Search Results

Search found 7387 results on 296 pages for 'adrian hope bailie'.

Page 200/296 | < Previous Page | 196 197 198 199 200 201 202 203 204 205 206 207  | Next Page >

  • Problem with oracle stored procedure - parameters

    - by Nicole
    I have this stored procedure: CREATE OR REPLACE PROCEDURE "LIQUIDACION_OBTENER" ( p_Cuenta IN NUMBER, p_Fecha IN DATE, p_Detalle OUT LIQUIDACION.FILADETALLE%TYPE ) IS BEGIN SELECT FILADETALLE INTO p_Detalle FROM Liquidacion WHERE (FILACUENTA = p_Cuenta) AND (FILAFECHA = p_Fecha); END; / ...and my c# code: string liquidacion = string.Empty; OracleCommand command = new OracleCommand("Liquidacion_Obtener"); command.BindByName = true; command.Parameters.Add(new OracleParameter("p_Cuenta", OracleDbType.Int64)); command.Parameters["p_Cuenta"].Value = cuenta; command.Parameters.Add(new OracleParameter("p_Fecha", OracleDbType.Date)); command.Parameters["p_Fecha"].Value = fecha; command.Parameters.Add("p_Detalle", OracleDbType.Varchar2, ParameterDirection.Output); OracleConnectionHolder connection = null; connection = this.GetConnection(); command.Connection = connection.Connection; command.CommandTimeout = 30; command.CommandType = CommandType.StoredProcedure; OracleDataReader lector = command.ExecuteReader(); while (lector.Read()) { liquidacion += ((OracleString)command.Parameters["p_Detalle"].Value).Value; } the thing is that when I try to put a value into the parameter "Fecha" (that is a date) the code gives me this error (when the line command.ExecuteReader(); is executed) Oracle.DataAccess.Client.OracleException : ORA-06502: PL/SQL: numeric or value error ORA-06512: at "SYSTEM.LIQUIDACION_OBTENER", line 9 ORA-06512: at line 1 I tried with the datetime and was not the problem, I eve tried with no input parameters and just the output and still got the same error. Aparently the problem is with the output parameter. I already tried putting p_Detalle OUT VARCHAR2 instead of p_Detalle OUT LIQUIDACION.FILADETALLE%TYPE but it didn't work either I hope my post is understandable.. thanks!!!!!!!!!!

    Read the article

  • LWUIT Deadlock (lwuit dialog VS System dialog)

    - by Ramps
    Hi, I have a deadlock problem when I try to make some I/O operations that needs user permission. When user click the button I start a new thread which is responsible for performing IO operations, and I display lwuit "please wait" dialog. Dialog is dismissed by IO thread from callback method. Problem is that, when system dialog appears (asking for user permission ) on top of lwuit dialog - deadlock occurs. I assume that this is because dialog.show() method blocks main thread (EDT), so it's impossible to dismiss system dialog, when lwuit dialog is behind it. Anyone managed to solve this problem? Here is the simplified code, hope it is clear enough: protected void actionPerformed(ActionEvent evt, int id) { switch (id) { case ID_FRIEND: MyRunnableWithIoOperation r = new MyRunnableWithIoOperation(this); new Thread(r).start(); //run the thread performing IO operations Command cmd = mWaitDialog.showDialog(); // show the "please wait" dialog ...//handle cancel }//end switch } /* method called from MyRunnableWithIoOperation, when operation finished*/ public void myCallbackMethod(){ mWaitDialog.dispose(); // } I tried to start my IO thread by calling Display.getInstance().invokeAndBlock( r ), but with no luck. In such case, my "wait dialog" doesn't show up.

    Read the article

  • Compare new Integer Objects in ArrayList Question

    - by thechiman
    I am storing Integer objects representing an index of objects I want to track. Later in my code I want to check to see if a particular object's index corresponds to one of those Integers I stored earlier. I am doing this by creating an ArrayList and creating a new Integer from the index of a for loop: ArrayList<Integer> courseselectItems = new ArrayList(); //Find the course elements that are within a courseselect element and add their indicies to the ArrayList for(int i=0; i<numberElementsInNodeList; i++) { if (nodeList.item(i).getParentNode().getNodeName().equals("courseselect")) { courseselectItems.add(new Integer(i)); } } I then want to check later if the ArrayList contains a particular index: //Cycle through the namedNodeMap array to find each of the course codes for(int i=0; i<numberElementsInNodeList; i++) { if(!courseselectItems.contains(new Integer(i))) { //Do Stuff } } My question is, when I create a new Integer by using new Integer(i) will I be able to compare integers using ArrayList.contains()? That is to say, when I create a new object using new Integer(i), will that be the same as the previously created Integer object if the int value used to create them are the same? I hope I didn't make this too unclear. Thanks for the help!

