Search Results

Search found 35507 results on 1421 pages for 'performance test'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 204/1421 | < Previous Page | 200 201 202 203 204 205 206 207 208 209 210 211  | Next Page >

  • C# Test if an object is an Enum

    - by Aran Mulholland
    I would like to know if 'theObject' is an enum (of any enum type) foreach (var item in Enum.GetValues(theObject.GetType())) { //make sure we have all the enumeration values in the collection if (this.ValuesCollection.Contains(item)) { } else { this.ValuesCollection.Add(item); } Console.WriteLine(item.ToString()); Console.WriteLine(item.GetType().ToString()); }

    Read the article

  • iOS - Application logging test and production code

    - by Peter Warbo
    I am doing a bunch of logging when I'm testing my application which is useful for getting information about variable state and such. However I have read that you should use logging sparsely in production code (because it can potentially slow down your application). But my question is now: if my app is in production and people are using it, whenever a crash (god forbid) occurs, how will I be able to interpret the crash information if I have removed the logging statements? Then I suppose I will only have a stacktrace for me to interpret? Does this mean I should leave logging in production code only WHERE it's really essential for me to interpret what has happened? Also how will the logging statements relate to the crash reports? Will they be combined? I'm thinking of using Flurry as analytics and crash reports...

    Read the article

  • Improve performance writing 10 million records to text file using windows service

    - by user1039583
    I'm fetching more than 10 millions of records from database and writing to a text file. It takes hours of time to complete this operation. Is there any option to use TPL features here? It would be great if someone could get me started implementing this with the TPL. using (FileStream fStream = new FileStream("d:\\file.txt", FileMode.OpenOrCreate, FileAccess.ReadWrite)) { BufferedStream bStream = new BufferedStream(fStream); TextWriter writer = new StreamWriter(bStream); for (int i = 0; i < 100000000; i++) { writer.WriteLine(i); } bStream.Flush(); writer.Flush(); // empty buffer; fStream.Flush(); }

    Read the article

  • Difficulty to start up with basic unit test (Sample from my book -- SportsStore)

    - by Richard77
    Hello, I'm really new in TDD and, actually, I'm trying to follow the sample from my book (SportsStore -- Pro ASP.NET MVC Framework/Steve Sanderson/APRESS). I'm on pages 103-105. Although there are more on this, as new to all of this, I'm concerned with the following statements. ProductsController controller = new ProductsController(repository); var result = controller.List(2); //... regarding the above statements, when I write this (as in the book), var products = result.ViewData.Model as IList<Product>; I get a compiler error "System.Web.MVC.ActionResult" does not contain a definition for ViewData ..." But, when I remove the List() from the statement, then the compiler error disapear. var result = controller.List(2);//Doesn't work var result = controller;//It works Is something wrong there? I checked Apress website for that book, but there is nothing listed as Errata or issue. So I'm really lost. Thanks for helping

    Read the article

  • Problem at JUnit test with generics

    - by Tom Brito
    In my utility method: public static <T> T getField(Object obj, Class c, String fieldName) { try { Field field = c.getDeclaredField(fieldName); field.setAccessible(true); return (T) field.get(obj); } catch (Exception e) { e.printStackTrace(); fail(); return null; } } The line return (T) field.get(obj); gives the warning "Type safety: Unchecked cast from Object to T"; but I cannot perform instanceof check against type parameter T, so what am I suppose to do here?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Mysql select - improve performances

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

    Read the article

  • pyInotify performance

    - by tranimatronic
    I have a very large directory tree I am wanting pyInotify to watch. Is it better to have pyInotify watch the entire tree or is it better to have a number of watches reporting changes to specific files ? Thanks

    Read the article

  • Downloadable HTML Test Corpus

    - by Alex Jordan
    I am working on a browser plug-in for Firefox, and I would like to be able to do some automated testing to make sure that it's handling a variety of different HTML/JavaScript features correctly. Does anyone know of a good downloadable corpus of HTML and/or JavaScript pages that could be used for this type of testing?

