Search Results

Search found 1112 results on 45 pages for 'recursive'.

Page 21/45 | < Previous Page | 17 18 19 20 21 22 23 24 25 26 27 28  | Next Page >

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Efficient Multiplication of Varying-Length #s [Conceptual]

    - by Milan Patel
    Write the pseudocode of an algorithm that takes in two arbitrary length numbers (provided as strings), and computes the product of these numbers. Use an efficient procedure for multiplication of large numbers of arbitrary length. Analyze the efficiency of your algorithm. I decided to take the (semi) easy way out and use the Russian Peasant Algorithm. It works like this: a * b = a/2 * 2b if a is even a * b = (a-1)/2 * 2b + a if a is odd My pseudocode is: rpa(x, y){ if x is 1 return y if x is even return rpa(x/2, 2y) if x is odd return rpa((x-1)/2, 2y) + y } I have 3 questions: Is this efficient for arbitrary length numbers? I implemented it in C and tried varying length numbers. The run-time in was near-instant in all cases so it's hard to tell empirically... Can I apply the Master's Theorem to understand the complexity...? a = # subproblems in recursion = 1 (max 1 recursive call across all states) n / b = size of each subproblem = n / 1 - b = 1 (problem doesn't change size...?) f(n^d) = work done outside recursive calls = 1 - d = 0 (the addition when a is odd) a = 1, b^d = 1, a = b^d - complexity is in n^d*log(n) = log(n) this makes sense logically since we are halving the problem at each step, right? What might my professor mean by providing arbitrary length numbers "as strings". Why do that? Many thanks in advance

    Read the article

  • Top n items in a List ( including duplicates )

    - by Krishnan
    Trying to find an efficient way to obtain the top N items in a very large list, possibly containing duplicates. I first tried sorting & slicing, which works. But this seems unnnecessary. You shouldn't need to sort a very large list if you just want the top 20 members. So I wrote a recursive routine which builds the top-n list. This also works, but is very much slower than the non-recursive one! Question: Which is my second routine (elite2) so much slower than elite, and how do I make it faster ? My code is attached below. Thanks. import scala.collection.SeqView import scala.math.min object X { def elite(s: SeqView[Int, List[Int]], k:Int):List[Int] = { s.sorted.reverse.force.slice(0,min(k,s.size)) } def elite2(s: SeqView[Int, List[Int]], k:Int, s2:List[Int]=Nil):List[Int] = { if( k == 0 || s.size == 0) s2.reverse else { val m = s.max val parts = s.force.partition(_==m) val whole = if( parts._1.size > 1) parts._1.tail:::parts._2 else parts._2 elite2( whole.view, k-1, m::s2 ) } } def main(args:Array[String]) = { val N = 1000000/3 val x = List(N to 1 by -1).flatten.map(x=>List(x,x,x)).flatten.view println(elite2(x,20)) println(elite(x,20)) } }

    Read the article

  • Insertion into BST without header Node JAVA

    - by Petiatil
    I am working on a recursive insertion method for a BST. This function is suppose to be a recursive helper method and is in a private class called Node. The Node class is in a class called BinarySearchTree which contains an instance variable for the root. When I am trying to insert an element, I get a NullPointerException at : this.left = insert(((Node)left).element); I am unsure about why this occurs. If I understand correctly, in a BST, I am suppose to insert the item at the last spot on the path transversed. Any help is appreciated! private class Node implements BinaryNode<E> { E item; BinaryNode<E> left, right; public BinaryNode<E> insert(E item) { int compare = item.compareTo(((Node)root).item); if(root == null) { root = new Node(); ((Node)root).item = item; } else if(compare < 0) { this.left = insert(((Node)left).item); } else if(compare > 0) { this.right = insert(((Node)right).item); } return root; } }

    Read the article

  • What causes style corruption in MS Word?

    - by Phil.Wheeler
    I've had a few documents across my desk that appear to have a corrupted or recursive style for much of the body text: Char char char char char char Does anyone know what causes this and how to permanently delete this style? When I try to delete it, it disappears from the Styles and Formatting pane of Word, only to reappear later when different text is selected. Input or guidance much appreciated.

    Read the article

  • Windows: File copy/move with filename regular expressions?

    - by Ian Boyd
    i basically want to run: C:\>xcopy [0-9]{13}\.(gif|jpg|png) s:\TargetFolder /s i know xcopy doesn't support regular-express filename searches. i can't find out how to find out if PowerShell has a Cmdlet to copy files; and if it does, how to find out if it supports regular expression filename matching. Can anyone think of a way to perform a recursive file copy/move with regex filename matching?

    Read the article

  • Windows: View "all" permissions of a specific user or group

    - by peterchen
    For a Windows domain, is there a way to see for a certain user or group, where the user/group has permissions? Primarily: List which files / folders the user can access on a certain network share. (Kind of a recursive "effective permissions") However, other permissions would be cool as well. I believe I've seen such a tool in action, but I can't remember anything beyond that - so this might be a false memory. Recommendations?