    Read the article

  • FIlling a Java Bean tree structure from a csv flat file

    - by Clem
    Hi, I'm currently trying to construct a list of bean classes in Java from a flat description file formatted in csv. Concretely : Here is the structure of the csv file : MES_ID;GRP_PARENT_ID;GRP_ID;ATTR_ID M1 ; ;G1 ;A1 M1 ; ;G1 ;A2 M1 ;G1 ;G2 ;A3 M1 ;G1 ;G2 ;A4 M1 ;G2 ;G3 ;A5 M1 ; ;G4 ;A6 M1 ; ;G4 ;A7 M1 ; ;G4 ;A8 M2 ; ;G1 ;A1 M2 ; ;G1 ;A2 M2 ; ;G2 ;A3 M2 ; ;G2 ;A4 It corresponds to the hierarchical data structure : M1 ---G1 ------A1 ------A2 ------G2 ---------A3 ---------A4 ---------G3 ------------A5 ------G4 ---------A7 ---------A8 M2 ---G1 ------A1 ------A2 ---G2 ------A3 ------A4 Remarks : A message M can have an infinite number of groups G and attributes A A group G can have an infinite number of attributes and an infinite number of under-groups each of them having under-groups too That beeing said, I'm trying to read this flat csv decription to store it in this structure of beans : Map<String, MBean> messages = new HashMap<String, Mbean>(); == public class MBean { private String mes_id; private Map<String, GBean> groups; } public class GBean { private String grp_id; private Map<String, ABean> attributes; private Map<String, GBean> underGroups; } public class ABean { private String attr_id; } Reading the csv file sequentially is ok and I've been investigating how to use recursion to store the description data, but couldn't find a way. Thanks in advance for any of your algorithmic ideas. I hope it will put you in the mood of thinking about this ... I've to admit that I'm out of ideas :s

    Read the article

  • weird swing heavyweight object lightweight objects problem

    - by Yoav Schwartz
    Hello, We have a problem in our swing based application since we've upgraded our java version from 6u5 to 6u18 (The application runs over WinXP). Our application contains a Canvas object which resides in a JFrame. The application draws things on the canvas. Every time we drag a lightweight swing object (popup or another frame) over the canvas, it has a refresh problem. It blinks - becomes black. The problem only resolves after we move the swing component away from the canvas and click on it again. We think this problem is related to the fact the the canvas is a heavyweight object. And we know there were changes done in the new versions of java on the mixing of heavyweight and lightweight objects issue. Some more details: 1) Our problem reproduces in java 6u14 and 6u16. 2) Everything works fine in java 6u5. Another strange thing: We have 2 types of stations running our application. The first type has a ATI FireGL7100 PCI-E graphics card. The second type has a Matrox G450 PCI graphic card. The problem does not reproduce on the Matrox based station in any java version. One more thing: http://bugs.sun.com/bugdatabase/view_bug.do?bug_id=6829858 - looks similar to our problem. Is our problem familiar? Do you have any suggestions (workarounds, ideas how the difference in graphics cards is connected to this problem) Hope I was clear enough, Yoav

    Read the article

  • rails search nested set (categories and sub categories)

    - by bob
    Hello, I am using the http://github.com/collectiveidea/awesome_nested_set awesome nested set plugin and currently, if I choose a sub category as my category_id for an item, I can not search by its parent. Category.parent Category.Child I choose Category.child as the category that my item is in. So now my item has category_id of 4 stored in it. If I go to a page in my rails application, lets say teh Category page and I am on the Category.parent's page, I want to show products that have category_id's of all the descendants as well. So ideally i want to have a find method that can take into account the descendants. You can get the descendants of a root by calling root.descendants (a built in plugin method). How would I go about making it so I can query a find that gets the descendants of a root instead of what its doing now which is binging up nothing unless the product had a specific category_id of the Category.parent. I hope I am being clear here. I either need to figure out a way to create a find method or named_scope that can query and return an array of objects that have id's corresponding tot he descendants of a root OR if I have any other options, what are they? I thought about creating a field in my products table like parent_id which can keep track of the parent so i can then create two named scopes one finding the parent stuff and one finding the child stuff and chaining them. I know I can create a named scope for each child and chain them together for multiple children but this seems a very tedious process and also, if you add more children, you would need to specify more named scopes.

