Search Results

Search found 6987 results on 280 pages for 'examples'.

Page 207/280 | < Previous Page | 203 204 205 206 207 208 209 210 211 212 213 214  | Next Page >

  • ASP.NET MVC 2: Mechanics behind an Order / Order Line in a edit form

    - by Dr. Zim
    In this question I am looking for links/code to handle an IList<OrderLine> in an MVC 2 edit form. Specifically I am interested in sending a complete order to the client, then posting the edited order back to an object (to persist) using: Html.EditorFor(m = m.orderlines[i]) (where orderlines is an enumerable object) Editing an Order that has multiple order lines (two tables, Order and OrderLine, one to many) is apparently difficult. Is there any links/examples/patterns out there to advise how to create this form that edits an entity and related entities in a single form (in C# MVC 2)? The IList is really throwing me for a loop. Should I have it there (while still having one form to edit one order)? How could you use the server side factory to create a blank OrderLine in the form while not posting the entire form back to the server? I am hoping we don't treat the individual order lines with individual save buttons, deletes, etc. (for example, they may open an order, delete all the lines, then click cancel, which shouldn't have altered the order itself in either the repository nor the database. Example classes: public class ViewModel { public Order order {get;set;} // Only one order } public class Order { public int ID {get;set;} // Order Identity public string name {get;set;} public IList<OrderLine> orderlines {get;set;} // Order has multiple lines } public class OrderLine { public int orderID {get;set;} // references Order ID above public int orderLineID {get;set;} // Order Line identity (need?) public Product refProduct {get;set;} // Product value object public int quantity {get;set;} // How many we want public double price {get;set;} // Current sale price }

    Read the article

  • Which knowledge base/rule-based inference engine to choose for real time Runway incursion prevention

    - by Piligrim
    Hello, we are designing a project that would listen to dialog between airport controllers and pilots to prevent runway incursions (eg. one airplane is taking off while other is crossing the runway). Our professor wants us to use Jena for knowledge base (or anything else but it should be some sort of rule-based engine). Inference is not the main thing in Jena and there's not much documentation and examples of this. So we need an engine that would get messages from pilots as input and output possible risks of incursion or any other error in message protocol. It should be easy to write rules, and should be easy to provide engine with real time data. I image it something like this: A pilot sends a message that he lands on some runway, the system remembers that the runway is busy and no one should cross it If someone is given an instruction to cross this runway, the engine should fire a rule that something is wrong When the pilot sends a message that he left the runway and goes to the gate, the system clears the runway and lets other planes to use it. So is Jena, or prolog or any other rules engine suitable for this? I mean it is suitable, but do we really need to use it? I asked the prof. if we could just keep state of the runway and use some simple checks based on messages we receive and he said that it is not scalable and we need the knowledge base. Can someone give me any advise on which approach to use for this system? If you recommend k.b., then which one should we use? The project is written in java. Thank you.

    Read the article

  • JSONP request using jquery $.getJSON not working on well formed JSON.

    - by Antti
    I'm not sure is it possible now from the url I am trying. Please see this url: http://www.heiaheia.com/voimakaksikko/stats.json It always serves the same padding function "voimakaksikkoStats". It is well formed JSON, but I have not been able to load it from remote server. Does it need some work from the server side or can it be loaded with javascript? I think the problems gotta to have something to with that callback function... JQuery is not requirement, but it would be nice. This (callback=voimakaksikkoStats) returns nothing (firebug - net - response), and alert doesn't fire: $.getJSON("http://www.heiaheia.com/voimakaksikko/stats.json?callback=voimakaksikkoStats", function(data){ alert(data); }) but this (callback=?): $.getJSON("http://www.heiaheia.com/voimakaksikko/stats.json?callback=?", function(data){ alert(data); }) returns: voimakaksikkoStats({"Top5Sports":[],"Top5Tests":{"8":"No-exercise ennuste","1":"Painoindeksi","2":"Vy\u00f6t\u00e4r\u00f6n ymp\u00e4rys","10":"Cooperin testi","4":"Etunojapunnerrus"},"Top5CitiesByTests":[],"Top5CitiesByExercises":[],"ExercisesLogged":0,"Top5CitiesByUsers":[""],"TestsTaken":22,"RegisteredUsers":1}); But I cannot access it... In both examples the alert never fires. Can someone help?

