Search Results

Search found 17845 results on 714 pages for 'python social auth'.

Page 175/714 | < Previous Page | 171 172 173 174 175 176 177 178 179 180 181 182  | Next Page >

• supply inputs to python unittests

  - by zubin71

  I`m relatively new to the concept of unit-testing and have very little experience in the same. I have been looking at lots of articles on how to write unit-tests; however, I still have difficulty in writing tests where conditions like the following arise:- Test user Input. Test input read from a file. Test input read from an environment variable. Itd be great if someone could show me how to approach the above mentioned scenarios; itd still be awesome if you could point me to a few docs/articles/blog posts which I could read.

  Read the article

• Python - Subprocess Popen and Thread error

  - by n0idea

  In both functions record and ftp, i have subprocess.Popen if __name__ == '__main__': try: t1 = threading.Thread(target = record) t1.daemon = True t1.start() t2 = threading.Thread(target = ftp) t2.daemon = True t2.start() except (KeyboardInterrupt, SystemExit): sys.exit() The error I'm receiving is: Exception in thread Thread-1 (most likely raised during interpreter shutdown): Traceback (most recent call last): File "/usr/lib/python2.7/threading.py", line 551, in __bootstrap_inner File "/usr/lib/python2.7/threading.py", line 504, in run File "./in.py", line 20, in recordaudio File "/usr/lib/python2.7/subprocess.py", line 493, in call File "/usr/lib/python2.7/subprocess.py", line 679, in __init__ File "/usr/lib/python2.7/subprocess.py", line 1237, in _execute_child <type 'exceptions.AttributeError'>: 'NoneType' object has no attribute 'close' What might the issue be ?

  Read the article

• How to remove commas etc from a matrix in python

  - by robert

  say ive got a matrix that looks like: [[0, 0, 0, 0, 0], [0, 0, 0, 0, 0], [0, 0, 0, 0, 0]] how can i make it on seperate lines: [[0, 0, 0, 0, 0], [0, 0, 0, 0, 0], [0, 0, 0, 0, 0]] and then remove commas etc: 0 0 0 0 0 And also to make it blank instead of 0's, so that numbers can be put in later, so in the end it will be like: _ 1 2 _ 1 _ 1 (spaces not underscores) thanks

  Read the article

• Optimizing python link matching regular expression

  - by Matt

  I have a regular expression, links = re.compile('<a(.+?)href=(?:"|\')?((?:https?://|/)[^\'"]+)(?:"|\')?(.*?)>(.+?)</a>',re.I).findall(data) to find links in some html, it is taking a long time on certain html, any optimization advice? One that it chokes on is http://freeyourmindonline.net/Blog/

  Read the article

• Caching result of setUp() using Python unittest

  - by dbr

  I currently have a unittest.TestCase that looks like.. class test_appletrailer(unittest.TestCase): def setup(self): self.all_trailers = Trailers(res = "720", verbose = True) def test_has_trailers(self): self.failUnless(len(self.all_trailers) > 1) # ..more tests.. This works fine, but the Trailers() call takes about 2 seconds to run.. Given that setUp() is called before each test is run, the tests now take almost 10 seconds to run (with only 3 test functions) What is the correct way of caching the self.all_trailers variable between tests? Removing the setUp function, and doing.. class test_appletrailer(unittest.TestCase): all_trailers = Trailers(res = "720", verbose = True) ..works, but then it claims "Ran 3 tests in 0.000s" which is incorrect.. The only other way I could think of is to have a cache_trailers global variable (which works correctly, but is rather horrible): cache_trailers = None class test_appletrailer(unittest.TestCase): def setUp(self): global cache_trailers if cache_trailers is None: cache_trailers = self.all_trailers = all_trailers = Trailers(res = "720", verbose = True) else: self.all_trailers = cache_trailers

  Read the article

• Python unicode search not giving correct answer

  - by user1318912

  I am trying to search hindi words contained one line per file in file-1 and find them in lines in file-2. I have to print the line numbers with the number of words found. This is the code: import codecs hypernyms = codecs.open("hindi_hypernym.txt", "r", "utf-8").readlines() words = codecs.open("hypernyms_en2hi.txt", "r", "utf-8").readlines() count_arr = [] for counter, line in enumerate(hypernyms): count_arr.append(0) for word in words: if line.find(word) >=0: count_arr[counter] +=1 for iterator, count in enumerate(count_arr): if count>0: print iterator, ' ', count This is finding some words, but ignoring some others The input files are: File-1: ???? ??????? File-2: ???????, ????-???? ?????-???, ?????-???, ?????_???, ?????_??? ????_????, ????-????, ???????_???? ????-???? This gives output: 0 1 3 1 Clearly, it is ignoring ??????? and searching for ???? only. I have tried with other inputs as well. It only searches for one word. Any idea how to correct this?

  Read the article

• Convert hex to utf in Python

  - by user260223

  Hi.. I have a hex string and i want to convert it utf8 to insert mysql. (my database is utf8) hex_string = 'kitap ara\xfet\xfdrmas\xfd' .. .. .. result='kitap arastirmasi' How can i do that? Best regards.

