Search Results

Search found 5262 results on 211 pages for 'operation'.

Page 176/211 | < Previous Page | 172 173 174 175 176 177 178 179 180 181 182 183  | Next Page >

• Migrate Data and Schema from MySQL to SQL Server

  - by colithium

  Are there any free solutions for automatically migrating a database from MySQL to SQL Server Server that "just works"? I've been attempting this simple (at least I thought so) task all day now. I've tried: SQL Server Management Studio's Import Data feature Create an empty database Tasks - Import Data... .NET Framework Data Provider for Odbc Valid DSN (verified it connects) Copy data from one or more tables or views Check 1 VERY simple table Click Preview Get Error: The preview data could not be retrieved. ADDITIONAL INFORMATION: ERROR [42000] [MySQL][ODBC 5.1 Driver][mysqld-5.1.45-community]You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near '"table_name"' at line 1 (myodbc5.dll) A similar error occurs if I go through the rest of the wizard and perform the operation. The failed step is "Setting Source Connection" the error refers to retrieving column information and then lists the above error. It can retrieve column information just fine when I modify column mappings so I really don't know what the issue is. I've also tried getting various MySql tools to output ddl statements that SQL Server understand but haven't succeeded. I've tried with MySQL v5.1.11 to SQL Server 2005 and with MySQL v5.1.45 to SQL Server 2008 (with ODBC drivers 3.51.27.00 and 5.01.06.00 respectively)

  Read the article

• How to stop the submission of the form using JQUERY?

  - by Param-Ganak

  Hello frineds! I have a form which have many check boxes in it. User will check one or many checkboxes and click on Delete button which is actually submit button then the respective records for selected check boxes are get deleted. Required operation steps are as follows:- When user selects one or more checkboxes and clicks the submit button then a JQUERY code is get executed in which It should checks that if any check box is selected; if not; then is displays alert message and do not submit the form. If it founds that one or more checkboxes are selected it should ask user for his/her confirmation using confirm alert box about the confirmation of deletion. If user press YES button on confirm box then it should submit the form using javascript submit statement. If user pressed the NO button then it should unchecks the checked selected checkboxes and should not submit the form. This is the JQUERY code I had written. $(document).ready(function (){ $("#id_delete").click(function(){ var temp=$("#id_frm input:checkbox:checked"); var len=temp.length; if(len==0) { alert("Please select the order."); } else { if(confirm("Are you sure to delete the selected orders.")) { $("#id_frm").submit(); } else { temp.checked=false; } } }); }); Problems: This code is not working properly. Here 1. It submits form when there is no check box is selected. 2. It submits the form when user press NO button on confirmation dialog box. Please guide me friends in this problem.

  Read the article

• How hide some nodes in Richfaces Tree (do not render nodes by condition)?

  - by VestniK

  I have a tree of categories and courses in my SEAM application. Courses may be active and inactive. I want to be able to show only active or all courses in my tree. I've decided to always build complete tree in my PAGE scope component since building this tree is quite expensive operation. I have boolean flag courseActive in the data wrapped by TreeNode<T>. Now I can't find the way to show courses node only if this flag is true. The best result I've achieved with the following code: <h:outputLabel for="showInactiveCheckbox" value="show all courses: "/> <h:selectBooleanCheckbox id="showInactiveCheckbox" value="#{categoryTreeEditorModel.showAllCoursesInTree}"> <a4j:support event="onchange" reRender="categoryTree"/> </h:selectBooleanCheckbox> <rich:tree id="categoryTree" value="#{categoryTree}" var="item" switchType="ajax" ajaxSubmitSelection="true" reRender="categoryTree,controls" adviseNodeOpened="#{categoryTreeActions.adviseRootOpened}" nodeSelectListener="#{categoryTreeActions.processSelection}" nodeFace="#{item.typeName}"> <rich:treeNode type="Category" icon="..." iconLeaf="..."> <h:outputText value="#{item.title}"/> </rich:treeNode> <rich:treeNode type="Course" icon="..." iconLeaf="..." rendered="#{item.courseActive or categoryTreeEditorModel.showAllCoursesInTree}"> <h:outputText rendered="#{item.courseActive}" value="#{item.title}"/> <h:outputText rendered="#{not item.courseActive}" value="#{item.title}" style="color:#{a4jSkin.inactiveTextColor}"/> </rich:treeNode> </rich:tree> the only problem is if some node is not listed in any rich:treeNode it just still shown with title obtained by Object.toString() method insted of being hidden. Does anybody know how to not show some nodes in the Richfases tree according to some condition?