    Read the article

  • I just don't get AudioFileReadPackets

    - by Eric Christensen
    I've tried to write the smallest chunk of code to narrow down a problem. It's now just a few lines and it doesn't work, which makes it pretty clear that I have a fundamental misunderstanding of how to use AudioFileReadPackets. I've read the docs and other examples online, and apparently I'm just not getting. Could you explain it to me? Here's what this block should do: I've previously opened a file. I want to read just one packet - the first one of the file - and then print it. But it crashes on the AudioFileReadPackets line: AudioFileID mAudioFile2; AudioFileOpenURL (audioFileURL, 0x01, 0, &mAudioFile2); UInt32 *audioData2 = (UInt32 *)malloc(sizeof(UInt32) * 1); AudioFileReadPackets(mAudioFile2, false, NULL, NULL, 0, (UInt32*)1, audioData2); NSLog(@"first packet:%i",audioData2[0]); (For clarity, I've stripped out all error handling.) It's the AFRP line that crashes out. (I understand that the third and fourth argument are useful, and in my "real" code, I use them, but they're not required, right? So NULL in this case should work, right?) So then what's going on? Any guidance would be much appreciated. Thanks.

    Read the article

  • Problems with native Win32api RichEdit control and its IRichEditOle interface

    - by Michael
    Hi All! As part of writing custom command (dll with class that implements Interwoven command interface) for one of Interwoven Worksite dialog boxes,I need to extract information from RichEdit textbox. The only connection to the existing dialog box is its HWND handle; Seemingly trivial task , but I got stuck : Using standard win32 api functions (like GetDlgItemText) returns empty string. After using Spy++ I noticed that the dialog box gets IRichEditOle interface and seems to encapsulate the string into OLE object. Here is what I tried to do: IRichEditOle richEditOleObj = null; IntPtr ppv = IntPtr.Zero; Guid guid = new Guid("00020D00-0000-0000-c000-000000000046"); Marshal.QueryInterface(pRichEdit, ref guid, out ppv); richEditOleObj = (IRichEditOle)Marshal.GetTypedObjectForIUnknown(ppv,typeof(IRichEditOle)); judging by GetObjectCount() method of the interface there is exactly one object in the textbox - most likely the string I need to extract. I used GetObject() method and got IOleObject interface via QueryInterface : if (richEditOleObj.GetObject(0, reObject, GetObjectOptions.REO_GETOBJ_ALL_INTERFACES) == 0) //S_OK { IntPtr oleObjPpv = IntPtr.Zero; try { IOleObject oleObject = null; Guid objGuid = new Guid("00000112-0000-0000-C000-000000000046"); Marshal.QueryInterface(reObject.poleobj, ref objGuid, out oleObjPpv); oleObject = (IOleObject)Marshal.GetTypedObjectForIUnknown(oleObjPpv, typeof(IOleObject)); To negate other possibilites I tried to QueryInteface IRichEditOle to ITextDocument but this also returned empty string; tried to send EM_STREAMOUT message and read buffer returned from callback - returned empty buffer. And on this point I got stuck. Googling didn't help much - couldn't find anything that was relevant to my issue - it seems that vast majority of examples on the net about IRichEditOle and RichEdit revolve around inserting bitmap into RichEdit control... Now since I know only basic stuff about COM and OLE , I guess I am missing something important here. I would appreciate any thoughts suggestions or remarks.

