Search Results

Search found 11532 results on 462 pages for 'word break'.

Page 174/462 | < Previous Page | 170 171 172 173 174 175 176 177 178 179 180 181  | Next Page >

  • Sliding & hiding multiple panels in jQuery.

    - by lloydphillips
    I have a table with multiple rows in each row is a select list and based on the selection (when the onchange event is fired) panels appear containing additional data below the row.I currently have code like this: var allPnls = '.inv-dtl-comnts-add,.inv-dtl-comnts-update'; $(document).ready(function(){ hideAll(); //select action change $(".inv-dtl-ddlaction").change(onSelectChange); $(".btn-cancel").click(function(event){ slideAll(); $(".inv-dtl-ddlaction").val('[Select an Action]'); return false; }); }); function onSelectChange(event){ //find out which select item was clicked switch($(this).val()) { case 'View/Add Comment': $(this).closest(".row").children(allPnls).slideUp("fast", function(){ $(this).closest(".row").children(".inv-dtl-comnts-add").slideToggle("fast"); }); break; case 'Change Status': $(this).closest(".row").children(allPnls).slideUp("fast", function(){ $(this).closest(".row").children(".inv-dtl-comnts-update").slideToggle("fast"); }); break; default: //code to be executed if n is different from case 1 and 2 } } function hideAll(){ $(allPnls).hide(); } function slideAll(){ $(allPnls).slideUp("fast"); } So I'm hiding all the panels when the page loads and if a panel is already open I want to slide it shut before reopening the new panel. This works with the postback. With just one panel in the selection it worked great but with two panels the sliding up happens twice (it seems to slide down unopened panels before sliding them back up again). How can I adjust this so that I can get all panels listed in the variable allPnls to slide shut ONLY if they are already open? Is there a better way of sliding the panels shut and then having a callback to have the slideToggle work? Lloyd

    Read the article

  • How can a link within a WebView load another layout using javascript?

    - by huffmaster
    So I have 2 layout files (main.xml, featured.xml) and both each have a single WebView. When the application starts "main.xml" loads a html file into it's WebView. In this html file I have a link that calls javascript that runs code in the Activity that loaded the html. Once back in this Activity code though I try running setContentView(R.layout.featured) but it just bombs out on me. If I debug it just dies without any real error and if I run it the application just Force closes. Am I going about this correctly or should I be doing something differently? final private int MAIN = 1; final private int FEATURED = 2; /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); webview = (WebView) findViewById(R.id.wvMain); webview.getSettings().setJavaScriptEnabled(true); webview.getSettings().setSupportZoom(false); webview.addJavascriptInterface(new EHJavaScriptInterface(), "eh"); webview.loadUrl("file:///android_asset/default.html"); } final class EHJavaScriptInterface { EHJavaScriptInterface() { } public void loadLayout(final String lo) { int i = Integer.parseInt(lo.trim()); switch (i) { /****** THIS IS WHERE I'M BOMBING OUT *********/ case FEATURED: setContentView(R.layout.featured);break; case MAIN: setContentView(R.layout.main);break; } } }

    Read the article

  • [Delphi] How would you refactor this code?

    - by Al C
    This hypothetical example illustrates several problems I can't seem to get past, even though I keep trying!! ... Suppose the original code is a long event handler, coded in the UI, triggered when a user clicks a cell in a grid. Expressed as pseudocode it's: if Condition1=true then begin //loop through every cell in row, //if aCell/headerCellValue>1 then //color aCell red end else if Condition2=true then begin //do some other calculation adding cell and headerCell values, and //if some other product>2 then //color the whole row green end else show an error message I look at this and say "Ah, refactor to the strategy pattern! The code will be easier to understand, easier to debug, and easier to later extend!" I get that. And I can easily break the code into multiple procedures. The problem is ultimately scope related. Assume the pseudocode makes extensive use of grid properties, values displayed in cells, maybe even built-in grid methods. How do you move all that to another unit, without referencing the grid component in the UI--which would break all the "rules" about loose coupling that make OOP valuable? ... I'm really looking forward to responses. Thanks, as always -- Al C.

