Search Results

Search found 20755 results on 831 pages for 'click counting'.

Page 21/831 | < Previous Page | 17 18 19 20 21 22 23 24 25 26 27 28 | Next Page >

data structure for counting frequencies in a database table-like format

- by user373312

i was wondering if there is a data structure optimized to count frequencies against data that is stored in a database table-like format. for example, the data comes in a (comma) delimited format below. col1, col2, col3 x, a, green x, b, blue ... y, c, green now i simply want to count the frequency of col1=x or col1=x and col2=green. i have been storing the data in a database table, but in my profiling and from empirical observation, database connection is the bottle-neck. i have tried using in-memory database solutions too, and that works quite well; the only problem is memory requirements and quirky init/destroy calls. also, i work mainly with java, but have experience with .net, and was wondering if there was any api to work with "tabular" data in a linq way using java. any help is appreciated.

Read the article
Code Golf: Counting XML elements in file on Android

- by CSharperWithJava

Take a simple XML file formatted like this: <Lists> <List> <Note/> ... <Note/> </List> <List> <Note/> ... <Note/> </List> </Lists> Each node has some attributes that actually hold the data of the file. I need a very quick way to count the number of each type of element, (List and Note). Lists is simply the root and doesn't matter. I can do this with a simple string search or something similar, but I need to make this as fast as possible. Design Parameters: Must be in java (Android application). Must AVOID allocating memory as much as possible. Must return the total number of Note elements and the number of List elements in the file, regardless of location in file. Number of Lists will typically be small (1-4), and number of notes can potentially be very large (upwards of 1000, typically 100) per file. I look forward to your suggestions.

Read the article
Ruby: counters, counting and incrementing

- by Shyam

Hi, If you have seen my previous questions, you'd already know I am a big nuby when it comes to Ruby. So, I discovered this website which is intended for C programming, but I thought whatever one can do in C, must be possible in Ruby (and more readable too). The challenge is to print out a bunch of numbers. I discovered this nifty method .upto() and I used a block (and actually understanding its purpose). However, in IRb, I got some unexpected behavior. class MyCounter def run 1.upto(10) { |x| print x.to_s + " " } end end irb(main):033:0> q = MyCounter.new => #<MyCounter:0x5dca0> irb(main):034:0> q.run 1 2 3 4 5 6 7 8 9 10 => 1 I have no idea where the = 1 comes from :S Should I do this otherwise? I am expecting to have this result: 1 2 3 4 5 6 7 8 9 10 Thank you for your answers, comments and feedback!

Read the article
jQuery Grouping Similar Items and Counting When Repeated

- by NessDan

So I have this structure setup: <ul> <li>http://www.youtube.com/watch?v=dw1Vh9Yzryo</li> (Vid1) <li>http://www.youtube.com/watch?v=bOF3o8B292U</li> (Vid2) <li>http://www.youtube.com/watch?v=yAY4vNJd7A8</li> (Vid3) <li>http://www.youtube.com/watch?v=yAY4vNJd7A8</li> <li>http://www.youtube.com/watch?v=dw1Vh9Yzryo</li> <li>http://www.youtube.com/watch?v=bOF3o8B292U</li> <li>http://www.youtube.com/watch?v=yAY4vNJd7A8</li> <li>http://www.youtube.com/watch?v=dw1Vh9Yzryo</li> </ul> Vid1 is repeated 3 times, Vid2 is repeated 3 times, and Vid3 is repeated 2 times. I want to put them into a structure where I can reference them like this: Vid1 - 3 (Repeated), http://www.youtube.com/get_video?video_id=dw1Vh9Yzryo&fmt=36 (Download) Vid2 - 3 (Repeated), http://www.youtube.com/get_video?video_id=bOF3o8B292U&fmt=36 (Download) Vid3 - 2 (Repeated), http://www.youtube.com/get_video?video_id=yAY4vNJd7A8&fmt=36 (Download) "This video was repeated " + [Vid1][Repeated] + " times and you can download it here: " + [Vid1][Download]; How can I set this structure up? I think I should be using an array to achieve the above but I'm not sure how I would set it up or how to reference certain things in the array. The other question is how can I get how many times something was repeated? The URL I have no problem with. Can anyone help me out?