    Read the article

  • Custom model validation of dependent properties using Data Annotations

    - by Darin Dimitrov
    Since now I've used the excellent FluentValidation library to validate my model classes. In web applications I use it in conjunction with the jquery.validate plugin to perform client side validation as well. One drawback is that much of the validation logic is repeated on the client side and is no longer centralized at a single place. For this reason I'm looking for an alternative. There are many examples out there showing the usage of data annotations to perform model validation. It looks very promising. One thing I couldn't find out is how to validate a property that depends on another property value. Let's take for example the following model: public class Event { [Required] public DateTime? StartDate { get; set; } [Required] public DateTime? EndDate { get; set; } } I would like to ensure that EndDate is greater than StartDate. I could write a custom validation attribute extending ValidationAttribute in order to perform custom validation logic. Unfortunately I couldn't find a way to obtain the model instance: public class CustomValidationAttribute : ValidationAttribute { public override bool IsValid(object value) { // value represents the property value on which this attribute is applied // but how to obtain the object instance to which this property belongs? return true; } } I found that the CustomValidationAttribute seems to do the job because it has this ValidationContext property that contains the object instance being validated. Unfortunately this attribute has been added only in .NET 4.0. So my question is: can I achieve the same functionality in .NET 3.5 SP1? UPDATE: It seems that FluentValidation already supports clientside validation and metadata in ASP.NET MVC 2. Still it would be good to know though if data annotations could be used to validate dependent properties.

    Read the article

  • COM Exceptions in C#

    - by Yaron Naveh
    I am consuming a cpp COM object from c# code. My c# code looks like this: try { var res = myComServer.GetSomething(); } catch (Exception e) { } However the exception never contains any of the details I set in cpp, in particular my error message. In my cpp side I have followed several examples I have found on the web: ... ICreateErrorInfo *pcerrinfo; IErrorInfo *perrinfo; HRESULT hr; hr = CreateErrorInfo(&pcerrinfo); pcerrinfo->SetDescription(L"C++ Exception"); hr = pcerrinfo->QueryInterface(IID_IErrorInfo, (LPVOID FAR*) &perrinfo); if (SUCCEEDED(hr)) { SetErrorInfo(0, perrinfo); perrinfo->Release(); } pcerrinfo->Release(); return E_FAIL; // E_FAIL or other appropriate failure code ... Am I missing anything? Is there anything else that could affect this, like marshaling, the interop creation or attributes of the com server itself?

    Read the article

  • How to explain to someone that a data structure should not draw itself, explaining separation of con

    - by leeand00
    I have another programmer who I'm trying to explain why it is that a UI component should not also be a data-structure. For instance say that you get a data-structure that contains a record-set from the "database", and you wish to display that record-set in a UI component within your application. According to this programmer (who will remain nameless, he's young and I'm teaching him...), we should subclass the data-structure into a class that will draw the UI component within our application!!!!!! And thus according to this logic, the record-set should manage the drawing of the UI. **Head Desk*** I know that asking a record-set to draw itself is wrong, because, if you wish to render the same data-structure on more than one type of component on your UI, you are going to have a real mess on your hands; you'll need to extend yet another class for each and every UI component that you render from the base-class of your record-set; I am well aware of the "cleanliness" of the of the MVC pattern (and by that what I really mean is you don't confuse your data (the Model) with your UI (the view) or the actions that take place on the data (the Controller more or less...okay not really the API should really handle that...and the Controller should just make as few calls to it as it can, telling it which view to render)) But it's certainly alot cleaner than using data-structures to render UI components! Is there any other advice I could send his way other than the example above? I understand that when you first learn OOP you go through "a stage" where you where just want to extend everything. Followed by a stage when you think that Design Patterns are the solution every single problem...which isn't entirely correct either...thanks Jeff. Is there a way that I can gently nudge this kid in the right direction? Do you have any more examples that might help explain my point to him?