  Read the article

• file output in python giving me garbage

  - by Richard

  When I write the following code I get garbage for an output. It is just a simple program to find prime numbers. It works when the first for loops range only goes up to 1000 but once the range becomes large the program fail's to output meaningful data output = open("output.dat", 'w') for i in range(2, 10000): prime = 1 for j in range(2, i-1): if i%j == 0: prime = 0 j = i-1 if prime == 1: output.write(str(i) + " " ) output.close() print "writing finished"

  Read the article

• Python module being reloaded for each request with django and mod_wsgi

  - by Vishal

  I have a variable in init of a module which get loaded from the database and takes about 15 seconds. For django development server everything is working fine but looks like with apache2 and mod_wsgi the module is loaded with every request (taking 15 seconds). Any idea about this behavior? Update: I have enabled daemon mode in mod wsgi, looks like its not reloading the modules now! needs more testing and I will update.

  Read the article

• Extra characters Extracted with XPath and Python (html)

  - by Nacari

  I have been using XPath with scrapy to extract text from html tags online, but when I do I get extra characters attached. An example is trying to extract a number, like "204" from a <td> tag and getting [u'204']. In some cases its much worse. For instance trying to extract "1 - Mathoverflow" and instead getting [u'\r\n\t\t 1 \u2013 MathOverflow\r\n\t\t ']. Is there a way to prevent this, or trim the strings so that the extra characters arent a part of the string? (using items to store the data). It looks like it has something to do with formatting, so how do I get xpath to not pick up that stuff?

  Read the article

• strip spaces in python.

  - by Richard

  ok I know that this should be simple... anyways say: line = "$W5M5A,100527,142500,730301c44892fd1c,2,686.5 4,333.96,0,0,28.6,123,75,-0.4,1.4*49" I want to strip out the spaces. I thought you would just do this line = line.strip() but now line is still '$W5M5A,100527,142500,730301c44892fd1c,2,686.5 4,333.96,0,0,28.6,123,75,-0.4,1.4*49' instead of '$W5M5A,100527,142500,730301c44892fd1c,2,686.54,333.96,0,0,28.6,123,75,-0.4,1.4*49' any thoughts?

  Read the article

• How to change the stdin encoding on python

  - by user210481

  Hi, I'm using windows and linux machines for the same project. The default encoding for stdin on windows is cp1252 and on linux is utf-8. I would like to change everything to uft-8. Is it possible? How can I do it? Thanks Eduardo

  Read the article

• Python/YACC Lexer: Token priority?

  - by Rosarch

  I'm trying to use reserved words in my grammar: reserved = { 'if' : 'IF', 'then' : 'THEN', 'else' : 'ELSE', 'while' : 'WHILE', } tokens = [ 'DEPT_CODE', 'COURSE_NUMBER', 'OR_CONJ', 'ID', ] + list(reserved.values()) t_DEPT_CODE = r'[A-Z]{2,}' t_COURSE_NUMBER = r'[0-9]{4}' t_OR_CONJ = r'or' t_ignore = ' \t' def t_ID(t): r'[a-zA-Z_][a-zA-Z_0-9]*' if t.value in reserved.values(): t.type = reserved[t.value] return t return None However, the t_ID rule somehow swallows up DEPT_CODE and OR_CONJ. How can I get around this? I'd like those two to take higher precedence than the reserved words.

  Read the article

• Restart logging to a new file (Python)

  - by compie

  I'm using the following code to initialize logging in my application. logger = logging.getLogger() logger.setLevel(logging.DEBUG) # log to a file directory = '/reserved/DYPE/logfiles' now = datetime.now().strftime("%Y%m%d_%H%M%S") filename = os.path.join(directory, 'dype_%s.log' % now) file_handler = logging.FileHandler(filename) file_handler.setLevel(logging.DEBUG) formatter = logging.Formatter("%(asctime)s %(filename)s, %(lineno)d, %(funcName)s: %(message)s") file_handler.setFormatter(formatter) logger.addHandler(file_handler) # log to the console console_handler = logging.StreamHandler() level = logging.INFO console_handler.setLevel(level) logger.addHandler(console_handler) logging.debug('logging initialized') How can I close the current logging file and restart logging to a new file? Note: I don't want to use RotatingFileHandler, because I want full control over all the filenames and the moment of rotation.

  Read the article

• [Python/Tkinter] Grid within a frame?

  - by Sam

  Is it possible to place a grid of buttons in Tkinter inside another frame? I'm wanting to create a tic-tac-toe like game and want to use the grid feature to put gamesquares (that will be buttons). However, I'd like to have other stuff in the GUI other than just the game board so it's not ideal to just have everything in the one grid. To illustrate: O | X | X | ---------- | O | O | X | Player 2 wins! ---------- | X | O | X | The tic tac toe board is in a grid that is made up of all buttons and the 'player 2 wins' is a label inside a frame. This is an oversimplification of what I'm trying to do so bear with me, for the way I've designed the program so far (the board is dynamically created) a grid makes the most sense.

