Search Results

Search found 12887 results on 516 pages for 'small jam'.

Page 187/516 | < Previous Page | 183 184 185 186 187 188 189 190 191 192 193 194  | Next Page >

  • executing null values records

    - by jjj
    i am trying to execute the records that have TotalTime null value from the table NewTimeAttendance...TotalTime datatype nchar(10) select * from newtimeattendance where TotalTime = 'NULL' ....nothing select * from newtimeattendance where TotalTime = 'null' ....nothing select * from newtimeattendance where TotalTime = 'Null' ....nothing select * from newtimeattendance where TotalTime = null ....nothing select * from newtimeattendance where TotalTime = Null ....nothing select * from newtimeattendance where TotalTime = NULL ....nothing when i select the whole table i can see that there is some NULL TotalTime values..!! it is small select statment ..why doesn't it work ? is there a way (special way ) to execute the 'NULL' with nchar type ?! thanks in advance

    Read the article

  • how to store a 2D game world in mysql

    - by monthon1
    I am making a 2D game in javascript/ajax, that will be using data stored in mysql database. Every user have got his own "area" made of small squares that can have some values. But I have no idea, how to store values of each square in mysql, when each user can have area with different width or height. Do you have some idea?

    Read the article

  • Building vs. Compiling (Java)

    - by sixtyfootersdude
    Thinking that the answer to this is pretty obvious but here it goes: When I am working on a small project for school (in java) I "compile" it. On my coop we are using ant to "build" our project. I think that compiling is a subset of building. Is this correct? What is the difference between building and compiling?

    Read the article

  • Image upload storage strategies

    - by MatW
    When a user uploads an image to my site, the image goes through this process; user uploads pic store pic metadata in db, giving the image a unique id async image processing (thumbnail creation, cropping, etc) all images are stored in the same uploads folder So far the site is pretty small, and there are only ~200,000 images in the uploads directory. I realise I'm nowhere near the physical limit of files within a directory, but this approach clearly won't scale, so I was wondering if anyone had any advice on upload / storage strategies for handling large volumes of image uploads.

    Read the article

  • Consequences of an infinite loop on Google App Engine?

    - by Axidos
    I am not a Google App Engine user. However, I understand you're billed for CPU time and other resources. What are the consequences if you happen to create an infinite loop? Will Google ever terminate it, or will you have to do it yourself manually somehow? I'm a hobbyist developer worried about a small error that might end up costing hundreds.

    Read the article

  • What is the recommended approach to add static subdomains to a website?

    - by shg
    I would like to create a few static subdomains like: mycategory.mydomain.com in a rather small website and would like it to point to the folder: mydomain.com/mycategory without showing such redirection in browser address bar. What is an easiest way to achieve it? I can do it in either IIS settings, asp.net, C# code, etc I guess there are better ways then creating a few separate Sites in IIS - one for each subdomain.

    Read the article

  • How to create a WebKit browser plugin in C#?

    - by Superior0
    I want to create C# plugin for some 3d + Music editing stuff. I want to be able to run my files inside browsers pages (so to see HTML some Flash content and some content which is rant by my plugin) using something like HTML tag or some JavaScript. (So my plugin will be small, powerfull and i want it to run at least on Windows and Mac firefox and safary and Chrome)(If it'll be runing on Linux itll be grate))) I'ma beginner so any helpfull info will be appriciated

    Read the article

  • Summary of changes for each API level?

    - by MisterSquonk
    As the title says, are there any sources (web pages etc) of summarised changes at each API level? I have an app which I've put out to a small group of beta testers and I already fell foul of Environment.getExternalFilesDir(), which I hadn't noticed was introduced in API Level 8, when a couple of the guys tried it on Android v2.1 devices. The majority of my code should be pretty generic but it would be useful if I could find a condensed/summarised list/table or similar that I can quickly glance over.

    Read the article

  • Learning... anything really

    - by WebDevHobo
    I'm particularly interested in Windows PowerShell, but here's a somewhat more general complaint: When asking for help on learning something new, be it a small subject on PHP or understanding a class in Java, what usually happens is that people direct me towards the documentation pages. What I'm looking for is somewhat of a course. A deep explanation of why something works the way it does. I know my basic programming, like Java and C#. I've never seen C or C++, though I have seen a bit of assembler. I know what the Stack and Heap are, how boxing and unboxing works, why you have to deep-copy an array instead of copying the pointer and some other things. Windows PowerShell on the other hand, I know nothing about. And I notice that when reading the small document or some code, I usually forget what it does or why it works. What I am looking for is preferably, a nice tutorial that explains the beginnings, the concepts, and goes to more difficult things at a steady pace. The only thing documentation can do is explain what a function does. That's no good to me since I don't know what I want to do yet. I could read about a thousand functions, and forget about most of them, because I don't need to implement them right after it. Randomly wandering through the documentation doesn't do me any good. So conclude, what is a good tutorial on Windows Powershell? One which explains in clear language what is happening, one which builds on previous things learned. I don't think googling this is a good idea. Doing a Google search on this would turn up numerous tutorials. And experience tells me that you have to look long and hard to find the gem you're looking for. That's why I'm asking here. Because this is the place where you can find more experienced people. Many of the PowerShell guys among you will know the good ones already, and by asking you, I avoid wasting time that could be spent learning. So to summarize: I will not google this!

    Read the article

  • iPhone SQLite connection in domain object - close each time?

