Search Results

Search found 3244 results on 130 pages for 'proof of concept'.

Page 17/130 | < Previous Page | 13 14 15 16 17 18 19 20 21 22 23 24  | Next Page >

  • ORM on which standards i can select?

    - by just_name
    Q: This question is about how can i figure or select the convenient ORM to my web application. when beginning a new web application,What are the criteria on which i can consider a specific ORM is better than another one for my project or case(web application)? another part of my question : when i begin any web application i use three layers: the DB layer (which contains the connections , and handle the CRUD operations ) the Managers layer(the Data Access Layer) a class for each table on my db (loosely coupled with the previous layer )it contains the CRUD operations for the specific table and the other required operations. the interface layer.. and i use Object Data source.Is that considered as an ORM (as a concept) or I'm wrong in understanding this concept. note:I still a beginner in this field ,, and every day i learn more about web development. please i want explanation and suggestions for this point. Thanks in advance.

    Read the article

  • is it posible to upload directly to remote server using SFTP on ASP.net MVC

    - by DucDigital
    Hi! I am currently develope something using asp.net MVC, im still quite not experience with it so please help me out. I have a form for user to upload Video. The current ideal concept to upload to remote server is to Upload it to to the current server, then use FTP to push it to a remote server. For me, this is not quite fast since you have to upload to current server (Time x1) and then the current server push to new server (Time x2) so it's double the time. So my idea is to make user upload it to the current server, and WHILE user is uploading, the current server add the file to DB and also send the file to the remote server at the same time using SFTP... is it posible and are there any security hole in this concept? Thank you very much

    Read the article

  • Minimum number of training examples for Find-S/Candidate Elimination algorithms?

    - by Rich
    Consider the instance space consisting of integer points in the x, y plane, where 0 = x, y = 10, and the set of hypotheses consisting of rectangles (i.e. being of the form (a = x = b, c = y = d), where 0 = a, b, c, d = 10). What is the smallest number of training examples one needs to provide so that the Find-S algorithm perfectly learns a particular target concept (e.g. (2 = x = 4, 6 = y = 9))? When can we say that the target concept is exactly learned in the case of the Find-S algorithm, and what is the optimal query strategy? I'd also like to know the answer w.r.t Candidate Elimination. Thanks in advance.

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • doctrine default values and relations

    - by Skirmantas
    Concept: Lets say we have table Properties with columns id and name (lets say with some predefined values: "Good" "Better" "Best"). Another table Users has column property_id with many to one relation on Properties (property_id = id). Users has default value on property_id, lets say 1 which means "Good". We might have another table analogue to Users however with default property, lets say "Better". What I need is ability to change default value for Users or other tables in administrator's panel. In mysql I can set default value for column like this: ALTER TABLE <Table> CHANGE <Column> DEFAULT <NEW_DEFAULT_VALUE> I can retrieve default value: SELECT DEFAULT(<Column>) FROM <Table> LIMIT 1 Is it possible to achieve this concept with Doctrine? What I actually need is such method in my table class: class UserTable extend Doctrine_Table { /* ... */ getDefaultProperty() { } setDefaultProperty($value) { /* $value can be either integer or Doctrine_Record */ } }

    Read the article

  • Fake ISAPI Handler to serve static files with extention that are rewritted by url rewriter