    Read the article

  • Enterprise IPv6 Migration - End of proxypac ? Start of Point-to-Point ? +10K users

    - by Yohann
    Let's start with a diagram : We can see a "typical" IPv4 company network with : An Internet acces through a proxy An "Others companys" access through an dedicated proxy A direct access to local resources All computers have a proxy.pac file that indicates which proxy to use or whether to connect directly. Computers have access to just a local DNS (no name resolution for google.com for example.) By the way ... The company does not respect the RFC1918 internally and uses public addresses! (historical reason). The use of internet proxy explicitly makes it possible to not to have problem. What if we would migrate to IPv6? Step 1 : IPv6 internet access Internet access in IPv6 is easy. Indeed, just connect the proxy in Internet IPv4 and IPv6. There is nothing to do in internal network : Step 2 : IPv6 AND IPv4 in internal network And why not full IPv6 network directly? Because there is always the old servers that are not compatible IPv6 .. Option 1 : Same architecture as in IPv4 with a proxy pac This is probably the easiest solution. But is this the best? I think the transition to IPv6 is an opportunity not to bother with this proxy pac! Option 2 : New architecture with transparent proxy, whithout proxypac, recursive DNS Oh yes! In this new architecture, we have: Explicit Internet Proxy becomes a Transparent Internet Proxy Local DNS becomes a Normal Recursive DNS + authorative for local domains No proxypac Explicit Company Proxy becomes a Transparent Company Proxy Routing Internal Routers reditect IP of appx.ext.example.com to Company Proxy. The default gateway is the Transparent Internet proxy. Questions What do you think of this architecture IPv6? This architecture will reveal the IP addresses of our internal network but it is protected by firewalls. Is this a real big problem? Should we keep the explicit use of a proxy? -How would you make for this migration scenario? -And you, how do you do in your company? Thanks! Feel free to edit my post to make it better.

    Read the article

  • How can I recursively verify the permissions within a given subdirectory?

    - by Mike
    I'd like to verify that nothing within /foo/bar is chmod 777. Or, alternatively, I'd like to make sure that nothing within /foo/bar us owned by user1 or in group1. Is there any way I can recursively verify the permissions within a given subdirectory to make sure there aren't any security holes? Notice that I do not want to change all the permissions to something specific, nor do I want to change the owner to something specific, so a recursive chmod or chown won't do it... Thanks!

    Read the article

  • Oracle error when logging into database

    - by Bryan
    When I try to log into my db with a specific user I get this message. Below is from the alert log. I can login as system just fine. Anyone know how to figure out what is causing this? Thanks in advance for the help. ----- Error Stack Dump ----- ORA-00604: error occurred at recursive SQL level 1 ORA-01438: value larger than specified precision allowed for this column ORA-06512: at line 2 Oracle 10g OEL 5.5

    Read the article

  • How to give user read/write access to folders?

    - by Will
    I'm running a certain script that is using a non-root user to do the following... mkdir: cannot create directory `/srv/www/example.com/releases' *** [err :: 12.23.45.789] : Permission denied How would I allow user xyz to have permanent permissions to do so and still keep this web server secure? Also is it possible to make it recursive for all subfolders? I know its probably chmod something but I'm not that linux savy, thanks.

    Read the article

  • nvcc not found, but only when using sudo

    - by dsp_099
    I can't get ANYTHING working on linux. I'm trying to compile CudaMiner. sudo make: ypt-jane.o `test -f 'scrypt-jane.cpp' || echo './'`scrypt-jane.cpp mv -f .deps/cudaminer-scrypt-jane.Tpo .deps/cudaminer-scrypt-jane.Po nvcc -g -O2 -Xptxas "-abi=no -v" -arch=compute_10 --maxrregcount=64 --ptxas-options=-v -I./compat/jansson -o salsa_kernel.o -c salsa_kernel.cu /bin/bash: nvcc: command not found make[2]: *** [salsa_kernel.o] Error 127 make[2]: Leaving directory `/var/progs/CudaMiner' make[1]: *** [all-recursive] Error 1 make[1]: Leaving directory `/var/progs/CudaMiner' make: *** [all] Error 2 So, kind of interesting: nvcc: nvcc fatal : No input files specified; use option --help for more information Whereas sudo nvcc: sudo: nvcc: command not found Huh?? I have identical exports listed in ~/.bashrc AND /etc/bash.bashrc. (Nvcc is located in: /usr/local/cuda-5.0/bin/nvcc) I also tried changing the current path, to no avail: $ sudo bash -c 'echo $PATH' /usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin $ PATH=$PATH:/usr/local/cuda-5.0/bin/nvcc $ sudo bash -c 'echo $PATH' /usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin Thanks in advance!

    Read the article

  • What happens to C# 4 optional parameters when compiling against 3.5?

    Heres a method declaration that uses optional parameters: public Path Copy( Path destination, bool overwrite = false, bool recursive = false) Something you may not know is that Visual Studio 2010 will let you compile this against .NET 3.5, with no error or warning. You may be wondering (as I was) how it does that. Well, it takes the easy and rather obvious way of not trying to be too smart and just ignores the optional parameters. So if youre compiling against 3.5 from Visual Studio 2010,...Did you know that DotNetSlackers also publishes .net articles written by top known .net Authors? We already have over 80 articles in several categories including Silverlight. Take a look: here.