    - by BahaiResearch.com
    I have what I would consider a small sized iPhone app that uses SQLite. There is a singleton domain object which gets data from a SQLite database. Is it better to create and open the SQLite connection for each request, or to open the DB once and hold on to it for the duration of the app. The app's reason for being is the domain object so other objects will not need the DB.

    Read the article

  • LAMP v/s WAMP in PHP

    - by Ajith
    I have a small server problem when working with LAMPP and WAMP server in PHP.I am using LAMPP server for local development and I need to host in WAMP server.When try to read an image from a dynamic created pdf file in LAMPP, it is working perfectly but, the same one not compact able with WAMP server.What will be the problem?Any additional feature need to configure in WAMP.Please help me to go forward.Please........

    Read the article

  • Java: JPQL search -similar- strings

    - by bguiz
    What methods are there to get JPQL to match similar strings? By similar I mean: Contains: search string is found within the string of the matches entity Case-insensitive Small mispellings: e.g. "arow" matches "arrow" I suspect the first two will be easy, however, I would appreciate help with the last one Thank you

    Read the article

  • What is a good CPU/PC setup to speed up intensive C++/templates compilation?

    - by ApplePieIsGood
    I currently have a machine with an Opteron 275 (2.2Ghz), which is a dual core CPU, and 4GB of RAM, along with a very fast hard drive. I find that when compiling even somewhat simple projects that use C++ templates (think boost, etc.), my compile times can take quite a while (minutes for small things, much longer for bigger projects). Unfortunately only one of the cores is pegged at 100%, so I know it's not the I/O, and it would seem that there is no way to take advantage of the other core for C++ compilation?

    Read the article

  • CSS: What is the proper way to deal with multiple classes of Text

    - by DavidR
    So I'm on commission for a website, and I'm trying to improve my code. When dealing with a website with multiple types of font (here it's large, there it's small, there it's bold, here it's underlined, etc.) is this where we use the h1-h6, or do we reserve those for times when there is a definite hierarchy, using instead <p class="xxx"> to define different classes for text?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Should I begin Learning C# with C# 3 or C# 4 ?

    - by Naughty.Coder
    Should I learn C#3 or C#4 !? there are alot more books on C#3 than C#4 , would my programming abilities be outdated if I learned C#3 !? And another small question : there are books like : beginning Visual C# 2008 , and Illustrated C# 2008 . The question is : Do they mean the IDE when they mention Visual C# 2008 ?

    Read the article

  • Using imtophat in Matlab

    - by jaff12
    I'm trying to do top hat filtering in matlab. The imtophat function looks promising, but I have no idea how to use it. I dont have a lot of work with Matlab before. I am trying to look find basically small spots several pixels wide that are local max in my 2 dimensional array.

    Read the article

  • Image_tag .blank? - paperclip - Ruby on rails

    - by bgadoci
    I have just installed paperclip into my ruby on rails blog application. Everything is working great...too great. I am trying to figure out how to tell paperclip not to output anything if there is no record in the table so that I don't have broken image links everywhere. How, and where, do I do this? Here is my code: class Post < ActiveRecord::Base has_attached_file :photo, :styles => { :small => "150x150"} validates_presence_of :body, :title has_many :comments, :dependent => :destroy has_many :tags, :dependent => :destroy has_many :ugtags, :dependent => :destroy has_many :votes, :dependent => :destroy belongs_to :user after_create :self_vote def self_vote # I am assuming you have a user_id field in `posts` and `votes` table. self.votes.create(:user => self.user) end cattr_reader :per_page @@per_page = 10 end View <% div_for post do %> <div id="post-wrapper"> <div id="post-photo"> <%= image_tag post.photo.url(:small) %> </div> <h2><%= link_to_unless_current h(post.title), post %></h2> <div class="light-color"> <i>Posted <%= time_ago_in_words(post.created_at) %></i> ago </div> <%= simple_format truncate(post.body, :length => 600) %> <div id="post-options"> <%= link_to "Read More >>", post %> | <%= link_to "Comments (#{post.comments.count})", post %> | <%= link_to "Strings (#{post.tags.count})", post %> | <%= link_to "Contributions (#{post.ugtags.count})", post %> | <%= link_to "Likes (#{post.votes.count})", post %> </div> </div> <% end %>

    Read the article

  • Android Image Button Problem

    - by xger86x
    Hi, i have the following imageButton <ImageButton android:id="@+id/header_buttonleft" android:layout_width="40dip" android:layout_height="40dip" android:layout_alignParentLeft="true" android:layout_marginLeft="10dip" android:layout_marginTop="5dip" android:src="@drawable/icon_download" android:clickable="true"/> But when i load my application in the device, it appears too small: Anyone knows how can i make the icon bigger. I have tried to increase the resolution (actually the icon is 70x70) but it still doesn't work. Any idea?

    Read the article

  • Good TFS Hosting Provider

    - by JonnyD
    I'm looking for a good 3rd party host for Team Foundation Server. Have any of you had good or bad experiences in the past? Will be working on a small .NET project with several other guys in different locations. Are there any performance problems or any other "gotchas" with 3rd party hosting?

    Read the article

  • Are regexes really maintainable?

    - by Rich Bradshaw
    Any code I've seen that uses Regexes tends to use them as a black box: Put in string Magic Regex Get out string This doesn't seem a particularly good idea to use in production code, as even a small change can often result in a completely different regex. Apart from cases where the standard is permanent and unchanging, are regexes the way to do things, or is it better to try different methods?

    Read the article

< Previous Page | 183 184 185 186 187 188 189 190 191 192 193 194  | Next Page >