Search Results

Search found 6199 results on 248 pages for 'fast enumeration'.

Page 202/248 | < Previous Page | 198 199 200 201 202 203 204 205 206 207 208 209  | Next Page >

  • mySQL need to merge fields and get unique rows

    - by jiudev
    i have a database with +1 million rows and the stuktur looks like: CREATE TABLE IF NOT EXISTS `Performance` ( `id` int(11) NOT NULL AUTO_INCREMENT, `CIDs` varchar(100) DEFAULT NULL, `COLOR` varchar(100) DEFAULT NULL, `Name` varchar(255) DEFAULT NULL, `XT` bigint(16) DEFAULT NULL, `MP` varchar(100) DEFAULT NULL, PRIMARY KEY (`id`), KEY `CIDs` (`CIDs`), KEY `COLOR` (`COLOR`), KEY `Name` (`Name`), KEY `XT` (`XT`) ) ENGINE=MyISAM DEFAULT CHARSET=utf8 AUTO_INCREMENT=0 ; insert into `Performance` (`id`, `CIDs`, `COLOR`, `Name`, `XT`, `MP`) VALUES (1, '1253374160', 'test test test test test', 'Load1', '89421331221', ''), (2, '1271672029', NULL, 'Load1', '19421331221', NULL), (3, '1188959688', NULL, 'Load2', '39421331221', NULL), (4, '1271672029', NULL, 'Load3', '49421341221', 'Description'), (5, '1271888888', NULL, 'Load4', '59421331221', 'Description'); The Output should look like: +----+------------+--------------------------+-------------+-------------+-------+-----------+---------+ | id | CIDs | COLOR | XT | MP | Name | PIDs | unqName | +----+------------+--------------------------+-------------+-------------+-------+-----------+---------+ | 1 | 1253374160 | test test test test test | 89421331221 | | Load1 | 1,2 | Load1 | | 3 | 1188959688 | NULL | 39421331221 | NULL | Load2 | 3 | Load2 | | 4 | 1271672029 | NULL | 49421341221 | Description | Load3 | 4,5 | Load3 | +----+------------+--------------------------+-------------+-------------+-------+-----------+---------+ any ideas, how i could do this as fast as possible? I have tried with some group by, but it takes some Minutes :/ Thanks Advance //edit: for the solution with the group by, i needed 4 subquerys :/ //edit2: as requested: select id, CIDs, COLOR, XT, MP, Name, concat(PIDs,",",GROUP_CONCAT(DISTINCT id)) as PIDs, IFNULL(Name,id) as unqName from ( select id, CIDs, COLOR, XT, MP, Name, concat(PIDs,",",GROUP_CONCAT(DISTINCT id)) as PIDs, IFNULL(MP,id) as unqMP from ( select id, CIDs, COLOR, XT, MP, Name, concat(PIDs,",",GROUP_CONCAT(DISTINCT id)) as PIDs, IFNULL(XT,id) as unqXT from ( select id, CIDs, COLOR, XT, MP, Name, GROUP_CONCAT(DISTINCT id) as PIDs, IFNULL(COLOR,id) as unqCOLOR from Performance group by unqCOLOR ) m group by unqXT ) x group by unqMP ) y group by unqName

    Read the article

  • Change NSTimer interval for repeating timer.

    - by user300713
    Hi, I am running a mainLoop in Cocoa using an NSTimer set up like this: mainLoopTimer = [NSTimer scheduledTimerWithTimeInterval:1.0/fps target:self selector:@selector(mainloop) userInfo:nil repeats:YES]; [[NSRunLoop currentRunLoop] addTimer:mainLoopTimer forMode:NSEventTrackingRunLoopMode]; At Program startup I set the timeInterval to 0.0 so that the mainloop runs as fast as possible. Anyways, I would like to provide a function to set the framerate(and thus the time interval of the timer) to a specific value at runtime. Unfortunately as far as I know that means that I have to reinitialize the timer since Cocoa does not provide a function like "setTimerInterval" This is what I tried: - (void)setFrameRate:(float)aFps { NSLog(@"setFrameRate"); [mainLoopTimer invalidate]; mainLoopTimer = nil; mainLoopTimer = [NSTimer scheduledTimerWithTimeInterval:1.0/aFps target:self selector:@selector(mainloop) userInfo:nil repeats:YES]; [[NSRunLoop currentRunLoop] addTimer:mainLoopTimer forMode:NSEventTrackingRunLoopMode]; } but this throws the following error and stops the mainloop: 2010-06-09 11:14:15.868 myTarget[7313:a0f] setFrameRate 2010-06-09 11:14:15.868 myTarget[7313:a0f] * __NSAutoreleaseNoPool(): Object 0x40cd80 of class __NSCFDate autoreleased with no pool in place - just leaking 2010-06-09 11:14:15.869 myTarget[7313:a0f] * __NSAutoreleaseNoPool(): Object 0x40e700 of class NSCFTimer autoreleased with no pool in place - just leaking 0.614628 I also tried to recreate the timer using the "retain" keyword, but that didn't change anything. Any ideas about how to dynamically change the interval of an NSTimer at runtime? Thanks!