    Read the article

  • Formal Languages, Inductive Proofs &amp; Regular Expressions

    - by MarkPearl
    So I am slogging away at my UNISA stuff. I have just finished doing the initial once non stop read through the first 11 chapters of my COS 201 Textbook - “Introduction to Computer Theory 2nd Edition” by Daniel Cohen. It has been an interesting couple of days, with familiar concepts coming up as well as some new territory. In this posting I am going to cover the first couple of chapters of the book. Let start with Formal Languages… What exactly is a formal language? Pretty much a no duh question for me but still a good one to ask – a formal language is a language that is defined in a precise mathematical way. Does that mean that the English language is a formal language? I would say no – and my main motivation for this is that one can have an English sentence that is correct grammatically that is also ambiguous. For example the ambiguous sentence: "I once shot an elephant in my pyjamas.” For this and possibly many other reasons that I am unaware of, English is termed a “Natural Language”. So why the importance of formal languages in computer science? Again a no duh question in my mind… If we want computers to be effective and useful tools then we need them to be able to evaluate a series of commands in some form of language that when interpreted by the device no confusion will exist as to what we were requesting. Imagine the mayhem that would exist if a computer misinterpreted a command to print a document and instead decided to delete it. So what is a Formal Language made up of… For my study purposes a language is made up of a finite alphabet. For a formal language to exist there needs to be a specification on the language that will describe whether a string of characters has membership in the language or not. There are two basic ways to do this: By a “machine” that will recognize strings of the language (e.g. Finite Automata). By a rule that describes how strings of a language can be formed (e.g. Regular Expressions). When we use the phrase “string of characters”, we can also be referring to a “word”. What is an Inductive Proof? So I am not to far into my textbook and of course it starts referring to proofs and different types. I have had to go through several different approaches of proofs in the past, but I can never remember their formal names , so when I saw “inductive proof” I thought to myself – what the heck is that? Google to the rescue… An inductive proof is like a normal proof but it employs a neat trick which allows you to prove a statement about an arbitrary number n by first proving it is true when n is 1 and then assuming it is true for n=k and showing it is true for n=k+1. The idea is that if you want to show that someone can climb to the nth floor of a fire escape, you need only show that you can climb the ladder up to the fire escape (n=1) and then show that you know how to climb the stairs from any level of the fire escape (n=k) to the next level (n=k+1). Does this sound like a form of recursion? No surprise then that in the same chapter they deal with recursive definitions. An example of a recursive definition for the language EVEN would the 3 rules below: 2 is in EVEN If x is in EVEN then so is x+2 The only elements in the set EVEN are those that be produced by the rules above. Nothing to exciting… So if a definition for a language is done recursively, then it makes sense that the language can be proved using induction. Regular Expressions So I am wondering to myself what use is this all – in fact – I find this the biggest challenge to any university material is that it is quite hard to find the immediate practical applications of some theory in real life stuff. How great was my joy when I suddenly saw the word regular expression being introduced. I had been introduced to regular expressions on Stack Overflow where I was trying to recognize if some text measurement put in by a user was in a valid form or not. For instance, the imperial system of measurement where you have feet and inches can be represented in so many different ways. I had eventually turned to regular expressions as an easy way to check if my parser could correctly parse the text or not and convert it to a normalize measurement. So some rules about languages and regular expressions… Any finite language can be represented by at least one if not more regular expressions A regular expressions is almost a rule syntax for expressing how regular languages can be formed regular expressions are cool For a regular expression to be valid for a language it must be able to generate all the words in the language and no other words. This is important. It doesn’t help me if my regular expression parses 100% of my measurement texts but also lets one or two invalid texts to pass as well. Okay, so this posting jumps around a bit – but introduces some very basic fundamentals for the subject which will be built on in later postings… Time to go and do some practical examples now…

    Read the article

  • Are there advantages for using recursion over iteration - other than sometimes readability and elegance?

    - by Prog
    I am about to make two assumptions. Please correct me if they're wrong: There isn't a recursive algorithm without an iterative equivalent. Iteration is always cheaper performance-wise than recursion (at least in general purpose languages such as Java, C++, Python etc.). If it's true that recursion is always more costly than iteration, and that it can always be replaced with an iterative algorithm (in languages that allow it) - than I think that the two remaining reasons to use recursion are: elegance and readability. Some algorithms are expressed more elegantly with recursion. E.g. scanning a binary tree. However apart from that, are there any reasons to use recursion over iteration? Does recursion have advantages over iteration other than sometimes elegance and readability?

    Read the article

  • How do I install Dan's Guardian on 12.04?