  Read the article

• re.sub emptying list

  - by jmau5

  def process_dialect_translation_rules(): # Read in lines from the text file specified in sys.argv[1], stripping away # excess whitespace and discarding comments (lines that start with '##'). f_lines = [line.strip() for line in open(sys.argv[1], 'r').readlines()] f_lines = filter(lambda line: not re.match(r'##', line), f_lines) # Remove any occurances of the pattern '\s*<=>\s*'. This leaves us with a # list of lists. Each 2nd level list has two elements: the value to be # translated from and the value to be translated to. Use the sub function # from the re module to get rid of those pesky asterisks. f_lines = [re.split(r'\s*<=>\s*', line) for line in f_lines] f_lines = [re.sub(r'"', '', elem) for elem in line for line in f_lines] This function should take the lines from a file and perform some operations on the lines, such as removing any lines that begin with ##. Another operation that I wish to perform is to remove the quotation marks around the words in the line. However, when the final line of this script runs, f_lines becomes an empty lines. What happened? Requested lines of original file: ## English-Geek Reversible Translation File #1 ## (Moderate Geek) ## Created by Todd WAreham, October 2009 "TV show" <=> "STAR TREK" "food" <=> "pizza" "drink" <=> "Red Bull" "computer" <=> "TRS 80" "girlfriend" <=> "significant other"

  Read the article

• Is this overly clever or unsafe?

  - by Liberalkid

  I was working on some code recently and decided to work on my operator overloading in c++, because I've never really implemented it before. So I overloaded the comparison operators for my matrix class using a compare function that returned 0 if LHS was less than RHS, 1 if LHS was greater than RHS and 2 if they were equal. Then I exploited the properties of logical not in c++ on integers, to get all of my compares in one line: inline bool Matrix::operator<(Matrix &RHS){ return ! (compare(*this,RHS)); } inline bool Matrix::operator>(Matrix &RHS){ return ! (compare((*this),RHS)-1); } inline bool Matrix::operator>=(Matrix &RHS){ return compare((*this),RHS); } inline bool Matrix::operator<=(Matrix &RHS){ return compare((*this),RHS)-1; } inline bool Matrix::operator!=(Matrix &RHS){ return compare((*this),RHS)-2; } inline bool Matrix::operator==(Matrix &RHS){ return !(compare((*this),RHS)-2); } Obviously I should be passing RHS as a const, I'm just probably not going to use this matrix class again and I didn't feel like writing another function that wasn't a reference to get the array index values solely for the comparator operation.

  Read the article

• Double null-terminated string

  - by wengseng

  I need to format a string to be double null-terminated string in order to use SHFileOperation. Interesting part is i found one of the following working, but not both: // Example 1 CString szDir(_T("D:\\Test")); szDir = szDir + _T('\0') + _T('\0'); // Example 2 CString szDir(_T("D:\\Test")); szDir = szDir + _T("\0\0"); //Delete folder SHFILEOPSTRUCT fileop; fileop.hwnd = NULL; // no status display fileop.wFunc = FO_DELETE; // delete operation fileop.pFrom = szDir; // source file name as double null terminated string fileop.pTo = NULL; // no destination needed fileop.fFlags = FOF_NOCONFIRMATION|FOF_SILENT; // do not prompt the user fileop.fAnyOperationsAborted = FALSE; fileop.lpszProgressTitle = NULL; fileop.hNameMappings = NULL; int ret = SHFileOperation(&fileop); Does anyone has idea on this? Is there other way to append double-terminated string?