    Read the article

  • Database warehoue design: fact tables and dimension tables

    - by morpheous
    I am building a poor man's data warehouse using a RDBMS. I have identified the key 'attributes' to be recorded as: sex (true/false) demographic classification (A, B, C etc) place of birth date of birth weight (recorded daily): The fact that is being recorded My requirements are to be able to run 'OLAP' queries that allow me to: 'slice and dice' 'drill up/down' the data and generally, be able to view the data from different perspectives After reading up on this topic area, the general consensus seems to be that this is best implemented using dimension tables rather than normalized tables. Assuming that this assertion is true (i.e. the solution is best implemented using fact and dimension tables), I would like to see some help in the design of these tables. 'Natural' (or obvious) dimensions are: Date dimension Geographical location Which have hierarchical attributes. However, I am struggling with how to model the following fields: sex (true/false) demographic classification (A, B, C etc) The reason I am struggling with these fields is that: They have no obvious hierarchical attributes which will aid aggregation (AFAIA) - which suggest they should be in a fact table They are mostly static or very rarely change - which suggests they should be in a dimension table. Maybe the heuristic I am using above is too crude? I will give some examples on the type of analysis I would like to carryout on the data warehouse - hopefully that will clarify things further. I would like to aggregate and analyze the data by sex and demographic classification - e.g. answer questions like: How does male and female weights compare across different demographic classifications? Which demographic classification (male AND female), show the most increase in weight this quarter. etc. Can anyone clarify whether sex and demographic classification are part of the fact table, or whether they are (as I suspect) dimension tables.? Also assuming they are dimension tables, could someone elaborate on the table structures (i.e. the fields)? The 'obvious' schema: CREATE TABLE sex_type (is_male int); CREATE TABLE demographic_category (id int, name varchar(4)); may not be the correct one.

    Read the article

  • express+jade: provided local variable is undefined in view (node.js + express + jade)

    - by Jake
    Hello. I'm implementing a webapp using node.js and express, using the jade template engine. Templates render fine, and can access helpers and dynamic helpers, but not local variables other than the "body" local variable, which is provided by express and is available and defined in my layout.jade. This is some of the code: app.set ('view engine', 'jade'); app.get ("/test", function (req, res) { res.render ('test', { locals: { name: "jake" } }); }); and this is test.jade: p hello =name when I remove the second line (referencing name), the template renders correctly, showing the word "hello" in the web page. When I include the =name, it throws a ReferenceError: 500 ReferenceError: Jade:2 NaN. 'p hello' NaN. '=name' name is not defined NaN. 'p hello' NaN. '=name' I believe I'm following the jade and express examples exactly with respect to local variables. Am I doing something wrong, or could this be a bug in express or jade?

    Read the article

  • Right to Left UI in iPhone (Hebrew)

    - by Reflog
    Hello, I'm struggling in creating a RTL UI in iPhone application. The framework doesn't seem to have any support for RTL languages. The only thing is the alignment inside labels, which is nice, but it conflicts with other controls behaviour. The question is: Is there a working code for a RTL TableView? Something that would handle the disclosure buttons to be on the left, section titles to be right aligned, index view to be left aligned? As far as I understand I cannot move the index view of the tableview, i have to overlay some custom control... Any suggestions/pointers/examples? p.s. this is not a duplication of this question: http://stackoverflow.com/questions/1677988/right-to-left-alignment-for-uitableview since what I am looking for is a deeper customization, not just a new type of CellView. (Update: Mar 10) For now - I've removed support for indexView from the tableView at all, implemented the cells as custom views by myself (with disclosure buttons on the left), and customized the header/footer of the table as well. the only thing that is left is the Index View. Thanks in advance!

    Read the article

  • Extremely slow MFMailComposeViewControllerDelegate

    - by Jeff B
    I have a bit of a strange problem. I am trying to send in-app email. I am also using Cocos2d. It works, so far as I get the mail window and I can send mail, but it is extremely slow. It seems to only accept touches every second or so. I checked the cpu usage, and it is quite low. I paused my director, so nothing else should be happening. Any ideas? I am pulling my hair out. I looked at some examples and did the following: Made my scene the mail delegate: @interface MyLayer : CCLayer <MFMailComposeViewControllerDelegate> { ... } And implemented the following function in the scenes: -(void) showEmailWindow: (id) sender { [[CCDirector sharedDirector] pause]; MFMailComposeViewController *picker = [[MFMailComposeViewController alloc] init]; picker.mailComposeDelegate = self; [picker setSubject: @"My subject here"]; NSString *emailBody = @"<h1>Here is my email!</h1>"; [picker setMessageBody:emailBody isHTML:YES]; [myMail presentModalViewController:picker animated:NO]; [picker release]; } I also implemented the mailComposeController, to handle the callback.