    Read the article

  • Regex to check if exact string exists

    - by Jayrox
    I am looking for a way to check if an exact string match exists in another string using Regex or any better method suggested. I understand that you tell regex to match a space or any other non-word character at the beginning or end of a string. However, I don't know exactly how to set it up. Search String: t String 1: Hello World, Nice to see you! t String 2: Hello World, Nice to see you! String 3: T Hello World, Nice to see you! I would like to use the search string and compare it to String 1, String 2 and String 3 and only get a positive match from String 1 and String 3 but not from String 2. Requirements: Search String may be at any character position in the Subject. There may or may not be a white-space character before or after it. I do not want it to match if it is part of another string; such as part of a word. For the sake of this question: I think I would do this using this pattern: /\bt\b/gi /\b{$search_string}\b/gi Does this look right? Can it be made better? Any situations where this pattern wouldn't work? Additional info: this will be used in PHP 5

    Read the article

  • Generate syntax tree for simple math operations

    - by M28
    I am trying to generate a syntax tree, for a given string with simple math operators (+, -, *, /, and parenthesis). Given the string "1 + 2 * 3": It should return an array like this: ["+", [1, ["*", [2,3] ] ] ] I made a function to transform "1 + 2 * 3" in [1,"+",2,"*",3]. The problem is: I have no idea to give priority to certain operations. My code is: function isNumber(ch){ switch (ch) { case '0': case '1': case '2': case '3': case '4': case '5': case '6': case '7': case '8': case '9': case '.': return true; break; default: return false; break; } } function generateSyntaxTree(text){ if (typeof text != 'string') return []; var code = text.replace(new RegExp("[ \t\r\n\v\f]", "gm"), ""); var codeArray = []; var syntaxTree = []; // Put it in its on scope (function(){ var lastPos = 0; var wasNum = false; for (var i = 0; i < code.length; i++) { var cChar = code[i]; if (isNumber(cChar)) { if (!wasNum) { if (i != 0) { codeArray.push(code.slice(lastPos, i)); } lastPos = i; wasNum = true; } } else { if (wasNum) { var n = Number(code.slice(lastPos, i)); if (isNaN(n)) { throw new Error("Invalid Number"); return []; } else { codeArray.push(n); } wasNum = false; lastPos = i; } } } if (wasNum) { var n = Number(code.slice(lastPos, code.length)); if (isNaN(n)) { throw new Error("Invalid Number"); return []; } else { codeArray.push(n); } } })(); // At this moment, codeArray = [1,"+",2,"*",3] return syntaxTree; } alert('Returned: ' + generateSyntaxTree("1 + 2 * 3"));

    Read the article

  • issue to solve the geo tagging in android

    - by sundar
    I am a new guy in Android. How to implement the Geo-tag for images? I have tried by myself but not getting expected result. My code is like: @Override protected Dialog onCreateDialog(int id) { jpgDialog = null;; switch(id){ case ID_JPGDIALOG: Context mContext = this; jpgDialog = new Dialog(mContext); jpgDialog.setContentView(R.layout.jpgdialog); exifText = (TextView) jpgDialog.findViewById(R.id.text); geoText = (TextView)jpgDialog.findViewById(R.id.geotext); bmImage = (ImageView)jpgDialog.findViewById(R.id.image); bmOptions = new BitmapFactory.Options(); bmOptions.inSampleSize = 2; Button okDialogButton = (Button)jpgDialog.findViewById(R.id.okdialogbutton); okDialogButton.setOnClickListener(okDialogButtonOnClickListener); mapviewButton = (Button)jpgDialog.findViewById(R.id.mapviewbutton); mapviewButton.setOnClickListener(mapviewButtonOnClickListener); break; default: break; } return jpgDialog; } Please help me how to proceed?