  Read the article

• association of more than one model to a listview

  - by Veer

  I have 3 Tables in my database. Each table has 3 fields each, excluding the ID field. out of which 2 fields are of type nvarchar. None of the tables are related. My ListView in the application helps the user to search my database, the search being incremental. The search includes the nvarchar fields of the 3 tables ie, 6 fields in total. Eg: PhoneBook: Name, PhoneNo Notes: Title, Content Bookmarks: Name, url I've the models generated for the 3 tables. Now the ListBox should display the Ph.Name, Title and the Bo.Name fields. ie, It should be bound to them. But they are from different models. I also should be able to perform CRUD operation on the item searched. How would i do that? P.S: Separate ViewModels are created for each Model which are used for their respective views for handling those tables individually. But this is an integrated view where the user should be able to search everything. Also please somebody suggest me a better Title for this question:)

  Read the article

• Calling private constructors with Reflection.Emit?

  - by Jakob Botsch Nielsen

  I'm trying to emit the following IL: LocalBuilder pointer = il.DeclareLocal(typeof(IntPtr)); il.Emit(OpCodes.Ldarg_0); il.Emit(OpCodes.Stloc, pointer); il.Emit(OpCodes.Ldloca, pointer); il.Emit(OpCodes.Call, typeof(IntPtr).GetMethod("ToPointer")); il.Emit(OpCodes.Ret); The delegate I bind with has the signature void* TestDelegate(IntPtr ptr) It throws the exception Operation could destabilize the runtime. Anyone knows what's wrong? EDIT: Alright, so I got the IL working now. The entire goal of this was to be able to call a private constructor. The private constructor takes a pointer so I can't use normal reflection. Now.. When I call it, I get an exception saying Attempt by method <built method> to access method <private constructor> failed. Apparently it's performing security checks - but from experience I know that Reflection is able to do private stuff like this normally, so hopefully there is a way to disable that check?

  Read the article

• Pass Memory in GB Using Import-CSV Powershell to New-VM in Hyper-V Version 3

  - by PowerShell

  I created the below function to pass memory from a csv file to create a VM in Hyper-V Version 3 Function Install-VM { param ( [Parameter(Mandatory=$true)] [int64]$Memory=512MB ) $VMName = "dv.VMWIN2K8R2-3.Hng" $vmpath = "c:\2012vms" New-VM -MemoryStartupBytes ([int64]$memory*1024) -Name $VMName -Path $VMPath -Verbose } Import-Csv "C:\2012vms\Vminfo1.csv" | ForEach-Object { Install-VM -Memory ([int64]$_.Memory) } But when i try to create the VM it says mismatch between the memory parameter passed from import-csv, i receive an error as below VERBOSE: New-VM will create a new virtual machine "dv.VMWIN2K8R2-3.Hng". New-VM : 'dv.VMWIN2K8R2-3.Hng' failed to modify device 'Memory'. (Virtual machine ID CE8D36CA-C8C6-42E6-B5C6-2AA8FA15B4AF) Invalid startup memory amount assigned for 'dv.VMWIN2K8R2-3.Hng'. The minimum amount of memory you can assign to a virtual machine is '8' MB. (Virtual machine ID CE8D36CA-C8C6-42E6-B5C6-2AA8FA15B4AF) A parameter that is not valid was passed to the operation. At line:48 char:9 + New-VM -ComputerName $HyperVHost -MemoryStartupBytes ([int64]$memory*10 ... + ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + CategoryInfo : InvalidArgument: (Microsoft.HyperV.PowerShell.VMTask:VMTask) [New-VM], VirtualizationOpe rationFailedException + FullyQualifiedErrorId : InvalidParameter,Microsoft.HyperV.PowerShell.Commands.NewVMCommand Also please not in the csv file im passing memory as 1,2,4.. etc as shown below, and converting them to MB by multiplying them with 1024 later Memory 1 Can Anyone help me out on how to format and pass the memory details to the function