    - by Matt
    I'm trying to install Dans Guardian on a virtual machine. The instructions ask me to run the ./configure script and then execute the command make install. The configure script runs fine but the make install throws errors. Making all in src make[2]: Entering directory `/webmin/dansguardian-2.10/src' g++ -DHAVE_CONFIG_H -I. -I.. -D__CONFFILE='"/usr/local/etc/dansguardian/dansguardian.conf"' -D__LOGLOCATION='"/usr/local/var/log/dansguardian/"' -D__PIDDIR='"/usr/local/var/run"' -D__PROXYUSER='"nobody"' -D__PROXYGROUP='"nobody"' -D__CONFDIR='"/usr/local/etc/dansguardian"' -g -O2 -MT dansguardian-fancy.o -MD -MP -MF .deps/dansguardian-fancy.Tpo -c -o dansguardian-fancy.o `test -f 'downloadmanagers/fancy.cpp' || echo './'`downloadmanagers/fancy.cpp downloadmanagers/fancy.cpp: In member function âstd::string fancydm::timestring(int)â: downloadmanagers/fancy.cpp:507:72: error: âsnprintfâ was not declared in this scope make[2]: *** [dansguardian-fancy.o] Error 1 make[2]: Leaving directory `/webmin/dansguardian-2.10/src' make[1]: *** [all-recursive] Error 1 make[1]: Leaving directory `/webmin/dansguardian-2.10' make: *** [all] Error 2 I'm running 12.04 LTS server x64

    Read the article

  • Master Data Services Employees Sample Model

    - by Davide Mauri
    I’ve been playing with Master Data Services quite a lot in those last days and I’m also monitoring the web for all available resources on it. Today I’ve found this freshly released sample available on MSDN Code Gallery: SQL Server Master Data Services Employee Sample Model http://code.msdn.microsoft.com/SSMDSEmployeeSample This sample shows how Recursive Hierarchies can be modeled in order to represent a typical organizational chart scenario where a self-relationship exists on the Employee entity. Share this post: email it! | bookmark it! | digg it! | reddit! | kick it! | live it!

    Read the article

  • Killing Stuck Child JVM's

    - by ACShorten
    Note: This facility only applies to Oracle Utilities Application Framework products using COBOL. In some situations, the Child JVM's may spin. This causes multiple startup/shutdown Child JVM messages to be displayed and recursive child JVM's to be initiated and shunned. If the following: Unable to establish connection on port …. after waiting .. seconds.The issue can be caused intermittently by CPU spins in connection to the creation of new processes, specifically Child JVMs. Recursive (or double) invocation of the System.exit call in the remote JVM may be caused by a Process.destroy call that the parent JVM always issues when shunning a JVM. The issue may happen when the thread in the parent JVM that is responsible for the recycling gets stuck and it affects all child JVMs. If this issue occurs at your site then there are a number of options to address the issue: Configure an Operating System level kill command to force the Child JVM to be shunned when it becomes stuck. Configure a Process.destroy command to be used if the kill command is not configured or desired. Specify a time tolerance to detect stuck threads before issuing the Process.destroy or kill commands. Note: This facility is also used when the Parent JVM is also shutdown to ensure no zombie Child JVM's exit. The following additional settings must be added to the spl.properties for the Business Application Server to use this facility: spl.runtime.cobol.remote.kill.command – Specify the command to kill the Child JVM process. This can be a command or specify a script to execute to provide additional information. The kill.command property can accept two arguments, {pid} and {jvmNumber}, in the specified string. The arguments must be enclosed in curly braces as shown here. Note: The PID will be appended to the killcmd string, unless the {pid} and {jvmNumber} arguments are specified. The jvmNumber can be useful if passed to a script for logging purposes. Note: If a script is used it must be in the path and be executable by the OS user running the system. spl.runtime.cobol.remote.destroy.enabled – Specify whether to use the Process.destroy command instead of the kill command. Specify true or false. Default value is false. Note: Unless otherwise required, it is recommended to use the kill command option if shunning JVM's is an issue. There this value can remain its default value, false, unless otherwise required. spl.runtime.cobol.remote.kill.delaysecs – Specify the number of seconds to wait for the Child JVM to terminate naturally before issuing the Process.destroy or kill commands. Default is 10 seconds. For example: spl.runtime.cobol.remote.kill.command=kill -9 {pid} {jvmNumber}spl.runtime.cobol.remote.destroy.enabled=falsespl.runtime.cobol.remote.kill.delaysecs=10 When a Child JVM is to be recycled, these properties are inspected and the spl.runtime.cobol.remote.kill.command, executed if provided. This is done after waiting for spl.runtime.cobol.remote.kill.delaysecs seconds to give the JVM time to shut itself down. The spl.runtime.cobol.remote.destroy.enabled property must be set to true AND the spl.runtime.cobol.remote.kill.command omitted for the original Process.destroy command to be used on the process. Note: By default the spl.runtime.cobol.remote.destroy enabled is set to false and is therefore disabled. If neither spl.runtime.cobol.remote.kill.command nor spl.runtime.cobol.remote.destroy.enabled is specified, child JVMs will not beforcibly killed. They will be left to shut themselves down (which may lead to orphan JVMs). If both are specified, the spl.runtime.cobol.remote.kill.command is preferred and spl.runtime.cobol.remote.destroy.enabled defaulted to false.It is recommended to invoke a script to issue the direct kill command instead of directly using the kill -9 commands.For example, the following sample script ensures that the process Id is an active cobjrun process before issuing the kill command: forcequit.sh #!/bin/shTHETIME=`date +"%Y-%m-%d %H:%M:%S"`if [ "$1" = "" ]then  echo "$THETIME: Process Id is required" >>$SPLSYSTEMLOGS/forcequit.log  exit 1fijavaexec=cobjrunps e $1 | grep -c $javaexecif [ $? = 0 ]then  echo "$THETIME: Process $1 is an active $javaexec process -- issuing kill-9 $1" >>$SPLSYSTEMLOGS/forcequit.log  kill -9 $1exit 0else  echo "$THETIME: Process id $1 is not a $javaexec process or not active --  kill will not be issued" >>$SPLSYSTEMLOGS/forcequit.logexit 1fi This script's name would then be specified as the value for the spl.runtime.cobol.remote.kill.command property, for example: spl.runtime.cobol.remote.kill.command=forcequit.sh The forcequit script does not have any explicit parameters but pid is passed automatically. To use the jvmNumber parameter it must explicitly specified in the command. For example, to call script forcequit.sh and pass it the pid and the child JVM number, specify it as follows: spl.runtime.cobol.remote.kill.command=forcequit.sh {pid} {jvmNumber} The script can then use the JVM number for logging purposes or to further ensure that the correct pid is being killed.If the arguments are omitted, the pid is automatically appended to the spl.runtime.cobol.remote.kill.command string. To use this facility the following patches must be installed: Patch 13719584 for Oracle Utilities Application Framework V2.1, Patches 13684595 and 13634933 for Oracle Utilities Application Framework V2.2 Group Fix 4 (as Patch 13640668) for Oracle Utilities Application Framework V4.1.