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • How can I build something like Amazon S3 in Perl?

    - by Joel G
    I am looking to code a file storage application in perl similar to amazon s3. I already have a amazon s3 clone that I found online called parkplace but its in ruby and is old also isn't built for high loads. I am not really sure what modules and programs I should use so id like some help picking them out. My requirements are listed below (yes I know there are lots but I could start simple then add more once I get it going): Easy API implementation for client side apps. (maybe REST (?) Centralized database server for the USERDB (maybe PostgreSQL (?). Logging of all connections, bandwidth used, well pretty much everything to a centralized server (maybe PostgreSQL again (?). Easy server side configuration (config file(s) stored on the servers). Web based control panel for admin(s) and user(s) to show logs. (could work just running queries from the databases) Fast High Uptime Low memory usage Some sort of load distribution/load balancer (maybe a dns based or pound or perlbal or something else (?). Maybe a cache of some sort (memcached or parlbal or something else (?). Thanks in advance

    Read the article

  • Looking for a .Net ORM

    - by SLaks
    I'm looking for a .Net 3.5 ORM framework with a rather unusual set of requirements: I need to create and alter tables at runtime with schemas defined by my end-users. (Obviously, that wouldn't be strongly-typed; I'm looking for something like a DataTable there) I also want regular strongly-typed partial classes for rows in non-dynamic tables, with custom validation and other logic. (Like normal ORMs) I want to load the entire database (or some entire tables) once, and keep it in memory throughout the life of the (WinForms) GUI. (I have a shared SQL Server with a relatively slow connection) I also want regular LINQ support (like LINQ-to-SQL) for ASP.Net on the shared server (which has a fast connection to SQL Server) In addition to SQL Server, I also want to be able to use a single-file database that would support XCopy deployment (without installing SQL CE on the end-user's machine). (Probably Access or SQLite) Finally, it has to be free (unless it's OpenAccess) I'll probably have to write it myself, as I don't think there is an existing ORM that meets these requirements. However, I don't want to re-invent the wheel if there is one, hence this question. I'm using VS2010, but I don't know when my webhost (LFC) will upgrade to .Net 4.0

    Read the article

  • jquery image hover popup cant detect browser edge and change its direction

    - by Salman
    hi guys i am trying to implement jquery image hover popup but facing a problem when the popup is closer to browser edge it goes beyond its edge i want it to change its direction when it finds that space is not enough to show that popup, i have see this effect in many plugins where popups, tooltips and drop down menus change their direction if they are close to browser window edge can any one guide me in right direction here is the screen shot for reference http://img512.imageshack.us/img512/4990/browseredge.png here is the jquery hover code function imagePreview(){ /* CONFIG */ xOffset = 10; yOffset = 30; // these 2 variable determine popup's distance from the cursor // you might want to adjust to get the right result /* END CONFIG */ $("a.preview").hover(function(e){ this.t = this.title; this.title = ""; var c = (this.t != "") ? "<br>" + this.t : ""; var newName = this.name; //console.log(this.name); newName=newName.replace("/l/","/o/"); //console.log(newName); $("body").append("<p id='preview'><img src='"+ this.name +"' alt='Image preview' style='margin-bottom:5px;'>"+ c +"</p>"); $("#preview img").error(function () { $("#preview img").attr("src" ,newName).css({'width': '400px', 'height': 'auto'}); }); $("#preview") .css("top",(e.pageY - xOffset) + "px") .css("left",(e.pageX + yOffset) + "px") .fadeIn("fast"); }, function(){ this.title = this.t; $("#preview").remove(); }); $("a.preview").mousemove(function(e){ $("#preview") .css("top",(e.pageY - xOffset) + "px") .css("left",(e.pageX + yOffset) + "px"); }); }; any help will be appriciated Thanks Salman