    Read the article

  • ASP.NET MVC Using Castle Windsor IoC

    - by Mad Halfling
    I have an app, modelled on the one from Apress Pro ASP.NET MVC that uses castle windsor's IoC to instantiate the controllers with their respective repositories, and this is working fine e.g. public class ItemController : Controller { private IItemsRepository itemsRepository; public ItemController(IItemsRepository windsorItemsRepository) { this.itemsRepository = windsorItemsRepository; } with using System; using System.Collections.Generic; using System.Linq; using System.Web; using System.Web.Mvc; using Castle.Windsor; using Castle.Windsor.Configuration.Interpreters; using Castle.Core.Resource; using System.Reflection; using Castle.Core; namespace WebUI { public class WindsorControllerFactory : DefaultControllerFactory { WindsorContainer container; // The constructor: // 1. Sets up a new IoC container // 2. Registers all components specified in web.config // 3. Registers all controller types as components public WindsorControllerFactory() { // Instantiate a container, taking configuration from web.config container = new WindsorContainer(new XmlInterpreter(new ConfigResource("castle"))); // Also register all the controller types as transient var controllerTypes = from t in Assembly.GetExecutingAssembly().GetTypes() where typeof(IController).IsAssignableFrom(t) select t; foreach (Type t in controllerTypes) container.AddComponentWithLifestyle(t.FullName, t, LifestyleType.Transient); } // Constructs the controller instance needed to service each request protected override IController GetControllerInstance(Type controllerType) { return (IController)container.Resolve(controllerType); } } } controlling the controller creation. I sometimes need to create other repository instances within controllers, to pick up data from other places, can I do this using the CW IoC, if so then how? I have been playing around with the creation of new controller classes, as they should auto-register with my existing code (if I can get this working, I can register them properly later) but when I try to instantiate them there is an obvious objection as I can't supply a repos class for the constructor (I was pretty sure that was the wrong way to go about it anyway). Any help (especially examples) would be much appreciated. Cheers MH

    Read the article

  • Importing MEF-Plugins into MVC Controllers

    - by Marks
    Hello. There are several examples of using MEF to plugin whole controller/view packages into a MVC application, but i didn't found one, using MEF to plugin funcional parts, used by other controllers. For example, think of a NewsService with a simple interface like interface INewsService { List<NewsItem> GetAllNews(); } That gets news wherever he wants, and returns them in a List of NewsItems. My page should load an exported INewsService and show the news on the page. But there is the problem. I cant just use [Import] in the controllers, as they are just created when they are needed. Edit: (Importing them to the main MVCApplication class doesn't work, becouse i cant access it from the controllers.) I think i found a way to access the main app via HttpContext.ApplicationInstance. But the Service object in this instance is null although it was created successfully in the Application_Start() method. Any idea why? So, how can i access the NewsService from within a controller? Thanks in advance, Marks

    Read the article

  • How do I create a .NET Web Service that Posts items to a users Facebook Wall?

    - by Jourdan
    I'm currently toying around with the Clarity .NET Facebook API but am finding certain situations with authentication to be kind of limiting. I keep going through the tutorials but always end up hitting a brick wall with what I want to do. Perhaps I just cannot do it? I want to make a Web Service that takes in the require credentials (APIKey, SecretKey, UsersId (or Session Key?) and whatever else I would need), and then do various tasks: Post to users wall, add events etc. The problem I am having is this: The current documentation, examples and support provide a way to do this within the context of a Web site. Within this context, the required "connect" popup can be initiated and allow the user to authenticate and and connect the application. From that point on the Web can go on with its business to do what it needs to do. If I close the browser and come back to the page, I have to push the connect button again. Except this time, since I was already logged into facebook, I don't have to go through the whole connection process. But still ... How do applications like Tweetdeck get around this? They seemingly have you connect once, when you install their application, and you don't have to do it again. I would assume that this same idea would have to applied towards making a web service because: You don't know what context the user is in when making the Web service call. The web service methods being called could be coming from a Windows Form app, or code behind in a workflow.