    Read the article

  • Need advice on OOP philosophy

    - by David Jenings
    I'm trying to get the wheels turning on a large project in C#. My previous experience is in Delphi, where by default every form was created at applicaton startup and form references where held in (gasp) global variables. So I'm trying to adapt my thinking to a 100% object oriented environment, and my head is spinning just a little. My app will have a large collection of classes Most of these classes will only really need one instance. So I was thinking: static classes. I'm not really sure why, but much of what I've read here says that if my class is going to hold a state, which I take to mean any property values at all, I should use a singleton structure instead. Okay. But there are people out there who for reasons that escape me, think that singletons are evil too. None of these classes is in danger of being used anywhere except in this program. So they could certainly work fine as regular objects (vs singletons or static classes) Then there's the issue of interaction between objects. I'm tempted to create a Global class full of public static properties referencing the single instances of many of these classes. I've also considered just making them properties (static or instance, not sure which) of the MainForm. Then I'd have each of my classes be aware of the MainForm as Owner. Then the various objects could refer to each other as Owner.Object1, Owner.Object2, etc. I fear I'm running out of electronic ink, or at least taxing the patience of anyone kind enough to have stuck with me this long. I hope I have clearly explained my state of utter confusion. I'm just looking for some advice on best practices in my situation. All input is welcome and appreciated. Thanks in advance, David Jennings

    Read the article

  • Positioning SVG Elements

    - by Rob Wilkerson
    In the course of toying with SVG for the first time (using the Raphael library), I've run into a problem positioning dynamic elements on the canvas in such a way that they're completely contained within the canvas. What I'm trying to do is randomly position n words/short phrases. Since the text is variable, its position needs to be variable as well so what I'm doing is: Initially creating the text at point 0,0 with no opacity. Checking the width of the drawn text element using text.getBBox().width. Setting a new x coordinate as Math.random() * (canvas_width - ( text_width/2 ) - pad). Altering the x coordinate of the text to the newly set value (text.attr( 'x', x ) ). Setting the opacity attribute of the text to 1. I'll be the first to admit that my math acumen is limited, but this seems pretty straightforward. Somehow, I still end up with text running off beyond the right edge of my canvas. For simplicity above, I removed the bit that also sets a minimum x value by adding it to the Math.random() result. It is there, though, and I see the same problem on the leading edge of the canvas. My understanding (such as it is), is that the Math.random() bits would generate a number between 0 and 1 which could then be multiplied by some number (in my case, the canvas width - half of the text width - some arbitrary padding) to get the outer bound. I'm dividing the width of the text in half because its position on the grid is set at its center. I hope I've just been staring at this for too long, but is my math that rusty or am I misunderstanding something about the behavior of Math.random(), SVG, text or anything else that's under the hood of this solution?

    Read the article

  • Help a C# developer understand: What is a monad?

    - by Charlie Flowers
    There is a lot of talk about monads these days. I have read a few articles / blog posts, but I can't go far enough with their examples to fully grasp the concept. The reason is that monads are a functional language concept, and thus the examples are in languages I haven't worked with (since I haven't used a functional language in depth). I can't grasp the syntax deeply enough to follow the articles fully ... but I can tell there's something worth understanding there. However, I know C# pretty well, including lambda expressions and other functional features. I know C# only has a subset of functional features, and so maybe monads can't be expressed in C#. However, surely it is possible to convey the concept? At least I hope so. Maybe you can present a C# example as a foundation, and then describe what a C# developer would wish he could do from there but can't because the language lacks functional programming features. This would be fantastic, because it would convey the intent and benefits of monads. So here's my question: What is the best explanation you can give of monads to a C# 3 developer? Thanks! (EDIT: By the way, I know there are at least 3 "what is a monad" questions already on SO. However, I face the same problem with them ... so this question is needed imo, because of the C#-developer focus. Thanks.)