    Read the article

  • Linq to SQL with INSTEAD OF Trigger and an Identity Column

    - by Bob Horn
    I need to use the clock on my SQL Server to write a time to one of my tables, so I thought I'd just use GETDATE(). The problem is that I'm getting an error because of my INSTEAD OF trigger. Is there a way to set one column to GETDATE() when another column is an identity column? This is the Linq-to-SQL: internal void LogProcessPoint(WorkflowCreated workflowCreated, int processCode) { ProcessLoggingRecord processLoggingRecord = new ProcessLoggingRecord() { ProcessCode = processCode, SubId = workflowCreated.SubId, EventTime = DateTime.Now // I don't care what this is. SQL Server will use GETDATE() instead. }; this.Database.Add<ProcessLoggingRecord>(processLoggingRecord); } This is the table. EventTime is what I want to have as GETDATE(). I don't want the column to be null. And here is the trigger: ALTER TRIGGER [Master].[ProcessLoggingEventTimeTrigger] ON [Master].[ProcessLogging] INSTEAD OF INSERT AS BEGIN SET NOCOUNT ON; SET IDENTITY_INSERT [Master].[ProcessLogging] ON; INSERT INTO ProcessLogging (ProcessLoggingId, ProcessCode, SubId, EventTime, LastModifiedUser) SELECT ProcessLoggingId, ProcessCode, SubId, GETDATE(), LastModifiedUser FROM inserted SET IDENTITY_INSERT [Master].[ProcessLogging] OFF; END Without getting into all of the variations I've tried, this last attempt produces this error: InvalidOperationException Member AutoSync failure. For members to be AutoSynced after insert, the type must either have an auto-generated identity, or a key that is not modified by the database after insert. I could remove EventTime from my entity, but I don't want to do that. If it was gone though, then it would be NULL during the INSERT and GETDATE() would be used. Is there a way that I can simply use GETDATE() on the EventTime column for INSERTs? Note: I do not want to use C#'s DateTime.Now for two reasons: 1. One of these inserts is generated by SQL Server itself (from another stored procedure) 2. Times can be different on different machines, and I'd like to know exactly how fast my processes are happening.

    Read the article

  • Rails: Ajax: Changes Onload

    - by Jay Godse
    Hi. I have a web layout of a for that looks something like this <html> <head> </head> <body> <div id="posts"> <div id="post1" class="post" > <!--stuff 1--> </div> <div id="post2" class="post" > <!--stuff 1--> </div> <!-- 96 more posts --> <div id="post99" class="post" > <!--stuff 1--> </div> </div> </body> </html> I would like to be able to load and render the page with a blank , and then have a function called when the page is loaded which goes in and load up the posts and updates the page dynamically. In Rails, I tried using "link_to_remote" to update with all of the elements. I also tweaked the posts controller to render the collection of posts if it was an ajax request (request.xhr?). It worked fine and very fast. However the update of the blank div is triggered by clicking the link. I would like the same action to happen when the page is loaded so that I don't have to put in a link. Is there a Rails Ajax helper or RJS function or something in Rails that I could use to trigger the loading of the "posts" after the page has loaded and rendered (without the posts)? (If putsch comes to shove, I will just copy the generated JS code from the link_to_remote call and have it called from the onload handler on the body).

    Read the article

  • Haskell Linear Algebra Matrix Library for Arbitrary Element Types

    - by Johannes Weiß
    I'm looking for a Haskell linear algebra library that has the following features: Matrix multiplication Matrix addition Matrix transposition Rank calculation Matrix inversion is a plus and has the following properties: arbitrary element (scalar) types (in particular element types that are not Storable instances). My elements are an instance of Num, additionally the multiplicative inverse can be calculated. The elements mathematically form a finite field (??2256). That should be enough to implement the features mentioned above. arbitrary matrix sizes (I'll probably need something like 100x100, but the matrix sizes will depend on the user's input so it should not be limited by anything else but the memory or the computational power available) as fast as possible, but I'm aware that a library for arbitrary elements will probably not perform like a C/Fortran library that does the work (interfaced via FFI) because of the indirection of arbitrary (non Int, Double or similar) types. At least one pointer gets dereferenced when an element is touched (written in Haskell, this is not a real requirement for me, but since my elements are no Storable instances the library has to be written in Haskell) I already tried very hard and evaluated everything that looked promising (most of the libraries on Hackage directly state that they wont work for me). In particular I wrote test code using: hmatrix, assumes Storable elements Vec, but the documentation states: Low Dimension : Although the dimensionality is limited only by what GHC will handle, the library is meant for 2,3 and 4 dimensions. For general linear algebra, check out the excellent hmatrix library and blas bindings I looked into the code and the documentation of many more libraries but nothing seems to suit my needs :-(. Update Since there seems to be nothing, I started a project on GitHub which aims to develop such a library. The current state is very minimalistic, not optimized for speed at all and only the most basic functions have tests and therefore should work. But should you be interested in using or helping out developing it: Contact me (you'll find my mail address on my web site) or send pull requests.