  Read the article

• Appropriate uses of Monad `fail` vs. MonadPlus `mzero`

  - by jberryman

  This is a question that has come up several times for me in the design code, especially libraries. There seems to be some interest in it so I thought it might make a good community wiki. The fail method in Monad is considered by some to be a wart; a somewhat arbitrary addition to the class that does not come from the original category theory. But of course in the current state of things, many Monad types have logical and useful fail instances. The MonadPlus class is a sub-class of Monad that provides an mzero method which logically encapsulates the idea of failure in a monad. So a library designer who wants to write some monadic code that does some sort of failure handling can choose to make his code use the fail method in Monad or restrict his code to the MonadPlus class, just so that he can feel good about using mzero, even though he doesn't care about the monoidal combining mplus operation at all. Some discussions on this subject are in this wiki page about proposals to reform the MonadPlus class. So I guess I have one specific question: What monad instances, if any, have a natural fail method, but cannot be instances of MonadPlus because they have no logical implementation for mplus? But I'm mostly interested in a discussion about this subject. Thanks! EDIT: One final thought occured to me. I recently learned (even though it's right there in the docs for fail) that monadic "do" notation is desugared in such a way that pattern match failures, as in (x:xs) <- return [] call the monad's fail. It seems like the language designers must have been strongly influenced by the prospect of some automatic failure handling built in to haskell's syntax in their inclusion of fail in Monad.

  Read the article

• Determining if an unordered vector<T> has all unique elements

  - by Hooked

  Profiling my cpu-bound code has suggested I that spend a long time checking to see if a container contains completely unique elements. Assuming that I have some large container of unsorted elements (with < and = defined), I have two ideas on how this might be done: The first using a set: template <class T> bool is_unique(vector<T> X) { set<T> Y(X.begin(), X.end()); return X.size() == Y.size(); } The second looping over the elements: template <class T> bool is_unique2(vector<T> X) { typename vector<T>::iterator i,j; for(i=X.begin();i!=X.end();++i) { for(j=i+1;j!=X.end();++j) { if(*i == *j) return 0; } } return 1; } I've tested them the best I can, and from what I can gather from reading the documentation about STL, the answer is (as usual), it depends. I think that in the first case, if all the elements are unique it is very quick, but if there is a large degeneracy the operation seems to take O(N^2) time. For the nested iterator approach the opposite seems to be true, it is lighting fast if X[0]==X[1] but takes (understandably) O(N^2) time if all the elements are unique. Is there a better way to do this, perhaps a STL algorithm built for this very purpose? If not, are there any suggestions eek out a bit more efficiency?

  Read the article

• How to set up a load/stress test for a web site?

  - by Ryan

  I've been tasked with stress/load testing our company web site out of the blue and know nothing about doing so. Every search I make on google for "how to load test a web site" just comes back with various companies and software to physically do the load testing. For now I'm more interested in how to actually go about setting up a load test like what I should take into account prior to load testing, what pages within my site I should be testing load against and what things I'm going to want to monitor when doing the test. Our web site is on a multi-tier system complete with a separate database server (IIS 7 Web Server, SQL Server 2000 db). I imagine I'd want to monitor both the web server and the database server for testing load however when setting up scenarios to load test the web server I'd have to use pages that query the database to see any load on the database server at the same time. Are web servers and database servers generally tested simultaneously or are they done as separate tests? As you can see I'm pretty clueless as to the whole operation so any incite as to how to go about this would be very helpful. FYI I have been tinkering with Pylot and was able to create and run a scenario against our site but I'm not sure what I should be looking for in the results or if the scenario I created is even a scenario worth measuring for our site. Thanks in advance.

  Read the article

• Hibernate Transient Extends problem

  - by mrvreddy

  @MappedSuperclass public abstract class BaseAbstract implements Serializable{ private static final long serialVersionUID = 1L; protected String test = //some random value; public String getTest() { return test; } public void setTest(String test){ this.test = test; } } @Entity public class Artist extends BaseAbstract { private static final long serialVersionUID = 1L; private Integer id; @override @Transient public String getTest() { return test; } ..... } My question is... when i am trying to do any operation on the artist, along with id and name, test is also getting saved which should not be the case... if i add the same transient on the baseabstract class getTest() method, i see test column NOT getting created(ideally what it should happen) but if i try to override the method with adding annotaion in the sub class it creates the test column... I dont know why this is happening since when hibernate is creating the artist object and checks for annotations, it should see the transient annotation present on the getTest() of artist method...and should not create a column in the database... Let me know if you need any clarification.... Any response on this is greatly appreciated.... Thank you