    Read the article

  • remove an ASIHTTPRequest thread when it is done

    - by user262325
    Hello everyone I have a project in which it runs 5 download threads - (void)fetchThisURLFiveTimes:(NSURL *)url { [myProgressIndicator setProgress:0]; NSLog(@"Value: %f", [myProgressIndicator progress]); [myQueue cancelAllOperations]; [myQueue setDownloadProgressDelegate:myProgressIndicator]; [myQueue setDelegate:self]; [myQueue setRequestDidFinishSelector:@selector(queueComplete:)]; int i; for (i=0; i<5; i++) { ASIHTTPRequest *request = [ASIHTTPRequest requestWithURL:url]; [request setDidFinishSelector:@selector(requestDone:)]; [request setDelegate:self]; [myQueue addOperation:request]; } [myQueue go]; } - (void)requestWentDone:(ASIHTTPRequest *)request { //.. } - (void)queueComplete:(ASINetworkQueue *)queue { NSLog(@"Value: %f", [myProgressIndicator progress]); } I hope to remove a thread when it is done. I do not know where I need to place my codes: requestWentDone:(ASIHTTPRequest *)request or queueComplete:(ASINetworkQueue *)queue I noticed there is no tag property for request, so I added it to ASIHTTPRequest to help me recognize which thread prompts the function reuqestWentDone, I can get the tag of different request, but I do not know how to remove the ASIHTTPRequest thread from myQueue. Welcome any comment Thanks interdev

    Read the article

  • How to save a picture to a file?

    - by Peter vdL
    I'm trying to use a standard Intent that will take a picture, then allow approval or retake. Then I want to save the picture into a file. Here's the Intent I am using: Intent intent = new Intent(android.provider.MediaStore.ACTION_IMAGE_CAPTURE ); startActivityForResult( intent, 22 ); The docs at http://developer.android.com/reference/android/provider/MediaStore.html#ACTION_IMAGE_CAPTURE say "The caller may pass an extra EXTRA_OUTPUT to control where this image will be written. If the EXTRA_OUTPUT is not present, then a small sized image is returned as a Bitmap object in the extra field. If the EXTRA_OUTPUT is present, then the full-sized image will be written to the Uri value of EXTRA_OUTPUT." I don't pass extra output, I hope to get a Bitmap object in the extra field of the Intent passed into onActivityResult() (for this request). So where/how do you extract it? Intent has a getExtras(), but that returns a Bundle, and Bundle wants a key string to give you something back. What do you invoke on the Intent to extract the bitmap?

    Read the article

  • Multiple model forms with some pre-populated fields

    - by jimbocooper
    Hi! Hope somebody can help me, since I've been stuck for a while with this... I switched to another task, but now back to the fight I still can't figure out how to come out from the black hole xD The thing is as follows: Let's say I've got a product model, and then a set of Clients which have rights to submit data for the products they've been subscribed (Many to Many from Client to Product). Whenever my client is going to submit data, I need to create as many forms as products he's subscribed, and pre-populate each one of them with the "product" field as long as perform a quite simple validation (some optional fields have to be completed if it's client's first submission). I would like one form "step" for each product submission, so I've tried formWizards... but the problem is you can't pre-assign values to the forms... this can be solved afterwards when submitting, though... but not the problem that it doesn't allow validation either, so at the end of each step I can check some data before rendering next step. Then I've tried model formsets, but then there's no way to pre-populate the needed fields. I came across some django plugins, but I'm not confident yet if any of them will make it.... Did anybody has a similar problem so he can give me a ray of light? Thanks a lot in advance!! :) edit: The code I used in the formsets way is as follows: prods = Products.objects.filter(Q(start_date__lte=today) & Q(end_date__gte=today), requester=client) num = len(prods) PriceSubmissionFormSet = modelformset_factory(PriceSubmission, extra=num) formset = PriceSubmissionFormSet(queryset=PriceSubmission.objects.none())