Read the article
Counting vowels in a string using recursion

- by Daniel Love Jr

In my python class we are learning about recursion. I understand that it's when a function calls itself, however for this particular assignment I can't figure out how exactly to get my function to call it self to get the desired results. I need to simply count the vowels in the string given to the function. def recVowelCount(s): 'return the number of vowels in s using a recursive computation' vowelcount = 0 vowels = "aEiou".lower() if s[0] in vowels: vowelcount += 1 else: ??? I'm really not sure where to go with this, it's quite frustrating. I came up with this in the end, thanks to some insight from here. def recVowelCount(s): 'return the number of vowels in s using a recursive computation' vowels = "aeiouAEIOU" if s == "": return 0 elif s[0] in vowels: return 1 + recVowelCount(s[1:]) else: return 0 + recVowelCount(s[1:])

Read the article
Counting point size based on chart area during zooming/unzoomin

- by Gacek

Hi folks. I heave a quite simple task. I know (I suppose) it should be easy, but from the reasons I cannot understand, I try to solve it since 2 days and I don't know where I'm making the mistake. So, the problem is as follows: - we have a chart with some points - The chart starts with some known area and points have known size - we would like to "emulate" the zooming effect. So when we zoom to some part of the chart, the size of points is getting proportionally bigger. In other words, the smaller part of the chart we select, the bigger the point should get. So, we have something like that. We know this two parameters: initialArea; // Initial area - area of the whole chart, counted as width*height initialSize; // initial size of the points Now lets assume we are handling some kind of OnZoom event. We selected some part of the chart and would like to count the current size of the points float CountSizeOnZoom() { float currentArea = CountArea(...); // the area is counted for us. float currentSize = initialSize * initialArea / currentArea; return currentSize; } And it works. But the rate of change is too fast. In other words, the points are getting really big too soon. So I would like the currentSize to be invertly proportional to currentArea, but with some scaling coefficient. So I created the second function: float CountSizeOnZoom() { float currentArea = CountArea(...); % the area is counted for us. // Lets assume we want the size of points to change ten times slower, than area of the chart changed. float currentSize = initialSize + 0.1f* initialSize * ((initialArea / currentArea) -1); return currentSize; } Lets do some calculations in mind. if currentArea is smaller than initialArea, initialArea/currentArea > 1 and then we add "something" small and postive to initialSize. Checked, it works. Lets check what happens if we would un-zoom. currentArea will be equal to initialArea, so we would have 0 at the right side (1-1), so new size should be equal to initialSize. Right? Yeah. So lets check it... and it doesn't work. My question is: where is the mistake? Or maybe you have any ideas how to count this scaled size depending on current area in some other way?

Read the article
Tracking/Counting Word Frequency

- by Joel Martinez

I'd like to get some community consensus on a good design to be able to store and query word frequency counts. I'm building an application in which I have to parse text inputs and store how many times a word has appeared (over time). So given the following inputs: "To Kill a Mocking Bird" "Mocking a piano player" Would store the following values: Word Count ------------- To 1 Kill 1 A 2 Mocking 2 Bird 1 Piano 1 Player 1 And later be able to quickly query for the count value of a given arbitrary word. My current plan is to simply store the words and counts in a database, and rely on caching word count values ... But I suspect that I won't get enough cache hits to make this a viable solution long term. Can anyone suggest algorithms, or data structures, or any other idea that might make this a well-performing solution?

Read the article
string comparision and counting the key in target [closed]