    Read the article

  • Failed to compile Network Manager 0.9.4

    - by Oleksa
    After upgrading to 12.04 I needed to re-compile Network Manager to the version 0.9.4.0 again. However with the version 9.4.0 I faced with the error during compilation with libdns-manager: $ make ... Making all in dns-manager make[4]: ????? ? ??????? "/home/stasevych/install/network-manager/nm0.9.4.0/network-manager-0.9.4.0/src/dns-manager" /bin/bash ../../libtool --tag=CC --mode=compile gcc -DHAVE_CONFIG_H -I. -I../.. -I../../src/logging -I../../libnm-util -I../../libnm-util -I../../src -I../../include -I../../include -I/usr/include/libnl3 -I/usr/include/libnl3 -I/usr/include/libnl3 -I/usr/include/dbus-1.0 -I/usr/lib/x86_64-linux-gnu/dbus-1.0/include -I/usr/include/glib-2.0 -I/usr/lib/x86_64-linux-gnu/glib-2.0/include -pthread -I/usr/include/glib-2.0 -I/usr/lib/x86_64-linux-gnu/glib-2.0/include -DLOCALSTATEDIR=\"/usr/local/var\" -Wall -std=gnu89 -g -O2 -Wshadow -Wmissing-declarations -Wmissing-prototypes -Wdeclaration-after-statement -Wfloat-equal -Wno-unused-parameter -Wno-sign-compare -fno-strict-aliasing -Wno-unused-but-set-variable -Wundef -Werror -MT libdns_manager_la-nm-dns-manager.lo -MD -MP -MF .deps/libdns_manager_la-nm-dns-manager.Tpo -c -o libdns_manager_la-nm-dns-manager.lo `test -f 'nm-dns-manager.c' || echo './'`nm-dns-manager.c libtool: compile: gcc -DHAVE_CONFIG_H -I. -I../.. -I../../src/logging -I../../libnm-util -I../../libnm-util -I../../src -I../../include -I../../include -I/usr/include/libnl3 -I/usr/include/libnl3 -I/usr/include/libnl3 -I/usr/include/dbus-1.0 -I/usr/lib/x86_64-linux-gnu/dbus-1.0/include -I/usr/include/glib-2.0 -I/usr/lib/x86_64-linux-gnu/glib-2.0/include -pthread -I/usr/include/glib-2.0 -I/usr/lib/x86_64-linux-gnu/glib-2.0/include -DLOCALSTATEDIR=\"/usr/local/var\" -Wall -std=gnu89 -g -O2 -Wshadow -Wmissing-declarations -Wmissing-prototypes -Wdeclaration-after-statement -Wfloat-equal -Wno-unused-parameter -Wno-sign-compare -fno-strict-aliasing -Wno-unused-but-set-variable -Wundef -Werror -MT libdns_manager_la-nm-dns-manager.lo -MD -MP -MF .deps/libdns_manager_la-nm-dns-manager.Tpo -c nm-dns-manager.c -fPIC -DPIC -o .libs/libdns_manager_la-nm-dns-manager.o mv -f .deps/libdns_manager_la-nm-dns-manager.Tpo .deps/libdns_manager_la-nm-dns-manager.Plo /bin/bash ../../libtool --tag=CC --mode=compile gcc -DHAVE_CONFIG_H -I. -I../.. -I../../src/logging -I../../libnm-util -I../../libnm-util -I../../src -I../../include -I../../include -I/usr/include/libnl3 -I/usr/include/libnl3 -I/usr/include/libnl3 -I/usr/include/dbus-1.0 -I/usr/lib/x86_64-linux-gnu/dbus-1.0/include -I/usr/include/glib-2.0 -I/usr/lib/x86_64-linux-gnu/glib-2.0/include -pthread -I/usr/include/glib-2.0 -I/usr/lib/x86_64-linux-gnu/glib-2.0/include -DLOCALSTATEDIR=\"/usr/local/var\" -Wall -std=gnu89 -g -O2 -Wshadow -Wmissing-declarations -Wmissing-prototypes -Wdeclaration-after-statement -Wfloat-equal -Wno-unused-parameter -Wno-sign-compare -fno-strict-aliasing -Wno-unused-but-set-variable -Wundef -Werror -MT libdns_manager_la-nm-dns-dnsmasq.lo -MD -MP -MF .deps/libdns_manager_la-nm-dns-dnsmasq.Tpo -c -o libdns_manager_la-nm-dns-dnsmasq.lo `test -f 'nm-dns-dnsmasq.c' || echo './'`nm-dns-dnsmasq.c libtool: compile: gcc -DHAVE_CONFIG_H -I. -I../.. -I../../src/logging -I../../libnm-util -I../../libnm-util -I../../src -I../../include -I../../include -I/usr/include/libnl3 -I/usr/include/libnl3 -I/usr/include/libnl3 -I/usr/include/dbus-1.0 -I/usr/lib/x86_64-linux-gnu/dbus-1.0/include -I/usr/include/glib-2.0 -I/usr/lib/x86_64-linux-gnu/glib-2.0/include -pthread -I/usr/include/glib-2.0 -I/usr/lib/x86_64-linux-gnu/glib-2.0/include -DLOCALSTATEDIR=\"/usr/local/var\" -Wall -std=gnu89 -g -O2 -Wshadow -Wmissing-declarations -Wmissing-prototypes -Wdeclaration-after-statement -Wfloat-equal -Wno-unused-parameter -Wno-sign-compare -fno-strict-aliasing -Wno-unused-but-set-variable -Wundef -Werror -MT libdns_manager_la-nm-dns-dnsmasq.lo -MD -MP -MF .deps/libdns_manager_la-nm-dns-dnsmasq.Tpo -c nm-dns-dnsmasq.c -fPIC -DPIC -o .libs/libdns_manager_la-nm-dns-dnsmasq.o nm-dns-dnsmasq.c: In function 'update': nm-dns-dnsmasq.c:274:2: error: passing argument 1 of 'g_slist_copy' discards 'const' qualifier from pointer target type [-Werror] /usr/include/glib-2.0/glib/gslist.h:82:10: note: expected 'struct GSList *' but argument is of type 'const struct GSList *' cc1: all warnings being treated as errors make[4]: *** [libdns_manager_la-nm-dns-dnsmasq.lo] ??????? 1 make[4]: ??????? ??????? "/home/stasevych/install/network-manager/nm0.9.4.0/network-manager-0.9.4.0/src/dns-manager" make[3]: *** [all-recursive] ??????? 1 make[3]: ??????? ??????? "/home/stasevych/install/network-manager/nm0.9.4.0/network-manager-0.9.4.0/src" make[2]: *** [all] ??????? 2 make[2]: ??????? ??????? "/home/stasevych/install/network-manager/nm0.9.4.0/network-manager-0.9.4.0/src" make[1]: *** [all-recursive] ??????? 1 make[1]: ??????? ??????? "/home/stasevych/install/network-manager/nm0.9.4.0/network-manager-0.9.4.0" make: *** [all] ??????? 2 Has anybody faced with the similar errors? Thank you in advance for your help.