    Read the article

  • CQRS - The query side

    - by mattcodes
    A lot of the blogsphere articles related to CQRS (command query repsonsibility) seperation seem to imply that all screens/viewmodels are flat. e.g. Name, Age, Location Of Birth etc.. and thus the suggestion that implementation wise we stick them into fast read source etc.. single table per view mySQL etc.. and pull them out with something like primitive SqlDataReader, kick that nasty nhibernate ORM etc.. However, whilst I agree that domain models dont mapped well to most screens, many of the screens that I work with are more dimensional, and Im sure this is pretty common in LOB apps. So my question is how are people handling screen where by for example it displays a summary of customer details and then a list of their orders with a [more detail] link etc.... I thought about keeping with the straight forward SQL query to the Query Database breaking off the outer join so can build a suitable ViewModel to View but it seems like overkill? Alternatively (this is starting to feel yuck) in CustomerSummaryView table have a text/big (whatever the type is in your DB) column called Orders, and the columns for the Order summary screen grid are seperated by , and rows by |. Even with XML datatype it still feeel dirty. Any thoughts on an optimal practice?

    Read the article

  • semi dynamic cdn

    - by dwi kristianto
    i'm developing couple of websites using php (directory script, etc.) and wordpress as cms. i need to improve its performance, by using cdn for static files (css, js, images). the problem is, css and javascript files are generated on the fly. i did that due to yahoo and some expert advice to combine the files into one file. also changing basic color of css files. for the time being, i use couple of small vps but still its not fast enough. i already contact maxcdn and the support guy said that they dont have such kind of services. what i need is: a cdn that will serve the request from user/visitor and there's no file in local disk, the cdn will redirect/fetch it from another domain/server. in vps, it could be done easily using combination of .htaccess and php, but NOT in the cdn. most of cdn only support purely static files. is there any such cdn that will server semi-dynamic files?

    Read the article

  • Getting Google results in Java? Need help!

    - by Cris Carter
    Hello. Right now, I'm trying to get the results from Google in Java, by searching for a term. I'm using a desktop program, not an applet. That in itself isn't complicated. but then Google gave me a 403 error. Anyways, I added referrer and User Agent and then it worked. Now, my problem is that I don't get the results page from Google. Instead, I get their script which gets the results page. My code right now simply uses a GET request on "http://www.google.com/search?q=" + Dork; Then it outputs each line. Here is what I get when I run my program: <.!doctype html<.head<.titledork - Google Search<./title<.scriptwindow.google={kEI:"9myaS-Date).getTime()}}};try{}catch(u){}window.google.jsrt_kill=1; align:center}#logo{display:block;overflow:hidden;position:relative;width:103px;height:37px; <./ script<./div Lots of stuff like that. I shortened it (A LOT) and put in dots to fit it here. So my big question is: How do I turn this whole mess into the nice results page I get when searching Google with a browser? Any help would be seriously appreciated, and I really need the answer fast. Also, please keep in mind that I do NOT want to use Google's API for this. Thanks in advance!

    Read the article

  • An implementation of Sharir's or Aurenhammer's deterministic algorithm for calculating the intersect

    - by RGrey
    The problem of finding the intersection/union of 'N' discs/circles on a flat plane was first proposed by M. I. Shamos in his 1978 thesis: Shamos, M. I. “Computational Geometry” Ph.D. thesis, Yale Univ., New Haven, CT 1978. Since then, in 1985, Micha Sharir presented an O(n log2n) time and O(n) space deterministic algorithm for the disc intersection/union problem (based on modified Voronoi diagrams): Sharir, M. Intersection and closest-pair problems for a set of planar discs. SIAM .J Comput. 14 (1985), pp. 448-468. In 1988, Franz Aurenhammer presented a more efficient O(n log n) time and O(n) space algorithm for circle intersection/union using power diagrams (generalizations of Voronoi diagrams): Aurenhammer, F. Improved algorithms for discs and balls using power diagrams. Journal of Algorithms 9 (1985), pp. 151-161. Earlier in 1983, Paul G. Spirakis also presented an O(n^2) time deterministic algorithm, and an O(n) probabilistic algorithm: Spirakis, P.G. Very Fast Algorithms for the Area of the Union of Many Circles. Rep. 98, Dept. Comput. Sci., Courant Institute, New York University, 1983. I've been searching for any implementations of the algorithms above, focusing on computational geometry packages, and I haven't found anything yet. As neither appear trivial to put into practice, it would be really neat if someone could point me in the right direction!