    Read the article

  • Passing Control's Value to Modal Popup

    - by Sherwin Valdez
    Hello, Just would like know how to pass textbox value to a modal popup after clicking a button using ModalPopUpExtender in ASP.NET, I've tried these codes but seems that I have no luck :( <script runat="server"> protected void Page_Load(object sender, EventArgs e) { Button1.Attributes.Add("onclick", "showModalPopup(); return false;"); } </script> <asp:ScriptManager ID="ScriptManager1" runat="server"> </asp:ScriptManager> <asp:TextBox ID="TextBox1" runat="server"></asp:TextBox> <asp:Button ID="Button1" runat="server" Text="Button" OnClick='showModalPopup(); return false;' /> <cc1:ModalPopupExtender ID="ModalPopupExtender1" runat="server" TargetControlID="Button1" PopupControlID="Panel1" CancelControlID="btnCancel" OkControlID="btnOkay" BackgroundCssClass="ModalPopupBG"> </cc1:ModalPopupExtender> <asp:Panel ID="Panel1" Style="display: none" runat="server"> <div class="HellowWorldPopup"> <div class="PopupHeader" id="PopupHeader"> Header</div> <div class="PopupBody"> <asp:Label ID="Label1" runat="server"></asp:Label> </div> <div class="Controls"> <input id="btnOkay" type="button" value="Done" /> <input id="btnCancel" type="button" value="Cancel" /> </div> </div> </asp:Panel> javascript function showModalPopup() { //show the ModalPopupExtender var value; value = document.getElementById("TextBox1").value; $get("<%=Label1.ClientID %>").value = value; $find("<%=ModalPopupExtender1.ClientID %>").show(); } I wonder what I miss out :(, Thanks and I hope someone could help me :)

    Read the article

  • Keymap issues with NX from Mac OS X Lion

    - by Andy
    I tried to answer the question from Mark: Keymap issues with NX from Mac OS X Lion to Ubuntu However, it is locked so I figured I would post a new question / answer. I have been trying to answer this for a few days now because I have no issues when connecting through NX Client (technically OpenNX) to FreeNX server from an iMac (with Lion), but if I try to connect with a Macbook Pro I get horrible keyboard binding issues. The fix that is working for me is to go into: ~/.nx/config/HOST.nxs and change: <option key="Current keyboard" value="false"/> <option key="Custom keyboard layout" value="empty"/> <option key="Grab keyboard" value="false"/> I have tried this on three NX Servers and all are fixed. Hope it helps or gets you closer. Always check in the ~/.nx/temp/ for the sshlog and see if --keyboard="empty/empty" instead of "pc105/en" because the Mac is really pc104. 9:05:35: startsession --session="HOST" --type="unix-gnome" --cache="8M" --images="32M" --link="adsl" --geometry="2556\ x1396" --screeninfo="2560x1440x32+render" --keyboard="empty/empty" --backingstore="1" --encryption="1" --composite="1" --\ shmem="1" --shpix="1" --streaming="1" --samba="0" --cups="0" --nodelay="1" --defer="0" --client="macosx" --media="0" --st\ rict="0" --aux="1"

    Read the article

  • ASP MVC: Submitting a form with nested user controls

    - by Nigel
    I'm fairly new to ASP MVC so go easy :). I have a form that contains a number of user controls (partial views, as in System.Web.Mvc.ViewUserControl), each with their own view models, and some of those user controls have nested user controls within them. I intended to reuse these user controls so I built up the form using a hierarchy in this way and pass the form a parent view model that contains all the user controls' view models within it. For example: Parent Page (with form and ParentViewModel) -->ChildControl1 (uses ViewModel1 which is passed from ParentViewModel.ViewModel1 property) -->ChildControl2 (uses ViewModel2 which is passed from ParentViewModel.ViewModel2 property) -->ChildControl3 (uses ViewModel3 which is passed from ViewModel2.ViewModel3 property) I hope this makes sense... My question is how do I retrieve the view data when the form is submitted? It seems the view data cannot bind to the ParentViewModel: public string Save(ParentViewModel viewData)... as viewData.ViewModel1 and viewData.ViewModel2 are always null. Is there a way I can perform a custom binding? Ultimately I need the form to be able to cope with a dynamic number of user controls and perform an asynchronous submission without postback. I'll cross those bridges when I come to them but I mention it now so any answer won't preclude this functionality. Many thanks.