    Read the article

  • Test assertions for tuples with floats

    - by Space_C0wb0y
    I have a function that returns a tuple that, among others, contains a float value. Usually I use assertAlmostEquals to compare those, but this does not work with tuples. Also, the tuple contains other data-types as well. Currently I am asserting every element of the tuple individually, but that gets too much for a list of such tuples. Is there any good way to write assertions for such cases?

    Read the article

  • Test sorting through QTP

    - by onkar
    There is a java table in my application which has 1 column & 5 rows. Contents of rows are as below. These contents are arranged in descending order 172-18-zfs MKTLAB NFSVOL datastore1 datastore1(1) after clicking on column header it get sort in asceding order & order is like this datastore1(1) datastore1 NFSVOL MKTLAB 172-18-zfs Through QTP i want to check whether this sortig is correct or not. I have used sort() method of dictionary but it doesnt give expected result. It just sort according to alphabatical order. In expected sorting order 1st priority should be to small letter then to capital letter then to number.

    Read the article

  • one two-directed tcp socket of two one-directed? (linux, high volume, low latency)

    - by osgx
    Hello I need to send (interchange) a high volume of data periodically with the lowest possible latency between 2 machines. The network is rather fast (e.g. 1Gbit or even 2G+). Os is linux. Is it be faster with using 1 tcp socket (for send and recv) or with using 2 uni-directed tcp sockets? The test for this task is very like NetPIPE network benchmark - measure latency and bandwidth for sizes from 2^1 up to 2^13 bytes, each size sent and received 3 times at least (in teal task the number of sends is greater. both processes will be sending and receiving, like ping-pong maybe). The benefit of 2 uni-directed connections come from linux: http://lxr.linux.no/linux+v2.6.18/net/ipv4/tcp_input.c#L3847 3847/* 3848 * TCP receive function for the ESTABLISHED state. 3849 * 3850 * It is split into a fast path and a slow path. The fast path is 3851 * disabled when: ... 3859 * - Data is sent in both directions. Fast path only supports pure senders 3860 * or pure receivers (this means either the sequence number or the ack 3861 * value must stay constant) ... 3863 * 3864 * When these conditions are not satisfied it drops into a standard 3865 * receive procedure patterned after RFC793 to handle all cases. 3866 * The first three cases are guaranteed by proper pred_flags setting, 3867 * the rest is checked inline. Fast processing is turned on in 3868 * tcp_data_queue when everything is OK. All other conditions for disabling fast path is false. And only not-unidirected socket stops kernel from fastpath in receive

    Read the article

  • Stopping cookies being set from a domain (aka "cookieless domain") to increase site performance

    - by Django Reinhardt
    I was reading in Google's documentation about improving site speed. One of their recommendations is serving static content (images, css, js, etc.) from a "cookieless domain": Static content, such as images, JS and CSS files, don't need to be accompanied by cookies, as there is no user interaction with these resources. You can decrease request latency by serving static resources from a domain that doesn't serve cookies. Google then says that the best way to do this is to buy a new domain and set it to point to your current one: To reserve a cookieless domain for serving static content, register a new domain name and configure your DNS database with a CNAME record that points the new domain to your existing domain A record. Configure your web server to serve static resources from the new domain, and do not allow any cookies to be set anywhere on this domain. In your web pages, reference the domain name in the URLs for the static resources. This is pretty straight forward stuff, except for the bit where it says to "configure your web server to serve static resources from the new domain, and do not allow any cookies to be set anywhere on this domain". From what I've read, there's no setting in IIS that allows you to say "serve static resources", so how do I prevent ASP.NET from setting cookies on this new domain? At present, even if I'm just requesting a .jpg from the new domain, it sets a cookie on my browser, even though our application's cookies are set to our old domain. For example, ASP.NET sets an ".ASPXANONYMOUS" cookie that (as far as I'm aware) we're not telling it to do. Apologies if this is a real newb question, I'm new at this! Thanks.