    Read the article

  • Big-O of PHP functions?

    - by Kendall Hopkins
    After using PHP for a while now, I've noticed that not all PHP built in functions as fast as expected. Consider the below two possible implementations of a function that finds if a number is prime using a cached array of primes. //very slow for large $prime_array $prime_array = array( 2, 3, 5, 7, 11, 13, .... 104729, ... ); $result_array = array(); foreach( $array_of_number => $number ) { $result_array[$number] = in_array( $number, $large_prime_array ); } //still decent performance for large $prime_array $prime_array => array( 2 => NULL, 3 => NULL, 5 => NULL, 7 => NULL, 11 => NULL, 13 => NULL, .... 104729 => NULL, ... ); foreach( $array_of_number => $number ) { $result_array[$number] = array_key_exists( $number, $large_prime_array ); } This is because in_array is implemented with a linear search O(n) which will linearly slow down as $prime_array grows. Where the array_key_exists function is implemented with a hash lookup O(1) which will not slow down unless the hash table gets extremely populated (in which case it's only O(logn)). So far I've had to discover the big-O's via trial and error, and occasionally looking at the source code. Now for the question... I was wondering if there was a list of the theoretical (or practical) big O times for all* the PHP built in functions. *or at least the interesting ones For example find it very hard to predict what the big O of functions listed because the possible implementation depends on unknown core data structures of PHP: array_merge, array_merge_recursive, array_reverse, array_intersect, array_combine, str_replace (with array inputs), etc.

    Read the article

  • JAVA vs .NET - Choice for way to go further [closed]

    - by Sarang
    I have my subject .Net acedemically. I also learned core Java and did a project as well. I took training from a Java firm. Now, as a skill I do have knowledge as both language. But, it is creating a large problem to me that, which field I should chhose? Even if having better OOP fundamentals, will it be easier for me to transfer from one to another in the future ? Please suggest me a way. Also, we do have may technologies available at both side, like JSP, JSF, J2ME, Share Point, SilverLight etc. Which is better as per their reliabity point of view? Which are fast growing and useful technologies used mostly in current IT corporate world ? Are they easier to learn at fresher's point of view? Please answer. Perhaps, this answer may help me mostly to create my way to learn them and go further. Every IT developer, please help to find me my way.

    Read the article

  • Cooperative/Non-preemptive threading avoiding threadlooks?

    - by Wayne
    Any creative ideas to avoid deadlocks on a yield or sleep with cooperative/non-preemptive multitasking without doing an O/S Thread.Sleep(10)? Typically the yield or sleep call will call back into the scheduler to run other tasks. But this can sometime produce deadlocks. Some background: This application has enormous need for speed and, so far, it's extremely fast as compared to other systems in the same industry. One of the speed techniques is cooperative/non-preemptive threading rather then the cost of a context switch from O/S threads. The high level design a priority manager which calls out to tasks depending on priority and processing time. Each task does one "iteration" of work and returns to wait its turn again in the priority queue. The tricky thing with non-preemptive threading is what to do when you want to a particular task to stop in the middle of work and wait for some other event from a different task before continuing. In this case, we have 3 tasks, A B and C where A is a controller that must synchronize the activity of B and C. First, A starts both B and C. Then B yields so C gets invoked. When C yields, A sees they are both inactive, decides it's time for B to run but not time for C yet. Well B is now stuck in a yield that has called C, so it can never run. Sincerely, Wayne