- by mesun

Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

Read the article
jquery parent/children selector for counting <li>

- by Kreker

Hi. I have this piece of HTML <div id="fileTreeInviati"> <ul class="php-file-tree"> <li class="pft-directory"> <a href="#" class="" name="101">A006 - SOMETEXT (<span name="contaNew"></span>)</a> <img src="./moduli/home/images/info.png" title="Informazioni Azienda" class="imgInfo"/> <ul style="display: none;"> <li class="pft-file ext-png"> <a href="javascript:getInfoFile('4');" class="" id="4">cut.png</a> </li> <li class="pft-file ext-dll"> <a href="javascript:getInfoFile('27');" class="new" id="27">Safari.dll</a> </li> </ul> </li> <li class="pft-directory"> <a href="#" class="" name="102">A012 - SOMETEXT (<span name="contaNew"></span>)</a> <img src="./moduli/home/images/info.png" title="Informazioni Azienda" class="imgInfo"/> <ul style="display: none;"> <li class="pft-file ext-jpg"> <a href="javascript:getInfoFile('19');" class="new" id="19">04.jpg</a> </li> <li class="pft-file ext-dll"> <a href="javascript:getInfoFile('24');" class="new" id="24">Safari.dll</a> </li> </ul> </li> <li class="pft-directory"> <a href="#" class="" name="103">A014 - SOMETEXT (<span name="contaNew"></span>)</a> <img src="./moduli/home/images/info.png" title="Informazioni Azienda" class="imgInfo"/> <ul style="display: none;"> <li class="pft-file ext-txt"> <a href="javascript:getInfoFile('17');" class="new" id="17">acu.txt</a> </li> <li class="pft-file ext-dll"> <a href="javascript:getInfoFile('22');" class="new" id="22">Safari.dll</a> </li> </ul> </li> </ul> I'm working on a js snippet that cycle through all "a" of the "li" and checks if it has the class "new" if yes increment a counter by one. This counter now has to be printed on the relative "li" "span" 3 level before. So I have the number of the element with the "new" class. The js snippet is this $("#fileTreeInviati .php-file-tree .pft-directory li").each(function(){ $(this).children("a").each(function(i,e){ if ($(e).hasClass("new")){ cont++; console.log($(e).text()); $(this).parent().parent().parent().children("a").children("span").text(cont); } }) cont = 0; }); I think I'm almost there but the counter is always 1. I think there is something mess with .children, maybe it can handle only the first occurrence? Thanks for help

Read the article
Java - Counting how many characters show up in another string

- by Vu Châu

I am comparing two strings, in Java, to see how many characters from the first string show up in the second string. The following is some expectations: matchingChars("AC", "BA") ? 1 matchingChars("ABBA", "B") ? 2 matchingChars("B", "ABBA") ? 1 My approach is as follows: public int matchingChars(String str1, String str2) { int count = 0; for (int a = 0; a < str1.length(); a++) { for (int b = 0; b < str2.length(); b++) { char str1Char = str1.charAt(a); char str2Char = str2.charAt(b); if (str1Char == str2Char) { count++; str1 = str1.replace(str1Char, '0'); } } } return count; } I know my approach is not the best, but I think it should do it. However, for matchingChars("ABBA", "B") ? 2 My code yields "1" instead of "2". Does anyone have any suggestion or advice? Thank you very much.

Read the article
Creating LINQ to SQL for counting a parameter

- by Matt

I'm trying to translate a sql query into LINQ to SQL. I keep getting an error "sequence operators not supported for type 'system.string'" If I take out the distinct count part, it works. Is it not because I'm using the GROUP BY? SELECT COUNT(EpaValue) AS [Leak Count], Location, EpaValue AS [Leak Desc.] FROM ChartMes.dbo.RecourceActualEPA_Report WHERE (EpaName = N'LEAK1') AND (Timestamp) '20100429030000' GROUP BY EpaValue, Location ORDER BY Location, [Leak Count] DESC Dim temp = (From p In db2.RecourceActualEPA_Reports _ Where (p.Timestamp = str1stShiftStart) And (p.Timestamp < str2ndShiftCutoff) _ And (p.EpaName = "Leak1") _ Select p.EpaName.Distinct.Count(), p.Location, p.EpaValue)

Read the article
Counting number of GC cleanups on an object

- by tsps

How do I keep a count of the number of times that objects of a specific class (type?) are getting disposed in the lifetime of my application. Imagine I have a class A, now, I want to count how many times the objects of A get collected by the GC. I hope I am phrasing this right because I was asked this in an interview today and the answer I gave did not satisfy the interviewer. And this is what I imagine he was trying to ask. What I said was that one could keep a static field called count in the class A and increment it in the Finalize() call of that object. The answer he was expecting was something called a static block. I've never heard of this in .NET/C#. Can someone explain what's this static block?