    - by developerit
    Introduction I often map html extention to the asp.net dll in order to use url rewritter with .html extentions. Recently, in the new version of www.nouvelair.ca, we renamed all urls to end with .html. This works great, but failed when we used FCK Editor. Static html files would not get serve because we mapped the html extension to the .NET Framework. We can we do to to use .html extension with our rewritter but still want to use IIS behavior with static html files. Analysis I thought that this could be resolve with a simple HTTP handler. We would map urls of static files in our rewriter to this handler that would read the static file and serve it, just as IIS would do. Implementation This is how I coded the class. Note that this may not be bullet proof. I only tested it once and I am sure that the logic behind IIS is more complicated that this. If you find errors or think of possible improvements, let me know. Imports System.Web Imports System.Web.Services ' Author: Nicolas Brassard ' For: Solutions Nitriques inc. http://www.nitriques.com ' Date Created: April 18, 2009 ' Last Modified: April 18, 2009 ' License: CPOL (http://www.codeproject.com/info/cpol10.aspx) ' Files: ISAPIDotNetHandler.ashx ' ISAPIDotNetHandler.ashx.vb ' Class: ISAPIDotNetHandler ' Description: Fake ISAPI handler to serve static files. ' Usefull when you want to serve static file that has a rewrited extention. ' Example: It often map html extention to the asp.net dll in order to use url rewritter with .html. ' If you want to still serve static html file, add a rewritter rule to redirect html files to this handler Public Class ISAPIDotNetHandler Implements System.Web.IHttpHandler Sub ProcessRequest(ByVal context As HttpContext) Implements IHttpHandler.ProcessRequest ' Since we are doing the job IIS normally does with html files, ' we set the content type to match html. ' You may want to customize this with your own logic, if you want to serve ' txt or xml or any other text file context.Response.ContentType = "text/html" ' We begin a try here. Any error that occurs will result in a 404 Page Not Found error. ' We replicate the behavior of IIS when it doesn't find the correspoding file. Try ' Declare a local variable containing the value of the query string Dim uri As String = context.Request("fileUri") ' If the value in the query string is null, ' throw an error to generate a 404 If String.IsNullOrEmpty(uri) Then Throw New ApplicationException("No fileUri") End If ' If the value in the query string doesn't end with .html, then block the acces ' This is a HUGE security hole since it could permit full read access to .aspx, .config, etc. If Not uri.ToLower.EndsWith(".html") Then ' throw an error to generate a 404 Throw New ApplicationException("Extention not allowed") End If ' Map the file on the server. ' If the file doesn't exists on the server, it will throw an exception and generate a 404. Dim fullPath As String = context.Server.MapPath(uri) ' Read the actual file Dim stream As IO.StreamReader = FileIO.FileSystem.OpenTextFileReader(fullPath) ' Write the file into the response context.Response.Output.Write(stream.ReadToEnd) ' Close and Dipose the stream stream.Close() stream.Dispose() stream = Nothing Catch ex As Exception ' Set the Status Code of the response context.Response.StatusCode = 404 'Page not found ' For testing and bebugging only ! This may cause a security leak ' context.Response.Output.Write(ex.Message) Finally ' In all cases, flush and end the response context.Response.Flush() context.Response.End() End Try End Sub ' Automaticly generated by Visual Studio ReadOnly Property IsReusable() As Boolean Implements IHttpHandler.IsReusable Get Return False End Get End Property End Class Conclusion As you see, with our static files map to this handler using query string (ex.: /ISAPIDotNetHandler.ashx?fileUri=index.html) you will have the same behavior as if you ask for the uri /index.html. Finally, test this only in IIS with the html extension map to aspnet_isapi.dll. Url rewritting will work in Casini (Internal Web Server shipped with Visual Studio) but it’s not the same as with IIS since EVERY request is handle by .NET. Versions First release

    Read the article

  • Selling Federal Enterprise Architecture (EA)