    Read the article

  • TextRenderer.DrawText renders Arial differently on XP vs Vista

    - by Michael
    I have a c# application that does text rendering, something on par with a simple wysiwyg text editor. I'm using TextRenderer.DrawText to render the text to the screen and GetTextExtentPoint32 to measure text so I can position different font styles/sizes on the same line. In Vista this all works fine. In XP however, Arial renders differently, certain characters like 'o' and 'b' take up more width than in Vista. GetTextExtentPoint32 seems to be measuring the string as it would in Vista though, with the smaller widths. The end result is that every now and then a run of text will overlap the text preceding it because the preceding text gets measured as smaller than it actually is on the screen. Also, my text rendering code mimics ie's text rendering exactly (for simple formatting and english language only) and ie text rendering seems to be consistent between vista and xp - that's how I noticed the change in size of the different characters. Anyone have any ideas about what's going on? In short, TextRenderer.DrawText and GetTextExtentPoint32 don't match up in xp for Arial. DrawText seems to draw certain characters larger and/or smaller than it does in Vista but GetTextExtentPoint32 seems to be measuring the text as it would in Vista (which seems to match the text rendering in ie on both xp and vista). Hope that makes sense. Note: unfortunately TextRenderer.MeasureString isn't fast or accurate enough to meet my requirements. I tried using it and had to rip it out.

    Read the article

  • Hidden controls, iframes or divs

    - by user287745
    What happens to the controls or the iframe or the div, which are hidden? Do they get transferred to the user side? Disabled: does it get transferred to the user side? What I want is, an aspx page will be having many iframes to display different pages. There will be many div tags to display CSS formatted information. To understand what I mean by many:- I have to transfer a complete website with 30 aspx pages into one single page! I have simply combined everything resulting in one extremely huge page. My concern is that on local host it loads fast, but when on online server accessed by numerous people for education purposes, the site (ONE PAGE) WILL SLOW DOWN terribly. To overcome this I thought of using hidden and disable options. What is an improved way of achieving the above? Yes, it sounds silly but this is the requirement. Edit: Yes, I know id and server tag must be set, but what I am asking will the div tag be sent to the user's browser? One answer is no. So can I enable them using JavaScript? Like document.getElementById(id).style.visibility="visible" What if I disable them, and from coding of JavaScript enable them? Will they be loaded at the time of enabling?

    Read the article

  • Draw Rectangle with XNA

    - by mazzzzz
    Hey guys, I was working on game, and wanted to highlight a spot on the screen when something happens, I created a class to do this for me, and found a bit of code to draw the rectangle static private Texture2D CreateRectangle(int width, int height, Color colori) { Texture2D rectangleTexture = new Texture2D(game.GraphicsDevice, width, height, 1, TextureUsage.None, SurfaceFormat.Color);// create the rectangle texture, ,but it will have no color! lets fix that Color[] color = new Color[width * height];//set the color to the amount of pixels in the textures for (int i = 0; i < color.Length; i++)//loop through all the colors setting them to whatever values we want { color[i] = colori; } rectangleTexture.SetData(color);//set the color data on the texture return rectangleTexture;//return the texture } Problem is that the code above is called every update, (60 times a second), and it was not written with optimization in mind, I have no clue how else to write a code to do this though. It needs to be extremely fast (the code above freezes the game, which has only skeleton code right now).. Any suggestions. Note: Any new code would be great (WireFrame/Fill are both fine). I would like to be able to specify color. Something to point in the right direction would be great, Thanks, Max

    Read the article

  • My OpenCL kernel is slower on faster hardware.. But why?

    - by matdumsa
    Hi folks, As I was finishing coding my project for a multicore programming class I came up upon something really weird I wanted to discuss with you. We were asked to create any program that would show significant improvement in being programmed for a multi-core platform. I’ve decided to try and code something on the GPU to try out OpenCL. I’ve chosen the matrix convolution problem since I’m quite familiar with it (I’ve parallelized it before with open_mpi with great speedup for large images). So here it is, I select a large GIF file (2.5 MB) [2816X2112] and I run the sequential version (original code) and I get an average of 15.3 seconds. I then run the new OpenCL version I just wrote on my MBP integrated GeForce 9400M and I get timings of 1.26s in average.. So far so good, it’s a speedup of 12X!! But now I go in my energy saver panel to turn on the “Graphic Performance Mode” That mode turns off the GeForce 9400M and turns on the Geforce 9600M GT my system has. Apple says this card is twice as fast as the integrated one. Guess what, my timing using the kick-ass graphic card are 3.2 seconds in average… My 9600M GT seems to be more than two times slower than the 9400M.. For those of you that are OpenCL inclined, I copy all data to remote buffers before starting, so the actual computation doesn’t require roundtrip to main ram. Also, I let OpenCL determine the optimal local-worksize as I’ve read they’ve done a pretty good implementation at figuring that parameter out.. Anyone has a clue? edit: full source code with makefiles here http://www.mathieusavard.info/convolution.zip cd gimage make cd ../clconvolute make put a large input.gif in clconvolute and run it to see results