    Read the article

  • Help! I've learned jQuery... now I want to learn JavaScript

    - by Derek Adair
    I am a self-taught web developer/programmer. I started out about two years ago by learning how to make simple dynamic websites with HTML/CSS/PHP. Then I started dabbling with animation... Enter jQuery I've become quite proficient with jQuery over the last year and I've even started making my own plugins. I've spent most of my effort learning how to beautify websites with fancy effects and what not. Upon tackling my first full-blown application, I realized how under-developed my knowledge of JavaScript actually is. jQuery has allowed me to rely on its framework so heavily that I rarely use any interesting functions, techniques, or whatever that are 'native' to the JavaScript language. For example: I have a basic understanding of what a closure is... but I am unsure where this technique can actually benefit me. Although as I understand it, that's what my jQuery plugins do with (function ($){//plugin code here})(jQuery). I've seen many posts/blogs/whatever about memory leaks and circular references which is concerning. I'm frustrated because I can wrap my head around the basic concepts of what these are just by reading the articles, but I'm finding that the deeper I go the more I don't understand. The vocabulary alone is burdensome. Let alone how to actually use these techniques/functions/language features. I am trying to figure out what I don't know I'm looking to gather any advice, techniques, articles, books, videos, snippets, examples, potential pitfalls... really anything you have regarding application development with JavaScript/jQuery.

    Read the article

  • Optimizing code using PIL

    - by freakazo
    Firstly sorry for the long piece of code pasted below. This is my first time actually having to worry about performance of an application so I haven't really ever worried about performance. This piece of code pretty much searches for an image inside another image, it takes 30 seconds to run on my computer, converting the images to greyscale and other changes shaved of 15 seconds, I need another 15 shaved off. I did read a bunch of pages and looked at examples but I couldn't find the same problems in my code. So any help would be greatly appreciated. From the looks of it (cProfile) 25 seconds is spent within the Image module, and only 5 seconds in my code. from PIL import Image import os, ImageGrab, pdb, time, win32api, win32con import cProfile def GetImage(name): name = name + '.bmp' try: print(os.path.join(os.getcwd(),"Images",name)) image = Image.open(os.path.join(os.getcwd(),"Images",name)) except: print('error opening image;', name) return image def Find(name): image = GetImage(name) imagebbox = image.getbbox() screen = ImageGrab.grab() #screen = Image.open(os.path.join(os.getcwd(),"Images","Untitled.bmp")) YLimit = screen.getbbox()[3] - imagebbox[3] XLimit = screen.getbbox()[2] - imagebbox[2] image = image.convert("L") Screen = screen.convert("L") Screen.load() image.load() #print(XLimit, YLimit) Found = False image = image.getdata() for y in range(0,YLimit): for x in range(0,XLimit): BoxCoordinates = x, y, x+imagebbox[2], y+imagebbox[3] ScreenGrab = screen.crop(BoxCoordinates) ScreenGrab = ScreenGrab.getdata() if image == ScreenGrab: Found = True #print("woop") return x,y if Found == False: return "Not Found" cProfile.run('print(Find("Login"))')

    Read the article

  • Doctrine2 ArrayCollection

    - by boosis
    Ok, I have a User entity as follows <?php class User { /** * @var integer * @Id * @Column(type="integer") * @GeneratedValue */ protected $id; /** * @var \Application\Entity\Url[] * @OneToMany(targetEntity="Url", mappedBy="user", cascade={"persist", "remove"}) */ protected $urls; public function __construct() { $this->urls = new \Doctrine\Common\Collections\ArrayCollection(); } public function addUrl($url) { // This is where I have a problem } } Now, what I want to do is check if the User has already the $url in the $urls ArrayCollection before persisting the $url. Now some of the examples I found says we should do something like if (!$this->getUrls()->contains($url)) { // add url } but this doesn't work as this compares the element values. As the $url doesn't have id value yet, this will always fail and $url will be dublicated. So I'd really appreciate if someone could explain how I can add an element to the ArrayCollection without persisting it and avoiding the duplication? Edit I have managed to achive this via $p = function ($key, $element) use ($url) { if ($element->getUrlHash() == $url->getUrlHash()) { return true; } else { return false; } }; But doesn't this still load all urls and then performs the check? I don't think this is efficient as there might be thousands of urls per user.