  Read the article

• Sorting Python list based on the length of the string

  - by prosseek

  I want to sort a list of strings based on the string length. I tried to use sort as follows, but it doesn't seem to give me correct result. xs = ['dddd','a','bb','ccc'] print xs xs.sort(lambda x,y: len(x) < len(y)) print xs ['dddd', 'a', 'bb', 'ccc'] ['dddd', 'a', 'bb', 'ccc'] What might be wrong?

  Read the article

• I want to design a html form in python

  - by VaIbHaV-JaIn

  when user will enter details in the text box on the html from <h1>Please enter new password</h1> <form method="POST" enctype="application/json action="uid"> Password<input name="passwd"type="password" /><br> Retype Password<input name="repasswd" type="password" /><br> <input type="Submit" /> </form> </body> i want to post the data in json format through http post request and also i want to set content-type = application/json

  Read the article

• Python: Unpack arbitary length bits for database storage

  - by sberry2A

  I have a binary data format consisting of 18,000+ packed int64s, ints, shorts, bytes and chars. The data is packed to minimize it's size, so they don't always use byte sized chunks. For example, a number whose min and max value are 31, 32 respectively might be stored with a single bit where the actual value is bitvalue + min, so 0 is 31 and 1 is 32. I am looking for the most efficient way to unpack all of these for subsequent processing and database storage. Right now I am able to read any value by using either struct.unpack, or BitBuffer. I use struct.unpack for any data that starts on a bit where (bit-offset % 8 == 0 and data-length % 8 == 0) and I use BitBuffer for anything else. I know the offset and size of every packed piece of data, so what is going to be the fasted way to completely unpack them? Many thanks.

  Read the article

• match strings in python

  - by mesun

  Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring. Complete the definition def constrainedMatchPair(firstMatch,secondMatch,length):

  Read the article

• Python RegExp exception

  - by Jasie

  How do I split on all nonalphanumeric characters, EXCEPT the apostrophe? re.split('\W+',text) works, but will also split on apostrophes. How do I add an exception to this rule? Thanks!

  Read the article

• Efficient way in Python to remove an element from a comma-separated string

  - by ensnare

  I'm looking for the most efficient way to add an element to a comma-separated string while maintaining alphabetical order for the words: For example: string = 'Apples, Bananas, Grapes, Oranges' subtraction = 'Bananas' result = 'Apples, Grapes, Oranges' Also, a way to do this but while maintaining IDs: string = '1:Apples, 4:Bananas, 6:Grapes, 23:Oranges' subtraction = '4:Bananas' result = '1:Apples, 6:Grapes, 23:Oranges' Sample code is greatly appreciated. Thank you so much.

  Read the article

• how to send some data to the Thread module on python and google-map-engine

  - by zjm1126

  from google.appengine.ext import db class Log(db.Model): content = db.StringProperty(multiline=True) class MyThread(threading.Thread): def run(self,request): #logs_query = Log.all().order('-date') #logs = logs_query.fetch(3) log=Log() log.content=request.POST.get('content',None) log.put() def Log(request): thr = MyThread() thr.start(request) return HttpResponse('') error is : Exception in thread Thread-1: Traceback (most recent call last): File "D:\Python25\lib\threading.py", line 486, in __bootstrap_inner self.run() File "D:\zjm_code\helloworld\views.py", line 33, in run log.content=request.POST.get('content',None) NameError: global name 'request' is not defined

  Read the article

• Python: Taking an array and break it into subarrays based on some criteria

  - by randombits

  I have an array of files. I'd like to be able to break that array down into one array with multiple subarrays, each subarray contains files that were created on the same day. So right now if the array contains files from March 1 - March 31, I'd like to have an array with 31 subarrays (assuming there is at least 1 file for each day). In the long run, I'm trying to find the file from each day with the latest creation/modification time. If there is a way to bundle that into the iterations that are required above to save some CPU cycles, that would be even more ideal. Then I'd have one flat array with 31 files, one for each day, for the latest file created on each individual day.

  Read the article

• python: problem with dictionary get method default value

  - by goutham

  I'm having a new problem here .. CODE 1: try: urlParams += "%s=%s&"%(val['name'], data.get(val['name'], serverInfo_D.get(val['name']))) except KeyError: print "expected parameter not provided - "+val["name"]+" is missing" exit(0) CODE 2: try: urlParams += "%s=%s&"%(val['name'], data.get(val['name'], serverInfo_D[val['name']])) except KeyError: print "expected parameter not provided - "+val["name"]+" is missing" exit(0) see the diffrence in serverInfo_D[val['name']] & serverInfo_D.get(val['name']) code 2 fails but code 1 works the data serverInfo_D:{'user': 'usr', 'pass': 'pass'} data: {'par1': 9995, 'extraparam1': 22} val: {'par1','user','pass','extraparam1'} exception are raised for for data dict .. and all code in for loop which iterates over val

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

< Previous Page | 171 172 173 174 175 176 177 178 179 180 181 182  | Next Page >