directly. The current disadvantage of this method is that you can't specify the column directly. Visual Studio 2008 and Other Versions If you are using Visual Studio 2008 open the registry at HKEY_CURRENT_USER\Software\Microsoft\VisualStudio\9.0\Text Editor and add a new string called Guides with the value RGB(100,100,100), 80. The first part specifies the color, while the other one (80) is the column the line will be displayed. The vertical line will appear, when you restart Visual Studio. This trick also works for various other version of Visual Studio, as long as you use the correct path: 2003: HKEY_CURRENT_USER\Software\Microsoft\VisualStudio\7.1\Text Editor 2005: HKEY_CURRENT_USER\Software\Microsoft\VisualStudio\8.0\Text Editor 2008: HKEY_CURRENT_USER\Software\Microsoft\VisualStudio\9.0\Text Editor 2008 Express: HKEY_CURRENT_USER\Software\Microsoft\VCExpress\9.0\Text Editor This also works in SQL Server 2005 and probably other versions.

  Read the article

• Combo-box values automatically update

  - by glinch

  Hi all, hopefully somebody can help The table structure is as follows: tblCompany: compID compName tblOffice: offID, compID, add1, add2, add3 etc... tblEmployee: empID Name, telNo, etc... offID I have a form that contains contact details for employees, all works ok using after update. A cascading combo box, cmbComp, allows me to select a company, and inturn select the appropriate office, cboOff, and updates the corresponding tblEmployee.offID field correctly. Fields are automatically updated for the address also cmbComp: RowSource SELECT DISTINCT tblOffice.compID, tblCompany.compID FROM tblCompany INNER JOIN AdjusterCompanyOffice ON tblCompany.compID=tblOffice.compID ORDER BY tblCompany.compName; cboOff: RowSource SELECT tblCompany.offID, tblCompany.Address1, tblCompany.Address2, tblCompany.Address3, tblCompany.Address4, tblCompany.Address5 FROM tblCompany ORDER BY tblCompany.Address1; The problem I am having is that when i load a new record how to retrieve the data and automatically load the cmbComp and text fields. The cboOff combo box loads correctly as the control source for this is the offID I imagine there must be a way of setting the value on opening the record? Not sure how though. I dont think I can set the controlsource cmbComp or text fields, or can I? Any help/point in the right direction appreciated, have been searching for a way to do this but cant get anywhere!

  Read the article

< Previous Page | 165 166 167 168 169 170 171 172 173 174 175 176  | Next Page >