  Read the article

• Efficient database access when dealing with multiple abstracted repositories

  - by Nathan Ridley

  I want to know how most people are dealing with the repository pattern when it involves hitting the same database multiple times (sometimes transactionally) and trying to do so efficiently while maintaining database agnosticism and using multiple repositories together. Let's say we have repositories for three different entities; Widget, Thing and Whatsit. Each repository is abstracted via a base interface as per normal decoupling design processes. The base interfaces would then be IWidgetRepository, IThingRepository and IWhatsitRepository. Now we have our business layer or equivalent (whatever you want to call it). In this layer we have classes that access the various repositories. Often the methods in these classes need to do batch/combined operations where multiple repositories are involved. Sometimes one method may make use of another method internally, while that method can still be called independently. What about, in this scenario, when the operation needs to be transactional? Example: class Bob { private IWidgetRepository _widgetRepo; private IThingRepository _thingRepo; private IWhatsitRepository _whatsitRepo; public Bob(IWidgetRepository widgetRepo, IThingRepository thingRepo, IWhatsitRepository whatsitRepo) { _widgetRepo = widgetRepo; _thingRepo= thingRepo; _whatsitRepo= whatsitRepo; } public void DoStuff() { _widgetRepo.StoreSomeStuff(); _thingRepo.ReadSomeStuff(); _whatsitRepo.SaveSomething(); } public void DoOtherThing() { _widgetRepo.UpdateSomething(); DoStuff(); } } How do I keep my access to that database efficient and not have a constant stream of open-close-open-close on connections and inadvertent invocation of MSDTS and whatnot? If my database is something like SQLite, standard mechanisms like creating nested transactions are going to inherently fail, yet the business layer should not have to be concerning itself with such things. How do you handle such issues? Does ADO.Net provide simple mechanisms to handle this or do most people end up wrapping their own custom bits of code around ADO.Net to solve these types of problems?

  Read the article

• C++ - Basic WinAPI question

  - by HardCoder1986

  Hello! I am now working on a some sort of a game engine and I had an idea to put everything engine-related into a static library and then link it to my actual problem. Right now I achieved it and actually link that library and every functions seem to work fine, except those, which are windows-related. I have a chunk of code in my library that looks like this: hWnd = CreateWindow(className, "Name", WS_OVERLAPPED | WS_CAPTION | WS_EX_TOPMOST, 0, 0, 800, 600, NULL, NULL, GetModuleHandle(NULL), this); if (hWnd) { ShowWindow(hWnd, SW_NORMAL); UpdateWindow(hWnd); } else { MessageBox(NULL, "Internal program error", "Error", MB_OK | MB_ICONERROR); return; } When this code was not in the library, but in the actual project, it worked fine, created the window and everything was ok. Right now (when I'm linking to my library that contains this code) CreateWindow(...) call returns NULL and GetLastError() returns "Operation succesfully completed" (wtf?). Could anybody help me with this? Is it possible to create a window and display it using a static library call and why could my code fail? Thank you.

  Read the article

• How to read the network file.

  - by ungalnanban

  I'm using Net::FTP for getting a remote hosted file. I want to read the file. I don't want to get the file from the remote host to my host (localhost), but I need to read the file content only. Is there any module to do this? use strict; use warnings; use Data::Dumper; use Net::FTP; my $ftp = Net::FTP->new("192.168.8.20", Debug => 0) or die "Cannot connect to some.host.name: $@"; $ftp->login("root",'root123') or die "Cannot login ", $ftp->message; $ftp->cwd("SUGUMAR") or die "Cannot change working directory ", $ftp->message; $ftp->get("Testing.txt") or die "get failed ", $ftp->message; $ftp->quit; In the above sample program, I get the file from 192.168.8.20. Then I will read the file and do the operation. I don't want to place the file in my local system. I need to read the Testing.txt file content.

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• Does Interlocked guarantee visibility to other threads in C# or do I still have to use volatile?