    Read the article

  • Recursion VS memory allocation

    - by Vladimir Kishlaly
    Which approach is most popular in real-world examples: recursion or iteration? For example, simple tree preorder traversal with recursion: void preorderTraversal( Node root ){ if( root == null ) return; root.printValue(); preorderTraversal( root.getLeft() ); preorderTraversal( root.getRight() ); } and with iteration (using stack): Push the root node on the stack While the stack is not empty Pop a node Print its value If right child exists, push the node's right child If left child exists, push the node's left child In the first example we have recursive method calls, but in the second - new ancillary data structure. Complexity is similar in both cases - O(n). So, the main question is memory footprint requirement?

    Read the article

  • Live from ODTUG - Big Data and SQL session #2

    - by Jean-Pierre Dijcks
    Sitting in Dominic Delmolino's session at ODTUG (KScope 12). If the session count at conferences is any indication then we will see more and more people start to deploy MapReduce in the database. And yes, that would be with SQL and PL/SQL first and foremost. Both Dominic and our own Bryn Llewellyn are doing MapReduce in the database presentations.  Since I have seen both, I would advice people to first look through Dominic's session to get a good grasp on what mappers do and what reducers do, then dive into Bryn's for a bunch of PL/SQL example. The thing I like about Dominic's is the last slide (a recursive WITH statement) to do this in SQL... Now I am hoping that next year we will see tools vendors show off how they work with Hadoop and MapReduce (at least talking about the concepts!!).