    Read the article

  • one two-directed tcp socket OR two one-directed? (linux, high volume, low latency)

    - by osgx
    Hello I need to send (interchange) a high volume of data periodically with the lowest possible latency between 2 machines. The network is rather fast (e.g. 1Gbit or even 2G+). Os is linux. Is it be faster with using 1 tcp socket (for send and recv) or with using 2 uni-directed tcp sockets? The test for this task is very like NetPIPE network benchmark - measure latency and bandwidth for sizes from 2^1 up to 2^13 bytes, each size sent and received 3 times at least (in teal task the number of sends is greater. both processes will be sending and receiving, like ping-pong maybe). The benefit of 2 uni-directed connections come from linux: http://lxr.linux.no/linux+v2.6.18/net/ipv4/tcp_input.c#L3847 3847/* 3848 * TCP receive function for the ESTABLISHED state. 3849 * 3850 * It is split into a fast path and a slow path. The fast path is 3851 * disabled when: ... 3859 * - Data is sent in both directions. Fast path only supports pure senders 3860 * or pure receivers (this means either the sequence number or the ack 3861 * value must stay constant) ... 3863 * 3864 * When these conditions are not satisfied it drops into a standard 3865 * receive procedure patterned after RFC793 to handle all cases. 3866 * The first three cases are guaranteed by proper pred_flags setting, 3867 * the rest is checked inline. Fast processing is turned on in 3868 * tcp_data_queue when everything is OK. All other conditions for disabling fast path is false. And only not-unidirected socket stops kernel from fastpath in receive

    Read the article

  • Performance implications of finalizers on JVM

    - by Alexey Romanov
    According to this post, in .Net, Finalizers are actually even worse than that. Besides that they run late (which is indeed a serious problem for many kinds of resources), they are also less powerful because they can only perform a subset of the operations allowed in a destructor (e.g., a finalizer cannot reliably use other objects, whereas a destructor can), and even when writing in that subset finalizers are extremely difficult to write correctly. And collecting finalizable objects is expensive: Each finalizable object, and the potentially huge graph of objects reachable from it, is promoted to the next GC generation, which makes it more expensive to collect by some large multiple. Does this also apply to JVMs in general and to HotSpot in particular?

    Read the article

  • Reasonably faster way to traverse a directory tree in Python?

    - by Sridhar Ratnakumar
    Assuming that the given directory tree is of reasonable size: say an open source project like Twisted or Python, what is the fastest way to traverse and iterate over the absolute path of all files/directories inside that directory? I want to do this from within Python (subprocess is allowed). os.path.walk is slow. So I tried ls -lR and tree -fi. For a project with about 8337 files (including tmp, pyc, test, .svn files): $ time tree -fi > /dev/null real 0m0.170s user 0m0.044s sys 0m0.123s $ time ls -lR > /dev/null real 0m0.292s user 0m0.138s sys 0m0.152s $ time find . > /dev/null real 0m0.074s user 0m0.017s sys 0m0.056s $ tree appears to be faster than ls -lR (though ls -R is faster than tree, but it does not give full paths). find is the fastest. Can anyone think of a faster and/or better approach? On Windows, I may simply ship a 32-bit binary tree.exe or ls.exe if necessary. Update 1: Added find

    Read the article

  • handling javaScript alerts when running a selenium test?

    - by Mo
    Hi I am am running some selenium tests(ruby) on my web page and as i enter an invalid characters in to a text box i have the JavaScript throw a alert like so if(isNaN($(this).val()) || Number($(this).val().valueOf() <=0)){ alert("Please Enter A Number"); } how can i handle this alert when its made and close the pop up? i tried to use the wait_for_pop_up() and close() but i think that's only for browser pop up's and not JavaScript alerts. any ideas? thanks