Read the article
Overriding form submit based on counting elements with jquery.each

- by MrGrigg

I am probably going about this all wrong, but here's what I'm trying to do: I have a form that has approximately 50 select boxes that are generated dynamically based on some database info. I do not have control over the IDs of the text boxes, but I can add a class to each of them. Before the form is submitted, the user needs to select at least one item from the select box, but no more than four. I'm a little bit sleepy, and I'm unfamiliar with jQuery overall, but I'm trying to override $("form").submit, and here's what I'm doing. Any advice or suggestions are greatly appreciated. $("form").submit(function() { $('.sportsCoachedValidation').each(function() { if ($('.sportsCoachedValidation :selected').text() != 'N/A') { sportsSelected++ } }); if (sportsSelected >= 1 && sportsSelected <= 4) { return true; } else if (sportsSelected > 4) { alert('You can only coach up to four sports.'); sportsSelected = 0; return false; } else { alert('Please select at least one coached sport.'); sportsSelected = 0; return false; } });

Read the article
Counting unique values in a column with a shell script

- by Lilly Tooner

Hello. I have a tab delimited file with 5 columns and need to retrieve a count of just the number of unique lines from column 2. I would normally do this with Perl/Python but I am forced to use the shell for this one. I have successfully in the past used *nix uniq function piped to wc but it looks like I am going to have to use awk in here. Any advice would be greatly appreciated. (I have asked a similar question previously about column checks using awk but this is a little different and I wanted to separate it so if someone in the future has this question this will be here) Many many thanks! Lilly

Read the article
Powershell - remote folder availability while counting files

- by ziklop

I´m trying to make a Powershell script that reports if there´s a file older than x minutes on remote folder. I make this: $strfolder = 'folder1 ..................' $pocet = (Get-ChildItem \\server1\edi1\folder1\*.* ) | where-object {($_.LastWriteTime -lt (Get-Date).AddDays(-0).AddHours(-0).AddMinutes(-20))} | Measure-Object if($pocet.count -eq 0){Write-Host $strfolder "OK" -foreground Green} else {Write-Host $strfolder "ERROR" -foreground Red} But there´s one huge problem. The folder is often unavailable for me bacause of the high load and I found out when there is no connection it doesn´t report an error but continues with zero in $pocet.count. It means it reports everything is ok when the folder is unavailable. I was thinking about using if(Test-Path..) but what about it became unavailable just after passing Test-Path? Does anyone has a solution please? Thank you in advance

Read the article
Counting arrays in loop

- by Ivory Santos

I have a loop... while($rows=mysql_fetch_array($result)) { $staff[] = $rows['staff']; $a = array_count_values($staff); $b = count($a); echo"$b<br>"; } that output 1 1 1 2 2 2 3 3 4 5 5 on my research, it must be and I wanted the result to be this way 3 (is equal to three 1's) 3 (is equal to three 2's) 2 (is equal to two 3) 1 (is equal to one 4) 2 (is equal to two 5's) any help? what I want is to get the number of same element in an array

Read the article
How do I "rebind" the click event after unbind('click') ?

- by Ben

I have an anchor tag <a class="next">next</a> made into a "button". Sometimes, this tag needs to be hidden if there is nothing new to show. All works fine if I simply hide the button with .hide() and re-display it with .show(). But I wanted to uses .fadeIn() and .fadeOut() instead. The problem I'm having is that if the user clicks on the button during the fadeOut animation, it can cause problems with the logic I have running the show. The solution I found was to unbind the click event from the button after the original click function begins, and then re-bind it after the animation is complete. $('a.next').click(function() { $(this).unbind('click'); ... // calls some functions, one of which fades out the a.next if needed ... $(this).bind('click'); } the last part of the above example does not work. The click event is not actually re-bound to the anchor. does anyone know the correct way to accomplish this? I'm a self-taught jquery guy, so some of the higher level things like unbind() and bind() are over my head, and the jquery documentation isn't really simple enough for me to understand.