    Read the article

  • Counting problem C#

    - by MadBoy
    Hello, I've a bit of a problem. I'm adding numbers to ArrayList like 156, 340 (when it is TransferIn or Buy) etc and then i remove them doing it like 156, 340 (when it's TransferOut, Sell). Following solution works for that without a problem. The problem I have is that for some old data employees were entering sum's like 1500 instead of 500+400+100+500. How would I change it so that when there's Sell/TransferOut and there's no match inside ArrayList it should try to add multiple items from that ArrayList and find elements that combine into aggregate. ArrayList alNew = new ArrayList(); ArrayList alNewPoIle = new ArrayList(); ArrayList alNewCo = new ArrayList(); string tempAkcjeCzynnosc = (string) alInstrumentCzynnoscBezNumerow[i]; string tempAkcjeInId = (string) alInstrumentNazwaBezNumerow[i]; decimal varAkcjeCena = (decimal) alInstrumentCenaBezNumerow[i]; decimal varAkcjeIlosc = (decimal) alInstrumentIloscBezNumerow[i]; int index; switch (tempAkcjeCzynnosc) { case "Sell": case "TransferOut": index = alNew.IndexOf(varAkcjeIlosc); if (index != -1) { alNew.RemoveAt(index); alNewPoIle.RemoveAt(index); alNewCo.RemoveAt(index); } else { // Number without match encountred } break; case "Buy": case "TransferIn": alNew.Add(varAkcjeIlosc); alNewPoIle.Add(varAkcjeCena); alNewCo.Add(tempAkcjeInId); break; } }

    Read the article

  • Need help implementing this algorithm with map Hadoop MapReduce

    - by Julia
    Hi all! i have algorithm that will go through a large data set read some text files and search for specific terms in those lines. I have it implemented in Java, but I didnt want to post code so that it doesnt look i am searching for someone to implement it for me, but it is true i really need a lot of help!!! This was not planned for my project, but data set turned out to be huge, so teacher told me I have to do it like this. EDIT(i did not clarified i previos version)The data set I have is on a Hadoop cluster, and I should make its MapReduce implementation I was reading about MapReduce and thaught that i first do the standard implementation and then it will be more/less easier to do it with mapreduce. But didnt happen, since algorithm is quite stupid and nothing special, and map reduce...i cant wrap my mind around it. So here is shortly pseudo code of my algorithm LIST termList (there is method that creates this list from lucene index) FOLDER topFolder INPUT topFolder IF it is folder and not empty list files (there are 30 sub folders inside) FOR EACH sub folder GET file "CheckedFile.txt" analyze(CheckedFile) ENDFOR END IF Method ANALYZE(CheckedFile) read CheckedFile WHILE CheckedFile has next line GET line FOR(loops through termList) GET third word from line IF third word = term from list append whole line to string buffer ENDIF ENDFOR END WHILE OUTPUT string buffer to file Also, as you can see, each time when "analyze" is called, new file has to be created, i understood that map reduce is difficult to write to many outputs??? I understand mapreduce intuition, and my example seems perfectly suited for mapreduce, but when it comes to do this, obviously I do not know enough and i am STUCK! Please please help.

    Read the article

  • Why do InterruptedExceptions clear a thread's interrupted status?

    - by Hanno Fietz
    If a thread is interrupted while inside Object.wait() or Thread.join(), it throws an InterruptedException, which resets the thread's interrupted status. I. e., if I have a loop like this inside a Runnable.run(): while (!this._workerThread.isInterrupted()) { // do something try { synchronized (this) { this.wait(this._waitPeriod); } } catch (InterruptedException e) { if (!this._isStopping()) { this._handleFault(e); } } } the thread will continue to run after calling interrupt(). This means I have to explicitly break out of the loop by checking for my own stop flag in the loop condition, rethrow the exception, or add a break. Now, this is not exactly a problem, since this behaviour is well documented and doesn't prevent me from doing anything the way I want. However, I don't seem to understand the concept behind it: Why is a thread not considered interrupted anymore once the exception has been thrown? A similar behaviour also occurs if you get the interrupted status with interrupted() instead of isInterrupted(), then, too, the thread will only appear interrupted once. Am I doing something unusual here? For example, is it more common to catch the InterruptedException outside the loop? (Even though I'm not exactly a beginner, I tagged this "beginner", because it seems like a very basic question to me, looking at it.)