    Read the article

  • touchesBegin & touchesMove Xcode Obj C Question

    - by AndrewDK
    So I have my app working good when you press and drag along. I also have UIButtons set to Touch Down in Interface Builder. As well when you drag you need to drag from the outside of the UIButton. You cannot click on the UIButton and drag to the other. TOUCHES MOVED: Code: -(void)touchesMoved:(NSSet *)touches withEvent:(UIEvent *)event { UITouch *touch = [[event touchesForView:self.view] anyObject]; CGPoint location = [touch locationInView:touch.view]; if(CGRectContainsPoint(oneButton.frame, location)) { if (!oneButton.isHighlighted){ [self oneFunction]; [oneButton setHighlighted:YES]; } }else { [oneButton setHighlighted:NO]; } // if(CGRectContainsPoint(twoButton.frame, location)) { if (!twoButton.isHighlighted){ [self twoFunction]; [twoButton setHighlighted:YES]; } }else { [twoButton setHighlighted:NO]; } } TOUCHES BEGAN: Code: - (void) touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event { UITouch *touch = [[event touchesForView:self.view] anyObject]; CGPoint location = [touch locationInView:touch.view]; if(CGRectContainsPoint(oneButton.frame, location)) { [self oneFunction]; [oneButton setHighlighted:YES]; } if(CGRectContainsPoint(twoButton.frame, location)) { [self twoFunction]; [twoButton setHighlighted:YES]; } } I want to be able to click on any of the button fire the function & also be able to drag from one button on to the other and fire that function. So basically just being able to click on a button and slide your finger over and activate the other button without having to press and slide from outside of the button. I think I'm close, need a bit of help. Hope thats clear enough. Thanks.

    Read the article

  • Using a .MDF SQL Server Database with ASP.NET Versus Using SQL Server

    - by Maxim Z.
    I'm currently writing a website in ASP.NET MVC, and my database (which doesn't have any data in it yet, it only has the correct tables) uses SQL Server 2008, which I have installed on my development machine. I connect to the database out of my application by using the Server Explorer, followed by LINQ to SQL mapping. Once I finish developing the site, I will move it over to my hosting service, which is a virtual hosting plan. I'm concerned about whether using the SQL Server setup that is currently working on my development machine will be hard to do on the production server, as I'll have to import all the database tables through the hosting control panel. I've noticed that it is possible to create a SQL Server database from inside Visual Studio. It is then stored in the App_Data directory. My questions are the following: Does it make sense to move my SQL Server DB out of SQL Server and into the App_Data directory as an .mdf file? If so, how can I move it? I believe this is called the Detach command, is it not? Are there any performance/security issues that can occur with a .mdf file like this? Would my intended setup work OK with a typical virtual hosting plan? I'm hoping that the .mdf database won't count against the limited number of SQL Server databases that can be created with my plan. I hope this question isn't too broad. Thanks in advance! Note: I'm just starting out with ASP.NET MVC and all this, so I might be completely misunderstanding how this is supposed to work.

    Read the article

  • ocunit testing on iPhone

    - by Magnus Poromaa
    Hi I am trying to get ocunit working in my project from XCode. Since I also need to debug in the unit tests I am using a script that automates the setup (see below). I just include it in the project under resources and change the name to the .ocunit file I want it to run. The problem I get is that it cant find the bundle file and therefore exists with an error. Can anyone who has a clue about XCode and objective-c take a look at it and tell me what is wrong. Also how am I supposed to produce the .ocunit file that I need to run. By setting up a new unit test target for the iPhone and add tests to it or? Hope someone has a clue since I just started ny iPhone development and need to get it up and running quickly Apple Script -- The only customized value we need is the name of the test bundle tell me to activate tell application "Xcode" activate set thisProject to project of active project document tell thisProject set testBundleName to name of active target set unitTestExecutable to make new executable at end of executables set name of unitTestExecutable to testBundleName set path of unitTestExecutable to "/Applications/TextEdit.app" tell unitTestExecutable -- Add a "-SenTest All" argument make new launch argument with properties {active:true, name:"-SenTest All"} -- Add the magic set injectValue to "$(BUILT_PRODUCTS_DIR)/" & testBundleName & ".octest" make new environment variable with properties {active:true, name:"XCInjectBundle", value:injectValue} make new environment variable with properties {active:true, name:"XCInjectBundleInto", value:"/Applications/TextEdit.app/Contents/MacOS/TextEdit"} make new environment variable with properties {active:true, name:"DYLD_INSERT_LIBRARIES", value:"$(DEVELOPER_LIBRARY_DIR)/PrivateFrameworks/DevToolsBundleInjection.framework/DevToolsBundleInjection"} make new environment variable with properties {active:true, name:"DYLD_FALLBACK_FRAMEWORK_PATH", value:"$(DEVELOPER_LIBRARY_DIR)/Frameworks"} end tell end tell end tell Cheers Magnus