    - by TedMcLaughlan
    Selling Federal Enterprise Architecture A taxonomy of subject areas, from which to develop a prioritized marketing and communications plan to evangelize EA activities within and among US Federal Government organizations and constituents. Any and all feedback is appreciated, particularly in developing and extending this discussion as a tool for use – more information and details are also available. "Selling" the discipline of Enterprise Architecture (EA) in the Federal Government (particularly in non-DoD agencies) is difficult, notwithstanding the general availability and use of the Federal Enterprise Architecture Framework (FEAF) for some time now, and the relatively mature use of the reference models in the OMB Capital Planning and Investment (CPIC) cycles. EA in the Federal Government also tends to be a very esoteric and hard to decipher conversation – early apologies to those who agree to continue reading this somewhat lengthy article. Alignment to the FEAF and OMB compliance mandates is long underway across the Federal Departments and Agencies (and visible via tools like PortfolioStat and ITDashboard.gov – but there is still a gap between the top-down compliance directives and enablement programs, and the bottom-up awareness and effective use of EA for either IT investment management or actual mission effectiveness. "EA isn't getting deep enough penetration into programs, components, sub-agencies, etc.", verified a panelist at the most recent EA Government Conference in DC. Newer guidance from OMB may be especially difficult to handle, where bottom-up input can't be accurately aligned, analyzed and reported via standardized EA discipline at the Agency level – for example in addressing the new (for FY13) Exhibit 53D "Agency IT Reductions and Reinvestments" and the information required for "Cloud Computing Alternatives Evaluation" (supporting the new Exhibit 53C, "Agency Cloud Computing Portfolio"). Therefore, EA must be "sold" directly to the communities that matter, from a coordinated, proactive messaging perspective that takes BOTH the Program-level value drivers AND the broader Agency mission and IT maturity context into consideration. Selling EA means persuading others to take additional time and possibly assign additional resources, for a mix of direct and indirect benefits – many of which aren't likely to be realized in the short-term. This means there's probably little current, allocated budget to work with; ergo the challenge of trying to sell an "unfunded mandate". Also, the concept of "Enterprise" in large Departments like Homeland Security tends to cross all kinds of organizational boundaries – as Richard Spires recently indicated by commenting that "...organizational boundaries still trump functional similarities. Most people understand what we're trying to do internally, and at a high level they get it. The problem, of course, is when you get down to them and their system and the fact that you're going to be touching them...there's always that fear factor," Spires said. It is quite clear to the Federal IT Investment community that for EA to meet its objective, understandable, relevant value must be measured and reported using a repeatable method – as described by GAO's recent report "Enterprise Architecture Value Needs To Be Measured and Reported". What's not clear is the method or guidance to sell this value. In fact, the current GAO "Framework for Assessing and Improving Enterprise Architecture Management (Version 2.0)", a.k.a. the "EAMMF", does not include words like "sell", "persuade", "market", etc., except in reference ("within Core Element 19: Organization business owner and CXO representatives are actively engaged in architecture development") to a brief section in the CIO Council's 2001 "Practical Guide to Federal Enterprise Architecture", entitled "3.3.1. Develop an EA Marketing Strategy and Communications Plan." Furthermore, Core Element 19 of the EAMMF is advised to be applied in "Stage 3: Developing Initial EA Versions". This kind of EA sales campaign truly should start much earlier in the maturity progress, i.e. in Stages 0 or 1. So, what are the understandable, relevant benefits (or value) to sell, that can find an agreeable, participatory audience, and can pave the way towards success of a longer-term, funded set of EA mechanisms that can be methodically measured and reported? Pragmatic benefits from a useful EA that can help overcome the fear of change? And how should they be sold? Following is a brief taxonomy (it's a taxonomy, to help organize SME support) of benefit-related subjects that might make the most sense, in creating the messages and organizing an initial "engagement plan" for evangelizing EA "from within". An EA "Sales Taxonomy" of