    Read the article

  • pure/const functions in C++

    - by Albert
    Hi, I'm thinking of using pure/const functions more heavily in my C++ code. (pure/const attribute in GCC) However, I am curious how strict I should be about it and what could possibly break. The most obvious case are debug outputs (in whatever form, could be on cout, in some file or in some custom debug class). I probably will have a lot of functions, which don't have any side effects despite this sort of debug output. No matter if the debug output is made or not, this will absolutely have no effect on the rest of my application. Or another case I'm thinking of is the use of my own SmartPointer class. In debug mode, my SmartPointer class has some global register where it does some extra checks. If I use such an object in a pure/const function, it does have some slight side effects (in the sense that some memory probably will be different) which should not have any real side effects though (in the sense that the behaviour is in any way different). Similar also for mutexes and other stuff. I can think of many complex cases where it has some side effects (in the sense of that some memory will be different, maybe even some threads are created, some filesystem manipulation is made, etc) but has no computational difference (all those side effects could very well be left out and I would even prefer that). How does it work out in practice? If I mark such functions as pure/const, could it break anything (considering that the code is all correct)?

    Read the article

  • Contingent Header Category Label

    - by poindexter
    Right now the header has a bit of code in it that queries the section name and then uses that section name as the h1 title in the page. It works fine. However, I want to selectively break that operation in certain categories and give myself the ability to manually enter the h1 title for a given section. Here's what I'm struggling with: how can I maintain the automatic query and title selection in most instances, but selectively break it in a given category (the 'blog' category, for starters)? Thanks for taking a look, I appreciate your help! Here's the code that drives the existing function (it's the get_the_section_name part): <?php if(!is_home()){?> <div class="section <?php echo get_the_section_name();?>"> <?php $sectitle = get_the_section_name(); $sectitle = str_ireplace("-"," ",$sectitle); echo '<h1>' . $sectitle . '</h1>';?> <p class="breadcrumbs"> <?php if(function_exists('bcn_display')) { bcn_display(); } ?> </p> </div> <div class="columns"> <?php } ?> Here's a page that shows what it looks like displayed (see the title in the blue graphic underneath the main nav near the top of the page): http://69.20.59.228/category/blog/

    Read the article

  • Why notify listeners in a content provider query method?

    - by cbrulak
    Vegeolla has this blog post about content providers and the snippet below (at the bottom) with this line: cursor.setNotificationUri(getContext().getContentResolver(), uri); I'm curious as to why one would want to notify listeners about a query operation. Am I missing something? Thanks @Override public Cursor query(Uri uri, String[] projection, String selection, String[] selectionArgs, String sortOrder) { // Uisng SQLiteQueryBuilder instead of query() method SQLiteQueryBuilder queryBuilder = new SQLiteQueryBuilder(); // Check if the caller has requested a column which does not exists checkColumns(projection); // Set the table queryBuilder.setTables(TodoTable.TABLE_TODO); int uriType = sURIMatcher.match(uri); switch (uriType) { case TODOS: break; case TODO_ID: // Adding the ID to the original query queryBuilder.appendWhere(TodoTable.COLUMN_ID + "=" + uri.getLastPathSegment()); break; default: throw new IllegalArgumentException("Unknown URI: " + uri); } SQLiteDatabase db = database.getWritableDatabase(); Cursor cursor = queryBuilder.query(db, projection, selection, selectionArgs, null, null, sortOrder); // Make sure that potential listeners are getting notified cursor.setNotificationUri(getContext().getContentResolver(), uri); return cursor; }

    Read the article

  • How to write this function as a pL/pgSQl function ?

    - by morpheous
    I am trying to implement some business logic in a PL/pgSQL function. I have hacked together some pseudo code that explains the type of business logic I want to include in the function. Note: This function returns a table, so I can use it in a query like: SELECT A.col1, B.col1 FROM (SELECT * from some_table_returning_func(1, 1, 2, 3)) as A, tbl2 as B; The pseudocode of the pl/PgSQL function is below: CREATE FUNCTION some_table_returning_func(uid int, type_id int, filter_type_id int, filter_id int) RETURNS TABLE AS $$ DECLARE where_clause text := 'tbl1.id = ' + uid; ret TABLE; BEGIN switch (filter_type_id) { case 1: switch (filter_id) { case 1: where_clause += ' AND tbl1.item_id = tbl2.id AND tbl2.type_id = filter_id'; break; //other cases follow ... } break; //other cases follow ... } // where clause has been built, now run query based on the type ret = SELECT [COL1, ... COLN] WHERE where_clause; IF (type_id <> 1) THEN return ret; ELSE return select * from another_table_returning_func(ret,123); ENDIF; END; $$ LANGUAGE plpgsql; I have the following questions: How can I write the function correctly to (i.e. EXECUTE the query with the generated WHERE clause, and to return a table How can I write a PL/pgSQL function that accepts a table and an integer and returns a table (another_table_returning_func) ?

