Search Results

Search found 10640 results on 426 pages for 'apache2 module'.

Page 201/426 | < Previous Page | 197 198 199 200 201 202 203 204 205 206 207 208  | Next Page >

  • Windows 7 - pydoc from cmd

    - by Random_Person
    Okay, I'm having one of those moments that makes me question my ability to use a computer. This is not the sort of question I imagined asking as my first SO post, but here goes. Started on Zed's new "Learn Python the Hard Way" since I've been looking to get back into programming after a 10 year hiatus and python was always what I wanted. This book has really spoken to me. That being said, I'm having a serious issue with pydoc from the command. I've got all the directories in c:/python26 in my system path and I can execute pydoc from the command line just fine regardless of pwd - but it accepts no arguments. Doesn't matter what I type, I just get the standard pydoc output telling me the acceptable arguments. Any ideas? For what it's worth, I installed ActivePython as per Zed's suggestion. C:\Users\Chevee>pydoc file pydoc - the Python documentation tool pydoc.py <name> ... Show text documentation on something. <name> may be the name of a Python keyword, topic, function, module, or package, or a dotted reference to a class or function within a module or module in a package. If <name> contains a '\', it is used as the path to a Python source file to document. If name is 'keywords', 'topics', or 'modules', a listing of these things is displayed. pydoc.py -k <keyword> Search for a keyword in the synopsis lines of all available modules. pydoc.py -p <port> Start an HTTP server on the given port on the local machine. pydoc.py -g Pop up a graphical interface for finding and serving documentation. pydoc.py -w <name> ... Write out the HTML documentation for a module to a file in the current directory. If <name> contains a '\', it is treated as a filename; if it names a directory, documentation is written for all the contents. C:\Users\Chevee> EDIT: New information, pydoc works just fine in PowerShell. As a linux user, I have no idea why I'm trying to use cmd anyways--but I'd still love to figure out what's up with pydoc and cmd. EDIT 2: More new information. In cmd... c:\>python c:/python26/lib/pydoc.py file ...works just fine. Everything works just fine with just pydoc in PowerShell without me worrying about pwd, or extensions or paths.

    Read the article

  • python __import__ problem

    - by Anurag Uniyal
    I have a messages folder(package) with __init__.py file and another module messages_en.py inside it. In __init__.py if I import messages_en it works, but __import__ fails with "ImportError: No module named messages_en" import messages_en # it works messages = __import__('messages_en') # it doesn't ? I used to think 'import x' is just another way of saying __import__('x')

    Read the article

  • How GAE emulator limits list of available Python modules?

    - by Konstantin
    I installed Python Mock module using PIP. When I try to import mock running under 'dev_appserver', GAE says that it can't find module 'mock'. import mock works perfectly in Python interpreter. I understand that dev_appserver behaves absolutely correctly because I can't install modules with PIP on GAE servers. My question is how technically dev_appserver filters list of modules that can be loaded?

    Read the article

  • how can i set the jdk in intellij 9 on mac

    - by Ali_IT
    i have a project on intellij and now i wanna run it on intellinj 9 on mac. when i run the project i get the error - "the JDK is not specifiedfor module "XXXXX" specify the JDK in Configuration project". when i go there in the dependencie for module SDk there is No Project JDk. and when i click on new it is just JSDK, Intellij idea plugin SDK,Flex SDK,AIR SDK, Flexmojos SDk and Mobile SDK what can i do? help me pleaaaaaaaaaaaase

    Read the article

  • Python __import__ parameter confusion

    - by CMC
    I'm trying to import a module, while passing some global variables, but it does not seem to work: File test_1: test_2 = __import__("test_2", {"testvar": 1}) File test_2: print testvar This seems like it should work, and print a 1, but I get the following error when I run test_1: Traceback (most recent call last): File ".../test_1.py", line 1, in <module> print testvar NameError: name 'testvar' is not defined What am I doing wrong?

    Read the article

  • Ruby's autoload not working in 1.8.7 or Ruby Enterprise?