sorts. We're not boiling the ocean here; the subjects that are included are ones that currently appear to be urgently relevant to the current Federal IT Investment landscape. Note that successful dialogue in these topics is directly usable as input or guidance for actually developing early-stage, "Fit-for-Purpose" (a DoDAF term) Enterprise Architecture artifacts, as prescribed by common methods found in most EA methodologies, including FEAF, TOGAF, DoDAF and our own Oracle Enterprise Architecture Framework (OEAF). The taxonomy below is organized by (1) Target Community, (2) Benefit or Value, and (3) EA Program Facet - as in: "Let's talk to (1: Community Member) about how and why (3: EA Facet) the EA program can help with (2: Benefit/Value)". Once the initial discussion targets and subjects are approved (that can be measured and reported), a "marketing and communications plan" can be created. A working example follows the Taxonomy. Enterprise Architecture Sales Taxonomy Draft, Summary Version 1. Community 1.1. Budgeted Programs or Portfolios Communities of Purpose (CoPR) 1.1.1. Program/System Owners (Senior Execs) Creating or Executing Acquisition Plans 1.1.2. Program/System Owners Facing Strategic Change 1.1.2.1. Mandated 1.1.2.2. Expected/Anticipated 1.1.3. Program Managers - Creating Employee Performance Plans 1.1.4. CO/COTRs – Creating Contractor Performance Plans, or evaluating Value Engineering Change Proposals (VECP) 1.2. Governance & Communications Communities of Practice (CoP) 1.2.1. Policy Owners 1.2.1.1. OCFO 1.2.1.1.1. Budget/Procurement Office 1.2.1.1.2. Strategic Planning 1.2.1.2. OCIO 1.2.1.2.1. IT Management 1.2.1.2.2. IT Operations 1.2.1.2.3. Information Assurance (Cyber Security) 1.2.1.2.4. IT Innovation 1.2.1.3. Information-Sharing/ Process Collaboration (i.e. policies and procedures regarding Partners, Agreements) 1.2.2. Governing IT Council/SME Peers (i.e. an "Architects Council") 1.2.2.1. Enterprise Architects (assumes others exist; also assumes EA participants aren't buried solely within the CIO shop) 1.2.2.2. Domain, Enclave, Segment Architects – i.e. the right affinity group for a "shared services" EA structure (per the EAMMF), which may be classified as Federated, Segmented, Service-Oriented, or Extended 1.2.2.3. External Oversight/Constraints 1.2.2.3.1. GAO/OIG & Legal 1.2.2.3.2. Industry Standards 1.2.2.3.3. Official public notification, response 1.2.3. Mission Constituents Participant & Analyst Community of Interest (CoI) 1.2.3.1. Mission Operators/Users 1.2.3.2. Public Constituents 1.2.3.3. Industry Advisory Groups, Stakeholders 1.2.3.4. Media 2. Benefit/Value (Note the actual benefits may not be discretely attributable to EA alone; EA is a very collaborative, cross-cutting discipline.) 2.1. Program Costs – EA enables sound decisions regarding... 2.1.1. Cost Avoidance – a TCO theme 2.1.2. Sequencing – alignment of capability delivery 2.1.3. Budget Instability – a Federal reality 2.2. Investment Capital – EA illuminates new investment resources via... 2.2.1. Value Engineering – contractor-driven cost savings on existing budgets, direct or collateral 2.2.2. Reuse – reuse of investments between programs can result in savings, chargeback models; avoiding duplication 2.2.3. License Refactoring – IT license & support models may not reflect actual or intended usage 2.3. Contextual Knowledge – EA enables informed decisions by revealing... 2.3.1. Common Operating Picture (COP) – i.e. cross-program impacts and synergy, relative to context 2.3.2. Expertise & Skill – who truly should be involved in architectural decisions, both business and IT 2.3.3. Influence – the impact of politics and relationships can be examined 2.3.4. Disruptive Technologies – new technologies may reduce costs or mitigate risk in unanticipated ways 2.3.5. What-If Scenarios – can become much more refined, current, verifiable; basis for Target Architectures 2.4. Mission Performance – EA enables beneficial decision results regarding... 2.4.1. IT Performance and Optimization – towards 100% effective, available resource utilization 2.4.2. IT Stability – towards 100%, real-time uptime 2.4.3. Agility – responding to rapid changes in mission 2.4.4. Outcomes –measures of mission success, KPIs – vs. only "Outputs" 2.4.5. Constraints – appropriate response to constraints 2.4.6. Personnel Performance – better line-of-sight through performance plans to mission outcome 2.5. Mission Risk Mitigation – EA mitigates decision risks in terms of... 2.5.1. Compliance – all the right boxes are checked 2.5.2. Dependencies –cross-agency, segment, government 2.5.3. Transparency – risks, impact and resource utilization are illuminated quickly, comprehensively 2.5.4. Threats and Vulnerabilities – current, realistic awareness and profiles 2.5.5. Consequences – realization of risk can be mapped as a series of consequences, from earlier decisions or new decisions required for current issues 2.5.5.1. Unanticipated – illuminating signals of future or non-symmetric risk; helping to "future-proof" 2.5.5.2. Anticipated – discovering the level of impact that matters 3. EA Program Facet (What parts of the EA can and should be communicated, using business or mission terms?) 