    Read the article

  • Towards an F# .NET Reflector add-in

    - by CliveT
    When I had the opportunity to spent some time during Red Gate's recent "down tools" week on a project of my choice, the obvious project was an F# add-in for Reflector . To be honest, this was a bit of a misnomer as the amount of time in the designated week for coding was really less than three days, so it was always unlikely that very much progress would be made in such a small amount of time (and that certainly proved to be the case), but I did learn some things from the experiment. Like lots of problems, one useful technique is to take examples, get them to work, and then generalise to get something that works across the board. Unfortunately, I didn't have enough time to do the last stage. The obvious first step is to take a few function definitions, starting with the obvious hello world, moving on to a non-recursive function and finishing with the ubiquitous recursive Fibonacci function. let rec printMessage message  =     printfn  message let foo x  =    (x + 1) let rec fib x  =     if (x >= 2) then (fib (x - 1) + fib (x - 2)) else 1 The major problem in decompiling these simple functions is that Reflector has an in-memory object model that is designed to support object-oriented languages. In particular it has a return statement that allows function bodies to finish early. I used some of the in-built functionality to take the IL and produce an in-memory object model for the language, but then needed to write a transformer to push the return statements to the top of the tree to make it easy to render the code into a functional language. This tree transform works in some scenarios, but not in others where we simply regenerate code that looks more like CPS style. The next thing to get working was library level bindings of values where these values are calculated at runtime. let x = [1 ; 2 ; 3 ; 4] let y = List.map  (fun x -> foo x) x The way that this is translated into a set of classes for the underlying platform means that the code needs to follow references around, from the property exposing the calculated value to the class in which the code for generating the value is embedded. One of the strongest selling points of functional languages is the algebraic datatypes, which allow definitions via standard mathematical-style inductive definitions across the union cases. type Foo =     | Something of int     | Nothing type 'a Foo2 =     | Something2 of 'a     | Nothing2 Such a definition is compiled into a number of classes for the cases of the union, which all inherit from a class representing the type itself. It wasn't too hard to get such a de-compilation happening in the cases I tried. What did I learn from this? Firstly, that there are various bits of functionality inside Reflector that it would be useful for us to allow add-in writers to access. In particular, there are various implementations of the Visitor pattern which implement algorithms such as calculating the number of references for particular variables, and which perform various substitutions which could be more generally useful to add-in writers. I hope to do something about this at some point in the future. Secondly, when you transform a functional language into something that runs on top of an object-based platform, you lose some fidelity in the representation. The F# compiler leaves attributes in place so that tools can tell which classes represent classes from the source program and which are there for purposes of the implementation, allowing the decompiler to regenerate these constructs again. However, decompilation technology is a long way from being able to take unannotated IL and transform it into a program in a different language. For a simple function definition, like Fibonacci, I could write a simple static function and have it come out in F# as the same function, but it would be practically impossible to take a mass of class definitions and have a decompiler translate it automatically into an F# algebraic data type. What have we got out of this? Some data on the feasibility of implementing an F# decompiler inside Reflector, though it's hard at the moment to say how long this would take to do. The work we did is included the 6.5 EAP for Reflector that you can get from the EAP forum. All things considered though, it was a useful way to gain more familiarity with the process of writing an add-in and understand difficulties other add-in authors might experience. If you'd like to check out a video of Down Tools Week, click here.