    Read the article

  • Using Java PDFBox library to write Russian PDF

    - by Brad
    Hello , I am using a Java library called PDFBox trying to write text to a PDF. It works perfect for English text, but when i tried to write Russian text inside the PDF the letters appeared so strange. It seems the problem is in the font used, but i am not so sure about that, so i hope if anyone could guide me through this. Here is the important code lines : PDTrueTypeFont font = PDTrueTypeFont.loadTTF( pdfFile, new File( "fonts/VREMACCI.TTF" ) ); // Windows Russian font imported to write the Russian text. font.setEncoding( new WinAnsiEncoding() ); // Define the Encoding used in writing. // Some code here to open the PDF & define a new page. contentStream.drawString( "??????? ????????????" ); // Write the Russian text. The WinAnsiEncoding source code is : Click here --------------------- Edit on 18 November 2009 After some investigation, i am now sure it is an Encoding problem, this could be solved by defining my own Encoding using the helpful PDFBox class called DictionaryEncoding. I am not sure how to use it, but here is what i have tried until now : COSDictionary cosDic = new COSDictionary(); cosDic.setString( COSName.getPDFName("Ercyrillic"), "0420 " ); // Russian letter. font.setEncoding( new DictionaryEncoding( cosDic ) ); This does not work, as it seems i am filling the dictionary in a wrong way, when i write a PDF page using this it appears blank. The DictionaryEncoding source code is : Click here Thanks . . .

    Read the article

  • Differences between iPhone/iPod Simulator and Devices

    - by Allisone
    Hi, since I started iPhone/iPod Development I have come across some differences between how the simulator and how real device react. Maybe I will come across some other differences I will have to figure out as well, maybe other people haven't met these problems here (YET) and can profit from the knowledge, and maybe you know some problems/differences that you would have been happy to know about earlier before you spent several hours or days figuring out what the heck is going on. So here is what I came across. Simulator is not case sensitive, Devices are case sensitive. This means a default.png or Icon.png will work in simulator, but not on a device where they must be named Default.png and icon.png (if it's still not working read this answer) Simulator has different codecs to play audio and video If you use f.e. MPMoviePlayerController you might play certain video on the simulator while on the device it won't work (use Handbrake-presets-iPhone & iPod Touch to create playable videos for Simulator and Device). If you play audio with AudioServicesPlaySystemSound(&soundID) you might here the sound on simulator but not an a device. (use Audacity to open your soundfile, export as wav and run afconvert -f caff -d LEI16@44100 -c 1 audacity.wav output.caf in terminal) Also there is this flickering on second run problem which can be resolved with an playerViewCtrl.initialPlaybackTime = -1.0; either on the end of playing or before each beginning. Simulator is mostly much faster cause it doesn't simulate the hardware but uses Mac resources, therefore f.e. sio2 Apps (OpenGL,OpenAL,etc. framework) run much better on simulator, well everything that uses more resources will run visibly better in simulator than on device. I hope we can add some more to this.

    Read the article

  • django shopping cart as a beginner

    - by Jacques Knie
    Hi, i'm quite new to django and trying to add a shopping cart to a simple webshop. What I need is a simple cart that can be filled and presents its content, which is then sent to the vendor via email. So Satchmo might be too big for this task. Therefore i chose django-cart (http://code.google.com/p/django-cart/) which causes some problems now. 1. Is django-cart the right thing? Or are there any better approaches to this task? 2. As I am a beginner even django-cart makes me struggle. I used the view and the template of the django-cart-website, but writing a form that can be used to add products to the cart took me hours. I probably need help in understanding the general layout of a shopping cart and its integration into a website. 3. Two more specific questions: Is it possible to dynamically populate a formfield in a template (e.g. with {{ object.id }})? Is django-cart able to change (update) the contents of a cart? I hope it's not too many questions at once. Thanks in advance Jacques