Read the article
Counting XML elements in file on Android

- by CSharperWithJava

Take a simple XML file formatted like this: <Lists> <List> <Note/> ... <Note/> </List> <List> <Note/> ... <Note/> </List> </Lists> Each node has some attributes that actually hold the data of the file. I need a very quick way to count the number of each type of element, (List and Note). Lists is simply the root and doesn't matter. I can do this with a simple string search or something similar, but I need to make this as fast as possible. Design Parameters: Must be in java (Android application). Must AVOID allocating memory as much as possible. Must return the total number of Note elements and the number of List elements in the file, regardless of location in file. Number of Lists will typically be small (1-4), and number of notes can potentially be very large (upwards of 1000, typically 100) per file. I look forward to your suggestions.

Read the article
Sorting in Lua, counting number of items

- by Josh

Two quick questions (I hope...) with the following code. The script below checks if a number is prime, and if not, returns all the factors for that number, otherwise it just returns that the number prime. Pay no attention to the zs. stuff in the script, for that is client specific and has no bearing on script functionality. The script itself works almost wonderfully, except for two minor details - the first being the factor list doesn't return itself sorted... that is, for 24, it'd return 1, 2, 12, 3, 8, 4, 6, and 24 instead of 1, 2, 3, 4, 6, 8, 12, and 24. I can't print it as a table, so it does need to be returned as a list. If it has to be sorted as a table first THEN turned into a list, I can deal with that. All that matters is the end result being the list. The other detail is that I need to check if there are only two numbers in the list or more. If there are only two numbers, it's a prime (1 and the number). The current way I have it does not work. Is there a way to accomplish this? I appreciate all the help! function get_all_factors(number) local factors = 1 for possible_factor=2, math.sqrt(number), 1 do local remainder = number%possible_factor if remainder == 0 then local factor, factor_pair = possible_factor, number/possible_factor factors = factors .. ", " .. factor if factor ~= factor_pair then factors = factors .. ", " .. factor_pair end end end factors = factors .. ", and " .. number return factors end local allfactors = get_all_factors(zs.param(1)) if zs.func.numitems(allfactors)==2 then return zs.param(1) .. " is prime." else return zs.param(1) .. " is not prime, and its factors are: " .. allfactors end

Read the article
Arrays not counting correctly

- by Nick Gibson

I know I was just asking a question earlier facepalm This is in Java coding by the way. Well after everyones VERY VERY helpful advice (thank you guys alot) I managed to get over half of the program running how I wanted. Everything is pointing in the arrays where I want them to go. Now I just need to access the arrays so that It prints the correct information randomly. This is the current code that im using: http://pastebin.org/301483 The specific code giving me problems is this: long aa; int abc; for (int i = 0; i < x; i++) { aa = Math.round(Math.random()*10); String str = Long.toString(aa); abc = Integer.parseInt(str); String[] userAnswer = new String[x]; if(abc > x) { JOptionPane.showMessageDialog(null,"Number is too high. \nNumber Generator will reset."); break; } userAnswer[i] = JOptionPane.showInputDialog(null,"Question "+quesNum+"\n"+questions[abc]+"\n\nA: "+a[abc]+"\nB: "+b[abc]+"\nC: "+c[abc]+"\nD: "+d[abc]); answer = userAnswer[i].compareTo(answers[i]); if(answer == 0) { JOptionPane.showMessageDialog(null,"Correct. \nThe Correct Answer is "+answers[abc]+""+i); } else { JOptionPane.showMessageDialog(null,"Wrong. \n The Correct Answer is "+answers[abc]+""+i); }//else

Read the article
Counting the number of occurrences of characters in an array

- by Anthony Pittelli

This is what I have but it is not working, this is confusing for me. If you scroll down I commented on someones post the exact problem I am having and what I am trying to do. I was thinking maybe the problem is my code to generate the random characters: public void add (char fromChar, char toChar){ Random r = new Random(); //creates a random object int randInt; for (int i=0; i<charArray.length; i++){ randInt = r.nextInt((toChar-fromChar) +1); charArray[i] = (char) randInt; //casts these integers as characters } }//end add public int[] countLetters() { int[] count = new int[26]; char current; for (int b = 0; b <= 26; b++) { for (int i = 97; i <= 123; i++) { char a = (char) i; for (int ch = 0; ch < charArray.length; ch++) { current = charArray[ch]; if (current == a) { count[b]++; } } } } return count; }