    Read the article

  • why installing lame it is getting failed

    - by Rahul Mehta
    I want to install ffmpeg with mp3lame enabled for this m following this tutorial , http://ubuntuforums.org/showpost.php?p=9868359&postcount=1289 and in step 2 error is libfaac is not found ? and in step 5 installing lame is giving this error , why it is getting failed , please advised what to do ? reach121@youngib:~/lame-3.98.4$ sudo checkinstall --pkgname=lame-ffmpeg --pkgversion="3.98.4" --backup=no --default --deldoc=yes checkinstall 1.6.2, Copyright 2009 Felipe Eduardo Sanchez Diaz Duran This software is released under the GNU GPL. ***************************************** **** Debian package creation selected *** ***************************************** This package will be built according to these values: 0 - Maintainer: [ root@youngib ] 1 - Summary: [ Package created with checkinstall 1.6.2 ] 2 - Name: [ lame-ffmpeg ] 3 - Version: [ 3.98.4 ] 4 - Release: [ 1 ] 5 - License: [ GPL ] 6 - Group: [ checkinstall ] 7 - Architecture: [ amd64 ] 8 - Source location: [ lame-3.98.4 ] 9 - Alternate source location: [ ] 10 - Requires: [ ] 11 - Provides: [ lame-ffmpeg ] 12 - Conflicts: [ ] 13 - Replaces: [ ] Enter a number to change any of them or press ENTER to continue: Installing with make install... ========================= Installation results =========================== Making install in mpglib make[1]: Entering directory `/home/reach121/lame-3.98.4/mpglib' make[2]: Entering directory `/home/reach121/lame-3.98.4/mpglib' make[2]: Nothing to be done for `install-exec-am'. make[2]: Nothing to be done for `install-data-am'. make[2]: Leaving directory `/home/reach121/lame-3.98.4/mpglib' make[1]: Leaving directory `/home/reach121/lame-3.98.4/mpglib' Making install in libmp3lame make[1]: Entering directory `/home/reach121/lame-3.98.4/libmp3lame' Making install in i386 make[2]: Entering directory `/home/reach121/lame-3.98.4/libmp3lame/i386' make[3]: Entering directory `/home/reach121/lame-3.98.4/libmp3lame/i386' make[3]: Nothing to be done for `install-exec-am'. make[3]: Nothing to be done for `install-data-am'. make[3]: Leaving directory `/home/reach121/lame-3.98.4/libmp3lame/i386' make[2]: Leaving directory `/home/reach121/lame-3.98.4/libmp3lame/i386' Making install in vector make[2]: Entering directory `/home/reach121/lame-3.98.4/libmp3lame/vector' make[3]: Entering directory `/home/reach121/lame-3.98.4/libmp3lame/vector' make[3]: Nothing to be done for `install-exec-am'. make[3]: Nothing to be done for `install-data-am'. make[3]: Leaving directory `/home/reach121/lame-3.98.4/libmp3lame/vector' make[2]: Leaving directory `/home/reach121/lame-3.98.4/libmp3lame/vector' make[2]: Entering directory `/home/reach121/lame-3.98.4/libmp3lame' make[3]: Entering directory `/home/reach121/lame-3.98.4/libmp3lame' test -z "/usr/local/lib" || /bin/mkdir -p "/usr/local/lib" /bin/bash ../libtool --mode=install /usr/bin/install -c 'libmp3lame.la' '/usr/local/lib/libmp3lame.la' /usr/bin/install -c .libs/libmp3lame.lai /usr/local/lib/libmp3lame.la /usr/bin/install -c .libs/libmp3lame.a /usr/local/lib/libmp3lame.a chmod 644 /usr/local/lib/libmp3lame.a ranlib /usr/local/lib/libmp3lame.a PATH="$PATH:/sbin" ldconfig -n /usr/local/lib ---------------------------------------------------------------------- Libraries have been installed in: /usr/local/lib If you ever happen to want to link against installed libraries in a given directory, LIBDIR, you must either use libtool, and specify the full pathname of the library, or use the `-LLIBDIR' flag during linking and do at least one of the following: - add LIBDIR to the `LD_LIBRARY_PATH' environment variable during execution - add LIBDIR to the `LD_RUN_PATH' environment variable during linking - use the `-Wl,--rpath -Wl,LIBDIR' linker flag - have your system administrator add LIBDIR to `/etc/ld.so.conf' See any operating system documentation about shared libraries for more information, such as the ld(1) and ld.so(8) manual pages. ---------------------------------------------------------------------- make[3]: Nothing to be done for `install-data-am'. make[3]: Leaving directory `/home/reach121/lame-3.98.4/libmp3lame' make[2]: Leaving directory `/home/reach121/lame-3.98.4/libmp3lame' make[1]: Leaving directory `/home/reach121/lame-3.98.4/libmp3lame' Making install in frontend make[1]: Entering directory `/home/reach121/lame-3.98.4/frontend' make[2]: Entering directory `/home/reach121/lame-3.98.4/frontend' test -z "/usr/local/bin" || /bin/mkdir -p "/usr/local/bin" /bin/bash ../libtool --mode=install /usr/bin/install -c 'lame' '/usr/local/bin/lame' /usr/bin/install -c lame /usr/local/bin/lame make[2]: Nothing to be done for `install-data-am'. make[2]: Leaving directory `/home/reach121/lame-3.98.4/frontend' make[1]: Leaving directory `/home/reach121/lame-3.98.4/frontend' Making install in Dll make[1]: Entering directory `/home/reach121/lame-3.98.4/Dll' make[2]: Entering directory `/home/reach121/lame-3.98.4/Dll' make[2]: Nothing to be done for `install-exec-am'. make[2]: Nothing to be done for `install-data-am'. make[2]: Leaving directory `/home/reach121/lame-3.98.4/Dll' make[1]: Leaving directory `/home/reach121/lame-3.98.4/Dll' Making install in debian make[1]: Entering directory `/home/reach121/lame-3.98.4/debian' make[2]: Entering directory `/home/reach121/lame-3.98.4/debian' make[2]: Nothing to be done for `install-exec-am'. make[2]: Nothing to be done for `install-data-am'. make[2]: Leaving directory `/home/reach121/lame-3.98.4/debian' make[1]: Leaving directory `/home/reach121/lame-3.98.4/debian' Making install in doc make[1]: Entering directory `/home/reach121/lame-3.98.4/doc' Making install in html make[2]: Entering directory `/home/reach121/lame-3.98.4/doc/html' make[3]: Entering directory `/home/reach121/lame-3.98.4/doc/html' make[3]: Nothing to be done for `install-exec-am'. test -z "/usr/local/share/doc/lame/html" || /bin/mkdir -p "/usr/local/share/doc/lame/html" /bin/mkdir: cannot create directory `/usr/local/share/doc': No such file or directory make[3]: *** [install-pkghtmlDATA] Error 1 make[3]: Leaving directory `/home/reach121/lame-3.98.4/doc/html' make[2]: *** [install-am] Error 2 make[2]: Leaving directory `/home/reach121/lame-3.98.4/doc/html' make[1]: *** [install-recursive] Error 1 make[1]: Leaving directory `/home/reach121/lame-3.98.4/doc' make: *** [install-recursive] Error 1 **** Installation failed. Aborting package creation. Cleaning up...OK Bye. reach121@youngib:~/lame-3.98.4$

    Read the article

< Previous Page | 17 18 19 20 21 22 23 24 25 26 27 28  | Next Page >