    Read the article

  • LINQ Joins - Performance

    - by Meiscooldude
    I am curious on how exactly LINQ (not LINQ to SQL) is performing is joins behind the scenes in relation to how Sql Server performs joins. Sql Server before executing a query, generates an Execution Plan. The Execution Plan is basically an Expression Tree on what it believes is the best way to execute the query. Each node provides information on whether to do a Sort, Scan, Select, Join, ect. On a 'Join' node in our execution plan, we can see three possible algorithms; Hash Join, Merge Join, and Nested Loops Join. Sql Server will choose which algorithm to for each Join operation based on expected number of rows in Inner and Outer tables, what type of join we are doing (some algorithms don't support all types of joins), whether we need data ordered, and probably many other factors. Join Algorithms: Nested Loop Join: Best for small inputs, can be optimized with ordered inner table. Merge Join: Best for medium to large inputs sorted inputs, or an output that needs to be ordered. Hash Join: Best for medium to large inputs, can be parallelized to scale linearly. LINQ Query: DataTable firstTable, secondTable; ... var rows = from firstRow in firstTable.AsEnumerable () join secondRow in secondTable.AsEnumerable () on firstRow.Field<object> (randomObject.Property) equals secondRow.Field<object> (randomObject.Property) select new {firstRow, secondRow}; SQL Query: SELECT * FROM firstTable fT INNER JOIN secondTable sT ON fT.Property = sT.Property Sql Server might use a Nested Loop Join if it knows there are a small number of rows from each table, a merge join if it knows one of the tables has an index, and Hash join if it knows there are a lot of rows on either table and neither has an index. Does Linq choose its algorithm for joins? or does it always use one?

    Read the article

  • Performance improvement of client server system

    - by Tanuj
    I have a legacy client server system where the server maintains a record of some data stored in a sqlite database. The data is related to monitoring access patterns of files stored on the server. The client application is basically a remote viewer of the data. When the client is launched, it connects to the server and gets the data from the server to display in a grid view. The data gets updated in real time on the server and the view in the client automatically gets refreshed. There are two problems with the current implementation: When the database gets too big, it takes a lot of time to load the client. What are the best ways to deal with this. One option is to maintain a cache at the client side. How to best implement a cache ? How can the server maintain a diff so that it only sends the diff during the refresh cycle. There can be multiple clients and each client needs to display the latest data available on the server. The server is a windows service daemon. Both the client and the server are implemented in C#

    Read the article

  • Use preforker(ruby gem) with supervisor

    - by user1548832
    I also asked same question on stackoverflow.com http://stackoverflow.com/questions/13871169/use-preforkerruby-gem-with-supervisor But, superuser.com might much help to me. Can anyone amswer this? I want to run a server program using preforker ruby gem with supervisor. But error has occured. I wrote a following test program using preforker. #!/usr/bin/env ruby require 'rubygems' require 'preforker' Preforker.new(:app_name => 'test-preforker', :timeout => 60, :workers => 1) do |master| while master.wants_me_alive? do puts "hello" sleep 10 end end.run And a following supervisor config. [program:test-preforker] command=/home/tkono/tmp/test-preforker.rb stdout_logfile_maxbytes=1MB stderr_logfile_maxbytes=1MB stdout_logfile=/var/log/%(program_name)s.log stderr_logfile=/var/log/%(program_name)s.log autorestart=true Then, reload supervisor. # supervisorctl reload Restarted supervisord Here is the log file of supervisor. 2012-12-13 17:50:47,161 CRIT Supervisor running as root (no user in config file) 2012-12-13 17:50:47,163 WARN Included extra file "/etc/supervisor.d/test-preforker.ini" during parsing 2012-12-13 17:50:47,209 INFO RPC interface 'supervisor' initialized 2012-12-13 17:50:47,213 CRIT Server 'unix_http_server' running without any HTTP authentication checking 2012-12-13 17:50:47,215 INFO supervisord started with pid 12437 2012-12-13 17:50:48,231 INFO spawned: 'test-preforker' with pid 12440 2012-12-13 17:50:48,233 INFO exited: test-preforker (exit status 1; not expected) 2012-12-13 17:50:49,248 INFO spawned: 'test-preforker' with pid 12441 2012-12-13 17:50:49,261 INFO exited: test-preforker (exit status 1; not expected) 2012-12-13 17:50:51,267 INFO spawned: 'test-preforker' with pid 12442 2012-12-13 17:50:51,284 INFO exited: test-preforker (exit status 1; not expected) 2012-12-13 17:50:54,305 INFO spawned: 'test-preforker' with pid 12443 2012-12-13 17:50:54,308 INFO exited: test-preforker (exit status 1; not expected) 2012-12-13 17:50:55,311 INFO gave up: test-preforker entered FATAL state, too many start retries too quickly Please tell me what is wrong? A program using preforker cannot run with supervisor? preforker https://github.com/dcadenas/preforker supervisor http://supervisord.org/index.html

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 200 201 202 203 204 205 206 207 208 209 210 211  | Next Page >