Read the article
Counting number of searches

- by shinjuo

I am trying to figure out how to get the total number of tests each search makes in this algorithm. I am not sure how I can pass that information back from this algorithm though. I need to count how many times while runs and then pass that number back into an array to be added together and determine the average number of test. main.c #include <stdio.h> #include <stdlib.h> #include <time.h> #include <stdbool.h> #include "percentage.h" #include "sequentialSearch.h" #define searchAmount 100 int main(int argc, char *argv[]) { int numbers[100]; int searches[searchAmount]; int i; int where; int searchSuccess; int searchUnsuccess; int percent; srand(time(NULL)); for (i = 0; i < 100; i++){ numbers[i] = rand() % 200; } for (i = 0; i < searchAmount; i++){ searches[i] = rand() % 200; } searchUnsuccess = 0; searchSuccess = 0; for(i = 0; i < searchAmount; i++){ if(seqSearch(numbers, 100, searches[i], &where)){ searchSuccess++; }else{ searchUnsuccess++; } } percent = percentRate(searchSuccess, searchAmount); printf("Total number of searches: %d\n", searchAmount); printf("Total successful searches: %d\n", searchSuccess); printf("Success Rate: %d%%\n", percent); system("PAUSE"); return 0; } sequentialSearch.h bool seqSearch (int list[], int last, int target, int* locn){ int looker; looker = 0; while(looker < last && target != list[looker]){ looker++; } *locn = looker; return(target == list[looker]); }

Read the article
Counting substring, while loop

- by user1554786

public class SubstringCount { public static void main(String[] args) { Scanner scan = new Scanner(System.in); System.out.println("Enter a word longer than 4 characters, and press q to quit"); int count = 0; while (scan.hasNextLine()) { System.out.println("Enter a word longer than 4 characters, and press q to quit"); String word = scan.next(); if (word.substring(0,4).equals("Stir")) { count++; System.out.println("Enter a word longer than 4 characters, and press q to quit"); scan.next(); } else if (word.equals("q")) { System.out.println("You have " + count + ("words with 'Stir' in them")); } else if (!word.substring(0,4).equals("Stir")) { System.out.println("Enter a word longer than 4 characters, and press q to quit"); scan.next(); } } } } Here I need to print how many words entered by the user contain the substring 'Stir.' However I'm not sure how to get this to work, or if I've done any of it right in the first place! Thanks for any help!

Read the article
Counting character count in Access database column ins SQL

- by jzr

Good Evening. My problem is possibly very easy, I just have spent some time researching now and probably have a brain lock and unable to solve this, help would be much appreciated. database structure: col1 col2 col3 col4 ==================== 1233+4566+ABCD+CDEF 1233+4566+ACD1+CDEF 1233+4566+D1AF+CDEF I need to count character count in col3, wanted result in from the previous table would be: char count =========== A 3 B 1 C 2 D 3 F 1 1 2 is this possible to achieve by using SQL only? at the moment I am thinking of passing a parameter in to SQL query and count the characters one by one and then sum, however I did not start the VBA part yet, and frankly wouldn't want to do that. this is my query at the moment: PARAMETERS X Long; SELECT First(Mid(TABLE.col3,X,1)) AS [col3 Field], Count(Mid(TABLE.col3,X,1)) AS Dcount FROM TEST GROUP BY Mid(TABLE.col3,X,1) HAVING (((Count(Mid([TABLE].[col3],[X],1)))>=1)); ideas and help are much appreciated, as being said this is probably very for some of your guys, I don't usually work with access and SQL. Thanks.

Read the article
counting sub rows in mysql

- by moustafa

i have 2 table ok catgories and artilces i have this structure catgories web > design > photoshop > layers web > design > photoshop > effects and each one is a catgory and layers catgories has 100 article and effects catgories has 50 article now i want when count the articles 'web' catgory it show 150 article how i can do this give me an example

Read the article

< Previous Page | 17 18 19 20 21 22 23 24 25 26 27 28 | Next Page >