    Read the article

  • Can a single developer still make money with shareware?

    - by Wouter van Nifterick
    I'm wondering if the shareware concept is dead nowadays. Like most developers, I've built up quite a collection of self-made tools and code libraries that help me to be productive. Some examples to give you an idea of the type of thing I'm talking about: A self-learning program that renames and orders all my mp3 files and adds information to the id3 tags; A Delphi component that wraps the Google Maps API; A text-to-singing-voice converter for musical purposes; A program to control a music synthesizer; A Gps-log <- KML <- ESRI-shapefile converter; I've got one of these already freely downloadable on my website, and on average it gets downloaded about a 150 times per month. Let's say I'd start charging 15 euro's for it; would there actually be people who buy it? How many? What would it depend on? If I could get some money for some of these, I'd finish them up a bit and put them online, but without that, I probably won't bother. Maintaining a SourceForge project is not very rewarding by itself. Is there anyone who is making money with shareware? How much? Any tips?

    Read the article

  • WPF DataValidation on a DataTemplate object in an ItemsControl

    - by Matt H.
    I have two datatemplates, both very similar... here is one of them: <DataTemplate x:Key="HeadingTemplate"> <Grid x:Name="mainHeadingGrid" Margin="5,5,30,0" HorizontalAlignment="Stretch"> <Grid.ColumnDefinitions> <ColumnDefinition Width="Auto" /> <ColumnDefinition /> </Grid.ColumnDefinitions> <TextBlock Grid.Column="1" Margin="30,3,10,0" Foreground="Black" FontWeight="Bold" HorizontalAlignment="Left" TextWrapping="Wrap"> <TextBlock.Text> <MultiBinding Converter="{StaticResource myHeadingConverter}" ConverterParameter="getRNHeadingTitle" Mode="TwoWay"> <Binding Path="num"/> <Binding Path="name"/> </MultiBinding> </TextBlock.Text> </TextBlock> <TextBox Grid.Column="1" Text="{Binding Path=moreInfo}"/> </Grid> </DataTemplate> I use an selector in my ItemsControl to choose between the two, based on the object it is bound to. I want to use validation to check through all of the properties and put a big exclamation point in front of the whole datatemplate as it is displayed in the itemscontrol. how do I do this? All of the examples I've found explain how to set a ValidationRule on a specific control in the datatemplate, in that control's binding. I want to apply my validation rule to the entire template... Help! :)

    Read the article

  • Loading a javascript library in javax.script?

    - by Shane
    I want to run Protovis javascript from Java and get the evaluated SVG code. I am using javax.script.* to run the Javascript: public static void EvalScript() throws Exception { ScriptEngineManager factory = new ScriptEngineManager(); ScriptEngine engine = factory.getEngineByName("JavaScript"); Object result = engine.eval("var vis = new pv.Panel().width(300).height(300) .add (pv.Line).data ([1,0.5, 0.1, 0.01, 0.001, 0.3, 0.2,0.1,1]) .left (function () { return this.index * 30; }) .bottom (function (d) { return d * 250; }); vis.root.render(); vis.scene[0].canvas.innerHTML;"); System.out.println(result); } This would complain because I never loaded Protovis itself, as would ordinarily be done with <script type="text/javascript" src="../protovis-r3.1.0.js"></script> Is there a good way, short of sourcing in the full Javascript into the eval() command, of loading a library when running Javascript through javax.script? (Incidentally, I know of examples that use Rhino to do this from the Google discussion group.)