    Read the article

  • NSOperations or NSThread for bursts of smaller tasks that continuously cancel each other?

    - by RickiG
    Hi I would like to see if I can make a "search as you type" implementation, against a web service, that is optimized enough for it to run on an iPhone. The idea is that the user starts typing a word; "Foo", after each new letter I wait XXX ms. to see if they type another letter, if they don't, I call the web service using the word as a parameter. The web service call and the subsequent parsing of the result I would like to move to a different thread. I have written a simple SearchWebService class, it has only one public method: - (void) searchFor:(NSString*) str; This method tests if a search is already in progress (the user has had a XXX ms. delay in their typing) and subsequently stops that search and starts a new one. When a result is ready a delegate method is called: - (NSArray*) resultsReady; I can't figure out how to get this functionality 'threaded'. If I keep spawning new threads each time a user has a XXX ms. delay in the typing I end up in a bad spot with many threads, especially because I don't need any other search, but the last one. Instead of spawning threads continuously, I have tried keeping one thread running in the background all the time by: - (void) keepRunning { NSAutoreleasePool *pool = [[NSAutoreleasePool alloc] init]; SearchWebService *searchObj = [[SearchWebService alloc] init]; [[NSRunLoop currentRunLoop] run]; //keeps it alive [searchObj release]; [pool release]; } But I can't figure out how to access the "searchFor" method in the "searchObj" object, so the above code works and keeps running. I just can't message the searchObj or retrieve the resultReady objects? Hope someone could point me in the right direction, threading is giving me grief:) Thank you.

    Read the article

  • Number of simple mutations to change one string to another?

    - by mstksg
    Hi; I'm sure you've all heard of the "Word game", where you try to change one word to another by changing one letter at a time, and only going through valid English words. I'm trying to implement an A* Algorithm to solve it (just to flesh out my understanding of A*) and one of the things that is needed is a minimum-distance heuristic. That is, the minimum number of one of these three mutations that can turn an arbitrary string a into another string b: 1) Change one letter for another 2) Add one letter at a spot before or after any letter 3) Remove any letter Examples aabca => abaca: aabca abca abaca = 2 abcdebf => bgabf: abcdebf bcdebf bcdbf bgdbf bgabf = 4 I've tried many algorithms out; I can't seem to find one that gives the actual answer every time. In fact, sometimes I'm not sure if even my human reasoning is finding the best answer. Does anyone know any algorithm for such purpose? Or maybe can help me find one? Thanks.

    Read the article

  • Full-text search in C++

    - by Jen
    I have a database of many (though relatively short) HTML documents. I want users to be able to search this database by entering one or more search words in a C++ desktop application. Hence, I’m looking for a fast full-text search solution. Ideally, it should: Skip common words, such as the, of, and, etc. Support stemming, i.e. search for run also finds documents containing runner, running and ran. Be able to update its index in the background as new documents are added to the database. Be able to provide search word suggestions (like Google Suggest) To illustrate, assume the database has just two documents: Document 1: This is a test of text search. Document 2: Testing is fun. The following words should be in the index: fun, search, test, testing, text. If the user types t in the search box, I want the application to be able to suggest test, testing and text (Ideally, the application should be able to query the search engine for the 10 most common search words starting with t). A search for testing should return both documents. Can you suggest a C or C++ based solution? (I’ve briefly reviewed CLucene and Xapian, but I’m not sure if either will address my needs, especially querying the search word indexes for the suggest feature).

    Read the article

  • Anonymous comments not saved in Drupal

    - by Marco
    For some reason I can no longer post a comment as an Anonymous user in my Drupal installation. I haven't tried in a while, so I'm not quite sure when this functionality was broken. I have Services installed, and I can post anonymous comments using comment.save. I have altered the Input Formats if that could break something. I have enabled both post comments and access comments on the anonymous user. The comments does not show up in the database. In fact, the native Drupal function comment_save isn't called when I try to comment as Anonymous (I check this by adding print_r($edit);die(); at the top of the comment_save function in comment.module. Also I read something that not having a User with the UID 0 would break the Anonymous commenting, this user exists (obviously, since commenting through Services works) I have tried out the AntiSpam module, and posted a comment as Anonymous that would get caught(and did) in the spamfilter, but this module is now disabled. I'm really running out of ideas here, does anyone have any other suggestions on what to do? In the meanwhile I'm going to attempt to backtrack the code to figure out why comment_save() isn't being called. Edit: Anonymous users also don't have to submit email and such to post, if that matters in any way.