    Read the article

  • AS3 microphone recording/saving works, in-flash PCM playback double speed

    - by Lowgain
    I have a working mic recording script in AS3 which I have been able to successfully use to save .wav files to a server through AMF. These files playback fine in any audio player with no weird effects. For reference, here is what I am doing to capture the mic's ByteArray: (within a class called AudioRecorder) public function startRecording():void { _rawData = new ByteArray(); _microphone.addEventListener(SampleDataEvent.SAMPLE_DATA, _samplesCaptured, false, 0, true); } private function _samplesCaptured(e:SampleDataEvent):void { _rawData.writeBytes(e.data); } This works with no problems. After the recording is complete I can take the _rawData variable and run it through a WavWriter class, etc. However, if I run this same ByteArray as a sound using the following code which I adapted from the adobe cookbook: (within a class called WavPlayer) public function playSound(data:ByteArray):void { _wavData = data; _wavData.position = 0; _sound.addEventListener(SampleDataEvent.SAMPLE_DATA, _playSoundHandler); _channel = _sound.play(); _channel.addEventListener(Event.SOUND_COMPLETE, _onPlaybackComplete, false, 0, true); } private function _playSoundHandler(e:SampleDataEvent):void { if(_wavData.bytesAvailable <= 0) return; for(var i:int = 0; i < 8192; i++) { var sample:Number = 0; if(_wavData.bytesAvailable > 0) sample = _wavData.readFloat(); e.data.writeFloat(sample); } } The audio file plays at double speed! I checked recording bitrates and such and am pretty sure those are all correct, and I tried changing the buffer size and whatever other numbers I could think of. Could it be a mono vs stereo thing? Hope I was clear enough here, thanks!

    Read the article

  • How to make Processes Run Parallel in Erlang?

    - by Ankit S
    Hello, startTrains() -> TotalDist = 100, Trains = [trainA,trainB ], PID = spawn(fun() -> train(1,length(Trains)) end), [ PID ! {self(),TrainData,TotalDist} || TrainData <- Trains], receive {_From, Mesg} -> error_logger:info_msg("~n Mesg ~p ~n",[Mesg]) after 10500 -> refresh end. so, I created Two Processes named trainA, trainB. I want to increment these process by 5 till it gets 100. I made different processes to make each of the train (process) increments its position parallely. But I was surprised to get the output sequentially i.e process trainA ends then process trainB starts. But I want to increment themselves at simultaneously. I want to run processes like this trainA 10 trainB 0 trainA 15 trainB 5 .... trainA 100 trainB 100 but I m getting trainA 0 .... trainA 90 trainA 95 trainA 100 trainA ends trainB 0 trainB 5 trainB 10 ..... trainB 100 How to make the processes run parallel/simultaneously? Hope you get my Q's. Please help me.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Android Application is unexpectedly stopped error when button is clicked

    - by user1794499
    Hi there I'm totally new to Android development and I'm working in my android application my application includes a forum where users can post, comment and have their discussion there.... So I'm working in the interface but I get error when I click on the button I directs me to the signup page can somebody please help me with this error this is the code of the mainuserinterface.java for the mainuserinterface.xml file where the button resides. and the signupform.class is the java file for the next activity triggered when the button is clicked the error I receive is the application is unexpectedly stopped.. Hope I make it clear for you guys package com.mohammed.watzIslam; import android.app.Activity; import android.content.Intent; import android.os.Bundle; import android.view.View; import android.widget.Button; public class mainuserinterface extends Activity { @Override protected void onCreate(Bundle savedInstanceState) { // TODO Auto-generated method stub super.onCreate(savedInstanceState); setContentView(R.layout.mainuserinterface); // this is the button where I receive errors when I click Button forum = (Button) findViewById(R.id.next); forum.setOnClickListener(new View.OnClickListener() { public void onClick(View view){ Intent myIntent = new Intent (view.getContext(), signupform.class); startActivityForResult (myIntent, 0); } }); //these two button still not directing to any next activity yet Button button1 = (Button) findViewById(R.id.next); forum.setOnClickListener(new View.OnClickListener() { public void onClick(View view){ Intent myIntent1 = new Intent (view.getContext(), signupform.class); startActivityForResult (myIntent1, 0); } }); Button button2 = (Button) findViewById(R.id.next); forum.setOnClickListener(new View.OnClickListener() { public void onClick(View view){ Intent myIntent2 = new Intent (view.getContext(), signupform.class); startActivityForResult (myIntent2, 0); } }); } }

    Read the article

< Previous Page | 196 197 198 199 200 201 202 203 204 205 206 207  | Next Page >