3.1. Architecture Models – the visual tools to be created and used 3.1.1. Operating Architecture – the Business Operating Model/Architecture elements of the EA truly drive all other elements, plus expose communication channels 3.1.2. Use Of – how can the EA models be used, and how are they populated, from a reasonable, pragmatic yet compliant perspective? What are the core/minimal models required? What's the relationship of these models, with existing system models? 3.1.3. Scope – what level of granularity within the models, and what level of abstraction across the models, is likely to be most effective and useful? 3.2. Traceability – the maturity, status, completeness of the tools 3.2.1. Status – what in fact is the degree of maturity across the integrated EA model and other relevant governance models, and who may already be benefiting from it? 3.2.2. Visibility – how does the EA visibly and effectively prove IT investment performance goals are being reached, with positive mission outcome? 3.3. Governance – what's the interaction, participation method; how are the tools used? 3.3.1. Contributions – how is the EA program informed, accept submissions, collect data? Who are the experts? 3.3.2. Review – how is the EA validated, against what criteria?  Taxonomy Usage Example:   1. To speak with: a. ...a particular set of System Owners Facing Strategic Change, via mandate (like the "Cloud First" mandate); about... b. ...how the EA program's visible and easily accessible Infrastructure Reference Model (i.e. "IRM" or "TRM"), if updated more completely with current system data, can... c. ...help shed light on ways to mitigate risks and avoid future costs associated with NOT leveraging potentially-available shared services across the enterprise... 2. ....the following Marketing & Communications (Sales) Plan can be constructed: a. Create an easy-to-read "Consequence Model" that illustrates how adoption of a cloud capability (like elastic operational storage) can enable rapid and durable compliance with the mandate – using EA traceability. Traceability might be from the IRM to the ARM (that identifies reusable services invoking the elastic storage), and then to the PRM with performance measures (such as % utilization of purchased storage allocation) included in the OMB Exhibits; and b. Schedule a meeting with the Program Owners, timed during their Acquisition Strategy meetings in response to the mandate, to use the "Consequence Model" for advising them to organize a rapid and relevant RFI solicitation for this cloud capability (regarding alternatives for sourcing elastic operational storage); and c. Schedule a series of short "Discovery" meetings with the system architecture leads (as agreed by the Program Owners), to further populate/validate the "As-Is" models and frame the "To Be" models (via scenarios), to better inform the RFI, obtain the best feedback from the vendor community, and provide potential value for and avoid impact to all other programs and systems. --end example -- Note that communications with the intended audience should take a page out of the standard "Search Engine Optimization" (SEO) playbook, using keywords and phrases relating to "value" and "outcome" vs. "compliance" and "output". Searches in email boxes, internal and external search engines for phrases like "cost avoidance strategies", "mission performance metrics" and "innovation funding" should yield messages and content from the EA team. This targeted, informed, practical sales approach should result in additional buy-in and participation, additional EA information contribution and model validation, development of more SMEs and quick "proof points" (with real-life testing) to bolster the case for EA. The proof point here is a successful, timely procurement that satisfies not only the external mandate and external oversight review, but also meets internal EA compliance/conformance goals and therefore is more transparently useful across the community. In short, if sold effectively, the EA will perform and be recognized. EA won’t therefore be used only for compliance, but also (according to a validated, stated purpose) to directly influence decisions and outcomes. The opinions, views and analysis expressed in this document are those of the author and do not necessarily reflect the views of Oracle.