    Read the article

  • Creating reusable chunks of Linq to SQL

    - by tia
    Hi, I am trying to break up horrible linq to sql queries to make them a bit more readable. Say I want to return all orders for product which in the previous year had more than 100 orders. So, original query is: from o in _context.Orders where (from o1 in _context.Orders where o1.Year == o.Year - 1 && o1.Product == o.Product select o1).Count() > 100 select o; Messy. What I'd like to be able to do is to be able to break it down, eg: private IEnumerable<Order> LastSeasonOrders(Order order) { return (from o in _context.Orders where o.Year == order.Year - 1 && o.Product == order.Product select o); } which then lets me change the original query to: from o in _context.Orders where LastSeasonOrders(o).Count() > 100 select o; This doesn't seem to work, as I get method Blah has no supported translation to SQL when the query is run. Any quick tips on the correct way to achieve this?

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Trying to use jquery ui in google chrome extension in the content level

    - by user135697
    The problem is that the scope of the content script is on the web page that your plugin is suppose to be used at. So the css background:url(images/ui-bg_inset-hard_100_fcfdfd_1x100.png) becomes url('http://webpageforplugin/images/ui-bg_inset-hard_100_fcfdfd_1x100.png') in order for this to work as far as i understood i need to have it to point to: url('chrome-extension://extensionId/images/ui-bg_inset-hard_100_fcfdfd_1x100.png') So i tried to haxorz the document.styleSheets var ss = document.styleSheets; for (var i=0; i<ss.length; i++) { var found=-1, x,i; var rules = ss[i].cssRules || ss[i].rules; for (var j=0; j<rules.length; j++) { if ('.ui-helper-hidden'==rules[j].selectorText){ found=i; break; } } if (found>-1){ for (var j=0; j<rules.length; j++) { if (x=rules[j].style.background){ if ((i=x.indexOf('url'))!=-1) rules[j].style.background = x.replace('http://page/images/','chrome-extension://extensionId/images/'); } } break; } }; I feel that i'm missing the obvious. That there must be an easier way. Even if i manage to change this how will i get the extension id to build the string. Btw this doesn't work, the icons are not properly fetched. (I hardcoded the extension id) Any ideas?

    Read the article

  • dynamical binding or switch/case?

    - by kingkai
    A scene like this: I've different of objects do the similar operation as respective func() implements. There're 2 kinds of solution for func_manager() to call func() according to different objects Solution 1: Use virtual function character specified in c++. func_manager works differently accroding to different object point pass in. class Object{ virtual void func() = 0; } class Object_A : public Object{ void func() {}; } class Object_B : public Object{ void func() {}; } void func_manager(Object* a) { a->func(); } Solution 2: Use plain switch/case. func_manager works differently accroding to different type pass in typedef _type_t { TYPE_A, TYPE_B }type_t; void func_by_a() { // do as func() in Object_A } void func_by_b() { // do as func() in Object_A } void func_manager(type_t type) { switch(type){ case TYPE_A: func_by_a(); break; case TYPE_B: func_by_b(); default: break; } } My Question are 2: 1. at the view point of DESIGN PATTERN, which one is better? 2. at the view point of RUNTIME EFFCIENCE, which one is better? Especailly as the kinds of Object increases, may be up to 10-15 total, which one's overhead oversteps the other? I don't know how switch/case implements innerly, just a bunch of if/else? Thanks very much!