  - by Lirik

  I've been reading the answer to a similar question, but I'm still a little confused... Abel had a great answer, but this is the part that I'm unsure about: ...declaring a variable volatile makes it volatile for every single access. It is impossible to force this behavior any other way, hence volatile cannot be replaced with Interlocked. This is needed in scenarios where other libraries, interfaces or hardware can access your variable and update it anytime, or need the most recent version. Does Interlocked guarantee visibility of the atomic operation to all threads, or do I still have to use the volatile keyword on the value in order to guarantee visibility of the change? Here is my example: public class CountDownLatch { private volatile int m_remain; // <--- do I need the volatile keyword there since I'm using Interlocked? private EventWaitHandle m_event; public CountDownLatch (int count) { Reset(count); } public void Reset(int count) { if (count < 0) throw new ArgumentOutOfRangeException(); m_remain = count; m_event = new ManualResetEvent(false); if (m_remain == 0) { m_event.Set(); } } public void Signal() { // The last thread to signal also sets the event. if (Interlocked.Decrement(ref m_remain) == 0) m_event.Set(); } public void Wait() { m_event.WaitOne(); } }

  Read the article

• Excel - Best Way to Connect With Access Data

  - by gamerzfuse

  Hello there, Here is the situation we have: a) I have an Access database / application that records a significant amount of data. Significant fields would be hours, # of sales, # of unreturned calls, etc b) I have an Excel document that connects to the Access database and pulls data in to visualize it As it stands now, the Excel file has a Refresh button that loads new data. The data is loaded into a large PivotTable. The main 'visual form' then uses VLOOKUP to get the results from the form, based on the related hours. This operation is slow (~10 seconds) and seems to be redundant and inefficient. Is there a better way to do this? I am willing to go just about any route - just need directions. Thanks in advance! Update: I have confirmed (due to helpful comments/responses) that the problem is with the data loading itself. removing all the VLOOKUPs only took a second or two out of the load time. So, the questions stands as how I can rapidly and reliably get the data without so much time involvement (it loads around 3000 records into the PivotTables).

  Read the article

• Trailing comments after variable assignment subvert comparison

  - by nobar

  In GNU make, trailing comments appended to variable assignments prevent subsequent comparison (via ifeq) from working correctly. Here's the Makefile... A = a B = b ## trailing comment C = c RESULT := ifeq "$(A)" "a" RESULT += a endif ifeq "$(B)" "b" RESULT += b endif ifeq "$(C)" "c" RESULT += c endif rule: @echo RESULT=\"$(RESULT)\" @echo A=\"$(A)\" @echo B=\"$(B)\" @echo C=\"$(C)\" Here's the output... $ make RESULT=" a c" A="a" B="b " C="c" As you can see from the displayed value of RESULT, the ifeq was affected by the presence of the comment in the assignment of B. Echoing the variable B, shows that the problem is not the comment, but the intervening space. The obvious solution is to explicitly strip the whitespace prior to comparison like so... ifeq "$(strip $(B))" "b" RESULT += b endif However this seems error prone. Since the strip operation is not needed unless/until a comment is used, you can leave out the strip and everything will initially work just fine -- so chances are you won't always remember to add the strip. Later, if someone adds a comment when setting the variable, the Makefile no longer works as expected. Note: There is a closely related issue, as demonstrated in this question, that trailing whitespace can break string compares even if there is no comment. Question: Is there a more fool-proof way to deal with this issue?

  Read the article

• C#: socket closing if user user exists

  - by corvallo

  Hi to everyone I'm trying to create a server/client application for a school project. This is the scenario: a server on a given port, multiple user connected, each user has it's own username. Now I want to check if a user that try to connect to the user use a valid username, for example if a user with username A it's already connected a new user that want to connect cannot use the username A. If this happen the server answer to the new client with an error code. This is the code for this part private void Receive() { while (true) { byte[] buffer = new byte[64]; socket.Receive(buffer); string received = Encoding.Default.GetString(buffer); if (received.IndexOf("!error") != -1) { string[] mySplit = received.Split(':'); string errorCode = mySplit[1].Trim((char)0); if (errorCode == "user exists") { richTextBox1.AppendText("Your connection was refused by server, because there's already another user connected with the username you choose"); socket.Disconnect(true); connectBtn.Enabled = true; } } } } But when I try to do this the program crash and visual studio said that there's an invalid cross-thread operation on richTextBox1. Any ideas. Thank you in advance.

  Read the article

• Longer execution through Java shell than console?