    Read the article

  • Improving RDP performance

    - by blade
    Hi, How can I improve RDP performance? I'm on an 8mb line, and I have disabled all the fancy features like visual styles. One page said if I set a low speed, that too will increase performance. Is there any proof in this? Also, there was an ad here about an application/technology which can increase RDP performance by x20. Has anyone used this? Thanks

    Read the article

  • Protect Gnome Screen Saver Settings

    - by Jared Brown
    By default in Gnome standard users can access their screensaver preferences and change settings such as the idle time and whether or not it locks the screen. I desire to set the screensaver settings as the root user for each user and only allow the root user to adjust them. What is the best (read: simplest + fool proof) way to accomplish this?

    Read the article

  • Microsoft PKI or PKI Vendor ?

    - by abmv
    I have a question related to PKI Infrastructure , should an organization go with Microsoft PKI or an independent separate PKI Infrastructure ? Is there any licensing restrictions if I user Microsoft PKI Infrastructure ? Or should I get an independent PKI infrastructure from a vendor that offer PKI TSA and SP(Signature Proof) Infrastructure.

    Read the article

  • Recover an HP recovery partition from an offline drive

    - by eric.chartier
    I have a (semi)-dead hard drive with an HP recovery partition on it. My goal is to 1-Buy a new hard drive (checked) 2-Copy the recovery partition to a drive ( dd if=/dev/sdb1 of=~/recovery.bak ) 3-Make a new partition of 12000 mb with Windows 7 4-Copy back recovery partition to the new drive ( dd if=~/recovery.bak of=/dev/sdb1 ) Then press F11 when the laptop boots however it does NOT work. Any idea why? It seemed quite fool proof...

    Read the article

  • Rsync over ssh: "ERROR: module is read only" suddenly appeared

    - by user978548
    I've used from some time rsync/ssh to backup my shared host contents to my personal Synology NAS (212j for that matter), and it worked quite well. For information, I use a password-less ssh connection. 3 days ago, I updated my NAS software and since (or at least I believe it's since that), the backup won't work anymore. I get the following error on the host: rsync: writefd_unbuffered failed to write 4 bytes to socket [sender]: Broken pipe (32) ERROR: module is read only ..which I do not understand. beside that nothing changed that I know of in both source and destination that can be related to rsync or ssh, I did check a few things and all seems to be alright: I can still connect through ssh from the host to my NAS with the good user, so ssh stuff like keys haven't changed. I also have the correct file permissions on the NAS (I checked, and also tried to create files, directories, .. with the user used by rsync through ssh). I read here and there that the error means that I have to ensure that my rsyncd.conf have the right read only = no in it, but as far as I know, I never used rsyncd as well as I never configured anything for it and until now it worked like a charm.. I use the following command to do the backup: rsync -ab --recursive \ --files-from="$FILES_FROM" \ --backup-dir=backup_$SUFFIX \ --delete \ --filter='protect backup_*' \ $WDIRECTORY/ \ remote_backup:$REMOTE_BACKUP/ So I'm stuck and really can't figure out what happened. Edit: As suggested in comments, I also tried passing commands to ssh (but not from inside a ssh session), that worked as expected, and also tried a single rsync command, which didnt worked, failing just like the complete backup command. (sharedHost):hostuser:~ > touch test.txt (sharedHost):hostuser:~ > rsync test.txt remote_backup:backups/test.txt ERROR: module is read only rsync error: syntax or usage error (code 1) at main.c(1034) [Receiver=3.0.8] rsync: connection unexpectedly closed (9 bytes received so far) [sender] rsync error: error in rsync protocol data stream (code 12) at io.c(601) [sender=3.0.7] and (sharedHost):hostuser:~ > ssh remote_backup 'touch /abs_path_to_backups/backups/test2.txt && echo "ProoF" > /abs_path_to_backups/backups/test2.txt' (sharedHost):hostuser:~ > ssh remote_backup 'cat /abs_path_to_backups/backups/test2.txt' ProoF