    Read the article

  • Operating on rows and then on columns of a matrix produces code duplication

    - by Chetan
    I have the following (Python) code to check if there are any rows or columns that contain the same value: # Test rows -> # Check each row for a win for i in range(self.height): # For each row ... firstValue = None # Initialize first value placeholder for j in range(self.width): # For each value in the row if (j == 0): # If it's the first value ... firstValue = b[i][j] # Remember it else: # Otherwise ... if b[i][j] != firstValue: # If this is not the same as the first value ... firstValue = None # Reset first value break # Stop checking this row, there's no win here if (firstValue != None): # If first value has been set # First value placeholder now holds the winning player's code return firstValue # Return it # Test columns -> # Check each column for a win for i in range(self.width): # For each column ... firstValue = None # Initialize first value placeholder for j in range(self.height): # For each value in the column if (j == 0): # If it's the first value ... firstValue = b[j][i] # Remember it else: # Otherwise ... if b[j][i] != firstValue: # If this is not the same as the first value ... firstValue = None # Reset first value break # Stop checking this column, there's no win here if (firstValue != None): # If first value has been set # First value placeholder now holds the winning player's code return firstValue # Return it Clearly, there is a lot of code duplication here. How do I refactor this code? Thanks!

    Read the article

  • Chrome extension sendRequest from async callback not working?

    - by Eugene
    Can't figure out what's wrong. onRequest not triggered on call from async callback method, the same request from content script works. The sample code below. background.js ============= ... makeAsyncRequest(); ... chrome.extension.onRequest.addListener(function(request, sender, sendResponse) { switch (request.id) { case "from_content_script": // This works console.log("from_content_script"); sendResponse({}); // clean up break; case "from_async": // Not working! console.log("from_async"); sendResponse({}); // clean up break; } }); methods.js ========== makeAsyncRequest = function() { ... var xhr = new XMLHttpRequest(); xhr.onreadystatechange = function() { if (xhr.readyState == 4) { ... // It works console.log("makeAsyncRequest callback"); chrome.extension.sendRequest({id: "from_async"}, function(response) { }); } } ... }; UPDATE: manifest configuration file. Don't no what's wrong here. { "name": "TestExt", "version": "0.0.1", "icons": { "48": "img/icon-48-green.gif" }, "description": "write it later", "background_page": "background.html", "options_page": "options.html", "browser_action": { "default_title": "TestExt", "default_icon": "img/icon-48-green.gif" }, "permissions": [ "tabs", "http://*/*", "https://*/*", "file://*/*", "webNavigation" ] }

    Read the article

  • how to store a file handle in perl class

    - by Haiyuan Zhang
    please look at the following code first. #! /usr/bin/perl package foo; sub new { my $pkg = shift; my $self = {}; my $self->{_fd} = undef; bless $self, $pkg; return $self; } sub Setfd { my $self = shift; my $fd = shift; $self_->{_fd} = $fd; } sub write { my $self = shift; print $self->{_fd} "hello word"; } my $foo = new foo; My intention is to store a file handle within a class using hash. the file handle is undefined at first, but can be initilized afterwards by calling Setfd function. then write can be called to actually write string "hello word" to a file indicated by the file handle, supposed that the file handle is the result of a success "write" open. but, perl compiler just complains that there are syntax error in the "print" line. can anyone of you tells me what's wrong here? thanks in advance.

    Read the article

  • Visual Studio 2008 Installer, Custom Action. Breakpoint not firing.

    - by Snake
    Hi, I've got an installer with a custom action project. I want the action to fire at install. The action fires, when I write something to the event log, it works perfectly. But I really need to debug the file since the action is quite complicated. So I've got the following installer class: namespace InstallerActions { using System; using System.Collections; using System.Collections.Generic; using System.ComponentModel; using System.Configuration.Install; using System.Diagnostics; using System.IO; [RunInstaller(true)] // ReSharper disable UnusedMember.Global public partial class DatabaseInstallerAction : Installer // ReSharper restore UnusedMember.Global { public DatabaseInstallerAction() { InitializeComponent(); } public override void Install(IDictionary stateSaver) { base.Install(stateSaver); System.Diagnostics.Debugger.Launch(); System.Diagnostics.Debugger.Break(); // none of these work Foo(); } private static void Foo() { } } } The installer just finalizes without warning me, it doesn't break, it doesn't ask me to attach a debugger. I've tried debug and release mode. Am I missing something? Thanks -Snake

    Read the article

< Previous Page | 170 171 172 173 174 175 176 177 178 179 180 181  | Next Page >