    Read the article

  • Read line and change the line that not consist of certain words and not end with dot

    - by igo
    I wanna read some text files in a folder line by line. for example of 1 txt : Fast and Effective Text Mining Using Linear-time Document Clustering Bjornar Larsen WORD2 Chinatsu Aone SRA International AK, Inc. 4300 Fair Lakes Cow-l Fairfax, VA 22033 {bjornar-larsen, WORD1 I wanna remove line that does not contain of words = word, word2, word3, and does not end with dot . so. from the example, the result will be : Bjornar Larsen WORD2 Chinatsu Aone SRA International, Inc. {bjornar-larsen, WORD1 I am confused, hw to remove the line? it that possible? or can we replace them with a space? here's the code : $url = glob($savePath.'*.txt'); foreach ($url as $file => $files) { $handle = fopen($files, "r") or die ('can not open file'); $ori_content= file_get_contents($files); foreach(preg_split("/((\r?\n)|(\r\n?))/", $ori_content) as $buffer){ $pos1 = stripos($buffer, $word1); $pos2 = stripos($buffer, $word2); $pos3 = stripos($buffer, $word3); $last = $str[strlen($buffer)-1];//read the las character if (true !== $pos1 OR true !== $pos2 OR true !==$pos3 && $last != '.'){ //how to remove } } } please help me, thank you so much :)

    Read the article

  • SQL Where Clause Against View

    - by Adam Carr
    I have a view (actually, it's a table valued function, but the observed behavior is the same in both) that inner joins and left outer joins several other tables. When I query this view with a where clause similar to SELECT * FROM [v_MyView] WHERE [Name] like '%Doe, John%' ... the query is very slow, but if I do the following... SELECT * FROM [v_MyView] WHERE [ID] in ( SELECT [ID] FROM [v_MyView] WHERE [Name] like '%Doe, John%' ) it is MUCH faster. The first query is taking at least 2 minutes to return, if not longer where the second query will return in less than 5 seconds. Any suggestions on how I can improve this? If I run the whole command as one SQL statement (without the use of a view) it is very fast as well. I believe this result is because of how a view should behave as a table in that if a view has OUTER JOINS, GROUP BYS or TOP ##, if the where clause was interpreted prior to vs after the execution of the view, the results could differ. My question is why wouldn't SQL optimize my first query to something as efficient as my second query?

    Read the article

  • Running another process without GUI freezing

    - by Adam
    I'm having trouble getting my GUI to appear and not freeze while running (and waiting for) an outside process. In this case, drivers.exe is a very simply program where the user simply clicks "OK". So whenever I click OK, it exits. I am trying to simply make my status strip count numbers up (really fast) as drivers.exe is executing. But in practice, my GUI never appears at all until drivers.exe exits. private void run_drivers() { Console.WriteLine("Start Driver"); int driver_timeout_in_minutes = 20; System.Diagnostics.Process driverproc = System.Diagnostics.Process.Start(Application.StartupPath + "\\" + "drivers.exe"); driverproc.WaitForExit(driver_timeout_in_minutes * 1000 * 60); //uses milliseconds, we must convert } private void Form1_Load(object sender, EventArgs e) { ThreadStart worker = new ThreadStart(run_drivers); Console.WriteLine("Main - Creating worker thread"); toolStripStatusLabel1.Text = "hi"; Thread t = new Thread(worker); t.IsBackground = true; t.Start(); Console.WriteLine("Main - Have requested the start of worker thread"); int i = 0; while (t.IsAlive) { i++; toolStripStatusLabel1.Text = i.ToString(); } Console.WriteLine("Dead"); }