    Read the article

  • Android emulator and arduino mega 2560

    - by linuxuser
    I do not have a Android phone yet. But i wanted to do proof of concept making arduino board + USB host shield work with Android emulator. Problem is pc takes only USB-A, so I decided to use USB - serial - serial USB and connect between Arduino USB shield and PC (Andoid emulator). Everything is set up including ADK, DemoKit Java application, firmware for Arduino. However, Demokit does not recognize as the device connected. So is there any workaround to this?

    Read the article

  • Difference between indoor and outdoor WiFi Access Points

    - by aaron-cook
    Does anyone know if there is an operational difference between what is classified as an 'indoor' wifi access point and an 'outdoor' wifi access point. I'm speaking specifically to its operation rather than things like whether its enclosure is weather proof or not. And I'm also referring to the access point itself as opposed to the antenna used.

    Read the article

  • Adding autocomplete options to auctex C-c C-e?

    - by Seamus
    When I'm using auctex with emacs to write LaTeX documents, I would like to be able to add a couple more options to the list of environment types that auctex "recognises" and can autocomplete, namely Theorem, Lemma, Proof, itemize* and a couple of others. Which variable to I need to edit? I have played around in customize-apropos LaTeX and auctex, but I haven't found it. (lisp code snippet to add to my .emacs would be preferred, I don't quite understand the syntax yete)

    Read the article

  • Which motherboards support ECC RAM and USB 3.0?

    - by dandv
    I'm gathering specs to build a highly reliable file server, somewhat future proof for the next 3-5 years. The component I'm starting with is the motherboard. Are there motherboards that have been shown to support ECC RAM (and which particular models?) and also USB 3.0? I've read that there are such chipsets with ECC support, but motherboard manufacturers won't guarantee they work, or won't even offer the required BIOS options.

    Read the article

  • How to install couchdb on mac osx 10.6

    - by Adam
    I'm trying to install CouchDB on my mac, running snow leopard 10.6. I installed Xcode, MacPorts, and then followed the instructions here: http://wiki.apache.org/couchdb/Installing_on_OSX It all worked fine until I tried to visit the web interface: http://127.0.0.1:5984/_utils/index.html Google chrome said "Oops! Google Chrome could not connect to 127.0.0.1:5984" I tried connecting using telnet in bash and it said connection refused. Can somebody shed some light with some suggestions or perhaps and idiot-proof walkthrough?

    Read the article

  • What's the max Windows 7 access possible to restrict tampering with single service?

    - by Crawford Comeaux
    I'm developing an ADHD management system for myself. Without going into detail (and as silly as it may sound for a grown man to need something like this), I need to build a me-proof service to run on my Windows 7 Ultra laptop. I still need fairly complete access to the system, though. How can I set things up so that I'm unable to "easily" (ie. within 3-5 mins without rebooting) stop the service or prevent it from running?

    Read the article

  • How would I template an SLS using saltstack

    - by user180041
    I'm trying to do proof of concept with Mongodb(sharding) and Id like to run a command every time I spin up a new cluster without having to add lines in all my sls files. My current init is as follows: mongo Replica4:27000 /usr/lib/mongo/init_addshard.js: cmd: - run - user: present The word Replica4 is not templated id like to know a way I would be able to do so, that way when I spin up a new cluster I wouldn't have to touch anything in this file.

    Read the article

< Previous Page | 13 14 15 16 17 18 19 20 21 22 23 24  | Next Page >