  - by czuk

  I have a script in Python which do some computations. When I run this script in console it takes about 7 minutes to complete but when I run it thought Java shell it takes three times longer. I use following code to execute the script in Java: this.p = Runtime.getRuntime().exec("script.py --batch", envp); this.input = new BufferedReader(new InputStreamReader(p.getInputStream())); this.output = new BufferedWriter(new OutputStreamWriter(p.getOutputStream())); this.error = new BufferedReader(new InputStreamReader(p.getErrorStream())); Do you have any suggestion why the Python script runs three time longer in Java than in a console? update The computation goes as follow: Java sends data to the Python. Python reads the data. Python generates a decision tree --- this is a long operation. Python sends a confirmation that the tree is ready. Java receives the confirmation. Later there is a series of communications between Java and Python but it takes only several second.

  Read the article

• Iterative printing over two data types in Python

  - by old Ixfoxleigh

  I often browse freely-available art on the web. Actually, I can't think of a better use for the internet than to turn it into a gigantic art gallery. When I encounter a set of pieces I quite like, I download them all to my hard drive. wget makes that easy, especially in combination with Python's print function, and I use this all the time to make a list of URLs that I then wget. Say I need to download a list of jpegs that run from art0 to art100 in the directory 'art,' I just tell python for i in range(0,101): print "http://somegallery/somedirectory/art", i So, this is probably a fairly simple operation in Python, and after a find-and-replace to remove whitespace, it's just a matter of using wget -i, but in days before I knew any Python I'd slavishly right-click and save. Now I've got a bunch of files from Fredericks & Freiser gallery in New York that all go a(1-14), b(1-14), c(1-14), etc., up to the letter g. I could do that in 7 goes, and it would take me less time than it took to write this SO question. That said, I want to deepen my knowledge of Python. So, given the letters a-g, how do I print a mapping of each letter to the integers 1-14?

  Read the article

• Is locking on the requested object a bad idea?

  - by Quick Joe Smith

  Most advice on thread safety involves some variation of the following pattern: public class Thing { private static readonly object padlock = new object(); private string stuff, andNonsense; public string Stuff { get { lock (Thing.padlock) { if (this.stuff == null) this.stuff = "Threadsafe!"; } return this.stuff; } } public string AndNonsense { get { lock (Thing.padlock) { if (this.andNonsense == null) this.andNonsense = "Also threadsafe!"; } return this.andNonsense; } } // Rest of class... } In cases where the get operations are expensive and unrelated, a single locking object is unsuitable because a call to Stuff would block all calls to AndNonsense, degrading performance. And rather than create a lock object for each call, wouldn't it be better to acquire the lock on the member itself (assuming it is not something that implements SyncRoot or somesuch for that purpose? For example: public string Stuff { get { lock (this.stuff) { // Pretend that this is a very expensive operation. if (this.stuff == null) this.stuff = "Still threadsafe and good?"; } return this.stuff; } } Strangely, I have never seen this approach recommended or warned against. Am I missing something obvious?

  Read the article

• How to get around LazyInitializationException in scheduled jobs?

  - by Shreerang

  I am working on a J2EE server application which is deployed on Tomcat. I use Spring source as MVC framework and Hibernate as ORM provider. My object model has lot of Lazy relationships (dependent objects are fetched on request). The high level design is like Service level methods call a few DAO methods to perform database operation. The service method is called either from the Flex UI or as a scheduled job. When it is called from Flex UI, the service method works fine i.e. it fetches some objects using DAO methods and even Lazy loading works. This is possible by the use of OpenSessionInViewFilter configured with the UI servlet. But when the same service method is called as scheduled Job, it gives LazyInitializationException. I can not configure OpenSessionInViewFilter because there is no servlet or UI request associated with that. I tried configuring Transaction around the scheduled job method so that service method starts a transaction and all the DAO methods participate in that same transaction, hoping that the transaction will remain active and hibernate session will be available. But it does not work. Please suggest if anyone has ever been able to get such a configuration working. If needed, I can post the Hibernate configuration and log messages. Thanks a lot for help! Shreerang

  Read the article

< Previous Page | 172 173 174 175 176 177 178 179 180 181 182 183  | Next Page >