    Read the article

  • SQL Server Search Proper Names Full Text Index vs LIKE + SOUNDEX

    - by Matthew Talbert
    I have a database of names of people that has (currently) 35 million rows. I need to know what is the best method for quickly searching these names. The current system (not designed by me), simply has the first and last name columns indexed and uses "LIKE" queries with the additional option of using SOUNDEX (though I'm not sure this is actually used much). Performance has always been a problem with this system, and so currently the searches are limited to 200 results (which still takes too long to run). So, I have a few questions: Does full text index work well for proper names? If so, what is the best way to query proper names? (CONTAINS, FREETEXT, etc) Is there some other system (like Lucene.net) that would be better? Just for reference, I'm using Fluent NHibernate for data access, so methods that work will with that will be preferred. I'm using SQL Server 2008 currently. EDIT I want to add that I'm very interested in solutions that will deal with things like commonly misspelled names, eg 'smythe', 'smith', as well as first names, eg 'tomas', 'thomas'. Query Plan |--Parallelism(Gather Streams) |--Nested Loops(Inner Join, OUTER REFERENCES:([testdb].[dbo].[Test].[Id], [Expr1004]) OPTIMIZED WITH UNORDERED PREFETCH) |--Hash Match(Inner Join, HASH:([testdb].[dbo].[Test].[Id])=([testdb].[dbo].[Test].[Id])) | |--Bitmap(HASH:([testdb].[dbo].[Test].[Id]), DEFINE:([Bitmap1003])) | | |--Parallelism(Repartition Streams, Hash Partitioning, PARTITION COLUMNS:([testdb].[dbo].[Test].[Id])) | | |--Index Seek(OBJECT:([testdb].[dbo].[Test].[IX_Test_LastName]), SEEK:([testdb].[dbo].[Test].[LastName] >= 'WHITDþ' AND [testdb].[dbo].[Test].[LastName] < 'WHITF'), WHERE:([testdb].[dbo].[Test].[LastName] like 'WHITE%') ORDERED FORWARD) | |--Parallelism(Repartition Streams, Hash Partitioning, PARTITION COLUMNS:([testdb].[dbo].[Test].[Id])) | |--Index Seek(OBJECT:([testdb].[dbo].[Test].[IX_Test_FirstName]), SEEK:([testdb].[dbo].[Test].[FirstName] >= 'THOMARþ' AND [testdb].[dbo].[Test].[FirstName] < 'THOMAT'), WHERE:([testdb].[dbo].[Test].[FirstName] like 'THOMAS%' AND PROBE([Bitmap1003],[testdb].[dbo].[Test].[Id],N'[IN ROW]')) ORDERED FORWARD) |--Clustered Index Seek(OBJECT:([testdb].[dbo].[Test].[PK__TEST__3214EC073B95D2F1]), SEEK:([testdb].[dbo].[Test].[Id]=[testdb].[dbo].[Test].[Id]) LOOKUP ORDERED FORWARD) SQL for above: SELECT * FROM testdb.dbo.Test WHERE LastName LIKE 'WHITE%' AND FirstName LIKE 'THOMAS%' Based on advice from Mitch, I created an index like this: CREATE INDEX IX_Test_Name_DOB ON Test (LastName ASC, FirstName ASC, BirthDate ASC) INCLUDE (and here I list the other columns) My searches are now incredibly fast for my typical search (last, first, and birth date).

    Read the article

  • First-chance exception at std::set dectructor

    - by bartek
    Hi, I have a strange exception at my class destructor: First-chance exception reading location 0x00000 class DispLst{ // For fast instance existance test std::set< std::string > instances; [...] DispLst::~DispLst(){ this->clean(); DeleteCriticalSection( &instancesGuard ); } <---- here instances destructor raises exception Call stack: X.exe!std::_Tree,std::allocator ,std::less,std::allocator ,std::allocator,std::allocator ,0 ::begin() Line 556 + 0xc bytes C++ X.exe!std::_Tree,std::allocator ,std::less,std::allocator ,std::allocator,std::allocator ,0 ::_Tidy() Line 1421 + 0x64 bytes C++ X.exe!std::_Tree,std::allocator ,std::less,std::allocator ,std::allocator,std::allocator ,0 ::~_Tree,std::allocator ,std::less,std::allocator ,std::allocator,std::allocator ,0 () Line 541 C++ X.exe!std::set,std::allocator ,std::less,std::allocator ,std::allocator,std::allocator ::~set,std::allocator ,std::less,std::allocator ,std::allocator,std::allocator () + 0x2b bytes C++ X.exe!DispLst::~DispLst() Line 82 + 0xf bytes C++ The exact place of error in xtree: void _Tidy() { // free all storage erase(begin(), end()); <------------------- HERE this->_Alptr.destroy(&_Left(_Myhead)); this->_Alptr.destroy(&_Parent(_Myhead)); this->_Alptr.destroy(&_Right(_Myhead)); this->_Alnod.deallocate(_Myhead, 1); _Myhead = 0, _Mysize = 0; } iterator begin() { // return iterator for beginning of mutable sequence return (_TREE_ITERATOR(_Lmost())); <---------------- HERE } What is going on ? I'm using Visual Studio 2008.

    Read the article

< Previous Page | 198 199 200 201 202 203 204 205 206 207 208 209  | Next Page >