    Read the article

  • Getting text between quotes using regular expression

    - by Camsoft
    I'm having some issues with a regular expression I'm creating. I need a regex to match against the following examples and then sub match on the first quoted string: Input strings ("Lorem ipsum dolor sit amet, consectetur adipiscing elit.") ('Lorem ipsum dolor sit amet, consectetur adipiscing elit. ') ('Lorem ipsum dolor sit amet, consectetur adipiscing elit. ', 'arg1', "arg2") Must sub match Lorem ipsum dolor sit amet, consectetur adipiscing elit. Regex so far: \((["'])([^"']+)\1,?.*\) The regex does a sub match on the text between the first set of quotes and returns the sub match displayed above. This is almost working perfectly, but the problem I have is that if the quoted string contains quotes in the text the sub match stops at the first instance, see below: Failing input strings ("Lorem ipsum dolor \"sit\" amet, consectetur adipiscing elit.") Only sub matches: Lorem ipsum dolor ("Lorem ipsum dolor 'sit' amet, consectetur adipiscing elit.") The entire match fails. Notes The input strings are actually php code function calls. I'm writing a script that will scan .php source files for a specific function and grab the text from the first parameter.

    Read the article

  • Updating Database from DataSet

    - by clawson
    I am having trouble updating my Database from my code using a DataSet. I'm using SQL Server 2008 and Visual Studio 2008. Here is what I've done so far. I have created a table in SQL Server called MyTable which has two columns: id nchar(10), and name nchar(50). I have then created a datasource in my VB.net project that consists of this table using the dataset wizard and called this dataset MyDataSet. I run the following code on a button click: Try Dim myDataSet As New MyDataSet Dim newRow As MyDataSet.MyTableRow = myDataSet.MyTable.NewMyTableRow newRow.id = "1" newRow.name = "Alpha" myDataSet.MyTable.AddMyTableRow(newRow) myDataSet.AcceptChanges() Catch ex As Exception MsgBox(ex.Message) End Try when I run this and check the rows in SQL Server it returns 0 rows What have I missed? How can I add these rows / save changes in a dataset to the database? I have seen other examples that use a TableAdapter but I don't think I want to do this, I think I should be able to achieve this just using a DataSet. Am I mistaken? Help is greatly appreciated!

    Read the article

  • Compute the Length of Largest substring that starts and ends with the same substring

    - by Deepak
    Hi People, Below is the Problem Statement: PS: Given a string and a non-empty substring sub, compute recursively the largest substring which starts and ends with sub and return its length. Examples: strDist("catcowcat", "cat") ? 9 strDist("catcowcat", "cow") ? 3 strDist("cccatcowcatxx", "cat") ? 9 Below is my Code: (Without recursion)//since i found it hard to implement with recursion. public int strDist(String str, String sub){ int idx = 0; int max; if (str.isEmpty()) max = 0; else max=1; while ((idx = str.indexOf(sub, idx)) != -1){ int previous=str.indexOf(sub, idx); max = Math.max(max,previous); idx++; } return max; } Its working for few as shown below but returns FAIL for others. Expected This Run strDist("catcowcat", "cat") ? 9 6 FAIL strDist("catcowcat", "cow") ? 3 3 OK strDist("cccatcowcatxx", "cat") ? 9 8 FAIL strDist("abccatcowcatcatxyz", "cat") ? 12 12 OK strDist("xyx", "x") ? 3 2 FAIL strDist("xyx", "y") ? 1 1 OK strDist("xyx", "z") ? 0 1 FAIL strDist("z", "z") ? 1 1 OK strDist("x", "z") ? 0 1 FAIL strDist("", "z") ? 0 0 OK strDist("hiHellohihihi", "hi") ? 13 11 FAIL strDist("hiHellohihihi", "hih") ? 5 9 FAIL strDist("hiHellohihihi", "o") ? 1 6 FAIL strDist("hiHellohihihi", "ll") ? 2 4 FAIL Could you let me whats wrong with the code and how to return the largest substring that begins and ends with sub with its respective length.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

< Previous Page | 203 204 205 206 207 208 209 210 211 212 213 214  | Next Page >