    - by webren
    I've written a gem and within a file I am doing this to autoload my main gem logic: $:.push File.expand_path('lib', __FILE__) require "oa-casport/version" require 'omniauth/core' module OmniAuth module Strategies autoload :Casport, 'omniauth/strategies/casport' end end For Ruby versions 1.8.7 and ree, it prints out "no such file to load - omniauth/strategies/casport' But it doesn't print out this message on version 1.9.2. Is there something off with the location of calling autoload? The repo for the gem is located at https://github.com/stevenhaddox/oa-casport

    Read the article

  • AngularJS service returning promise unit test gives error No more request expected

    - by softweave
    I want to test a service (Bar) that invokes another service (Foo) and returns a promise. The test is currently failing with this error: Error: Unexpected request: GET foo.json No more request expected Here are the service definitions: // Foo service returns new objects having get function returning a promise angular.module('foo', []). factory('Foo', ['$http', function ($http) { function FooFactory(config) { var Foo = function (config) { angular.extend(this, config); }; Foo.prototype = { get: function (url, params, successFn, errorFn) { successFn = successFn || function (response) {}; errorFn = errorFn || function (response) {}; return $http.get(url, {}).then(successFn, errorFn); } }; return new Foo(config); }; return FooFactory; }]); // Bar service uses Foo service angular.module('bar', ['foo']). factory('Bar', ['Foo', function (Foo) { var foo = Foo(); return { getCurrentTime: function () { return foo.get('foo.json', {}, function (response) { return Date.parse(response.data.now); }); } }; }]); Here is my current test: 'use strict'; describe('bar tests', function () { var currentTime, currentTimeInMs, $q, $rootScope, mockFoo, mockFooFactory, Foo, Bar, now; currentTime = "March 26, 2014 13:10 UTC"; currentTimeInMs = Date.parse(currentTime); beforeEach(function () { // stub out enough of Foo to satisfy Bar service: // create mock object with function get: function(url, params, successFn, errorFn) // that promises to return a response with this property // { data: { now: "March 26, 2014 13:10 UTC" }}) mockFoo = { get: function (url, params, successFn, errorFn) { successFn = successFn || function (response) {}; errorFn = errorFn || function (response) {}; // setup deferred promise var deferred = $q.defer(); deferred.resolve({data: { now: currentTime }}); return (deferred.promise).then(successFn, errorFn); } }; // create mock Foo service mockFooFactory = function(config) { return mockFoo; }; module(function ($provide) { $provide.value('Foo', mockFooFactory); }); module('bar'); inject(function (_$q_, _$rootScope_, _Foo_, _Bar_) { $q = _$q_; $rootScope = _$rootScope_; Foo = _Foo_; Bar = _Bar_; }); }); it('getCurrentTime should return currentTimeInMs', function () { Bar.getCurrentTime().then(function (serverCurrentTime) { now = serverCurrentTime; }); $rootScope.$apply(); // resolve Bar promise expect(now).toEqual(currentTimeInMs); }); }); The error is being thrown at $rootScope.$apply(). I also tried using $rootScope.$digest(), but it gives the same error. Thanks in advance for any insight you can give me.

    Read the article

  • logger chain in python

    - by Zaar Hai
    I'm writing python package/module and would like the logging messages mention what module/class/function they come from. I.e. if I run this code: import mymodule.utils.worker as worker w = worker.Worker() w.run() I'd like to logging messages looks like this: 2010-06-07 15:15:29 INFO mymodule.utils.worker.Worker.run <pid/threadid>: Hello from worker How can I accomplish this? Thanks.

    Read the article

  • Use symfony 1.4 without changing apache configuration

    - by aRagnis
    Is it possible to set the /web directory as webroot whithout changing apache configuration file? I tried using the following .htaccess code, but if i go to localhost/module/, it displays 404 error. But if i go to localhost/web/module/ then everything works. <IfModule mod_rewrite.c> RewriteEngine on RewriteRule sf/(.*) lib/vendor/symfony/data/web/sf/$1 [L] RewriteRule ^$ web/ [L] RewriteRule (.*) web/$1 [L] </IfModule>

    Read the article

  • pg.so problem with Ruby in Windows

    - by Alexander
    I have installed the pg module with help of gem install pg Which returned Successfully installed pg-0.8.0-x86-mswin32-60 When a .rb-file looks like this require 'rubygems' require 'pg' I get an LoadError (exception 126) which tells me that it can't find the module C:/Ruby/lib/ruby/gems/1.8/gems/pg-0.8.0-x86-mswin32-60/lib/pg.so. I heard something about that it is a Linux compilation. I'm really stuck so I really welcome suggestions. I have also installed PostgreSQL, I use Windows XP.

    Read the article

  • ruby nested classes and modules

    - by ash34
    Hi, I am familiar with the concept of nesting classes and modules within another module and grouping them in a namespace. What is the idea / purpose behind Nesting classes within another class class A class B def method_B ... end end end 2.Nesting modules within another class class A module c def method_c ... end end end thanks, ash

    Read the article

  • APE engine Mysql push data to channel on insert

    - by Fotis
    Hello, i am working with APE Engine (http://www.ape-project.org) and up until now i had no actual problem. The problem is that i would like to use the MySQL module and push data to a channel each time a row is inserted into a table. I've tried to setup a server side module, i created an SQL query but data is fetched only when the server boots. How can i make this work?

    Read the article

  • How to get all usages/references of control in DotNetNuke?

    - by macias
    Sorry for lame question but I am literally starting with DNN. When you are in admin/design mode you can list all modules used, and when you click on module at the end you will see the list of controls used in this module with info about filename of the source. The problem I have is in reverse -- I already know the filename with source, I would like to list all modules which use this control. How to do it?

    Read the article

  • selecting the first of multiple classes

    - by gleddy
    Not sure if you can do this, but I want to select the first of two classes of an element with jQuery and return it's first class only. <div class="module blue"> I want to return 'module'. tried this: var state = $('body').attr('class').first(); but none of that seems to work, thanks for any advice.

    Read the article

  • Common utility functions for Perl .t tests

    - by zedoo
    Hi I am getting started with Test::More, already have a few .t test scripts. Now I'd like to define a function that will only be used for the tests, but accross different .t files. Where's the best place to put such a function? Define another .t without any tests and require it where needed? (As a sidenote I use the module structure created by Module::Starter)

    Read the article

  • maya2008 win32api 64 bit python

    - by knishua
    how is it possible to run import win32api successfully on a 64bit maya version 2008 following error occurs Error: No module named win32api Traceback (most recent call last): File "", line 1, in ImportError: No module named win32api # I need to get mouse cursor position in python so that i can place window exactly in that position. Is there any other way to get it Brgds, kNish

    Read the article

  • Replacing python docstrings

    - by tomaz
    I have written a epytext to reST markup converter, and now I want to convert all the docstrings in my entire library from epytext to reST format. Is there a smart way to read the all the docstrings in a module and write back the replacements? ps: ast module perhaps?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Getting "uninitialized constant" in Rails app

    - by Robert McCabe
    I'm new to Rails and feeling my way, but this has me stumped. I moved some constants to a separate module ie: module Fns Fclick = "function() { alert(\"You clicked the map.\");}\n" ... end then in my controller added: require "fns" class GeomapController < ApplicationController def index fstring = Fns::Fclick ... end but when I run the server I get: uninitialized constant Fns::Fclick what am I missing?

    Read the article

  • Is it possible to add IPTC data to a JPG using python when no such data already exists?

    - by ventolin
    With the IPTCInfo module under Python (http://snippets.dzone.com/posts/show/768 for more info) it's possible to read, modify and write IPTC info to pictures. However, if a JPG doesn't already have IPTC information, the module simply raises an exception. It doesn't seem to be able to create and add this metadata information itself. What alternatives are there? I've googled for the past hour but to no avail whatsoever.

    Read the article

< Previous Page | 197 198 199 200 201 202 203 204 205 206 207 208  | Next Page >