Search Results

Search found 21317 results on 853 pages for 'key mapping'.

Page 215/853 | < Previous Page | 211 212 213 214 215 216 217 218 219 220 221 222  | Next Page >

  • Database Modelling - Conceptually different entities but with near identical fields

    - by Andrew Shepherd
    Suppose you have two sets of conceptual entities: MarketPriceDataSet which has multiple ForwardPriceEntries PoolPriceForecastDataSet which has multiple PoolPriceForecastEntry Both different child objects have near identical fields: ForwardPriceEntry has MarketPriceDataSetId (foreign key to parent table) StartDate EndDate SimulationItemId ForwardPrice PoolPriceForecastEntry has PoolPriceForecastDataSetId (foreign key to parent table) StartDate EndDate SimulationItemId ForecastPoolPrice If I modelled them as separate tables, the only difference would be the foreign key, and the name of the price field. There has been a debate as to whether the two near identical tables should be merged into one. Options I've thought of to model this is: Just keep them as two independent, separate tables Have both sets in the one table with an additional "type" field, and a parent_id equalling a foreign key to either parent table. This would sacrifice referential integrity checks. Have both sets in the one table with an additional "type" field, and create a complicated sequence of joining tables to maintain referential integrity. What do you think I should do, and why?

    Read the article

  • Advice Please: SQL Server Identity vs Unique Identifier keys when using Entity Framework

    - by c.batt
    I'm in the process of designing a fairly complex system. One of our primary concerns is supporting SQL Server peer-to-peer replication. The idea is to support several geographically separated nodes. A secondary concern has been using a modern ORM in the middle tier. Our first choice has always been Entity Framework, mainly because the developers like to work with it. (They love the LiNQ support.) So here's the problem: With peer-to-peer replication in mind, I settled on using uniqueidentifier with a default value of newsequentialid() for the primary key of every table. This seemed to provide a good balance between avoiding key collisions and reducing index fragmentation. However, it turns out that the current version of Entity Framework has a very strange limitation: if an entity's key column is a uniqueidentifier (GUID) then it cannot be configured to use the default value (newsequentialid()) provided by the database. The application layer must generate the GUID and populate the key value. So here's the debate: abandon Entity Framework and use another ORM: use NHibernate and give up LiNQ support use linq2sql and give up future support (not to mention get bound to SQL Server on DB) abandon GUIDs and go with another PK strategy devise a method to generate sequential GUIDs (COMBs?) at the application layer I'm leaning towards option 1 with linq2sql (my developers really like linq2[stuff]) and 3. That's mainly because I'm somewhat ignorant of alternate key strategies that support the replication scheme we're aiming for while also keeping things sane from a developer's perspective. Any insight or opinion would be greatly appreciated.

    Read the article

  • Why i am getting NullPointerException for this btree method??

    - by user306540
    hi, i am writing code for btree algorithms. i am getting NullPointerException . why???? please somebody help me...! public void insertNonFull(BPlusNode root,BPlusNode parent,String key) { int i=0; BPlusNode child=new BPlusNode(); BPlusNode node=parent; while(true) { i=node.numKeys-1; if(node.leaf) { while(i>=0 && key.compareTo(node.keys[i])<0) { node.keys[i+1]=node.keys[i]; i--; } node.keys[i+1]=key; node.numKeys=node.numKeys+1; } else { while(i>=0 && key.compareTo(node.keys[i])<0) { i--; } } i++; child=node.pointers[i]; if(child!=null && child.numKeys==7) { splitChild(root,node,i,child); if(key.compareTo(node.keys[i])>0) { i++; } } node=node.pointers[i]; } }

    Read the article

  • DataGridView Cell Validating only when 'Enter' is pressed

    - by Eldad
    Hi, I want to validate and commit the value entered in the DataGridViewCell ONLY when the user presses the 'Enter' key. If the users presses any other key or mouse button (Arrow keys, Pressing a different cell using the mouse...), I want the behavior to be similar to the 'ESC' key: Move the focus to the new cell and revert the edited cell value to its previous value.

    Read the article

  • Share java object between two forms using Spring IoC

    - by Vladimir
    I want to share java object between two forms using Spring IoC. It should acts like Registry: Registry.set("key", new Object()); // ... Object o = Registry.get("key"); // ... Registry.set("key", new AnotherObject()); // rewrite old object I tried this code to register bean at runtime: applicationContext.getBeanFactory().registerSingleton("key", object); but it does not allow to rewrite existing object (result code for checking and deleting existing bean is too complicated)... PS I am Java newbie, so mb I am doing it wrong and I should not use IoC at all... any help is appreciated...

    Read the article

  • Hibernate doesn't generate cascade

    - by Shervin
    Hi. I have a set hibernate.hbm2ddl.auto to create so that Hibernate creates the tables in mysql for me. However, it doesn't seem that hibernate correctly adds Cascade on the references in the table. It does however work when I for instance delete a row, and I have a delete cascade as hibernate annotation. So I guess that means that Hibernate reads the annoation on runtime, and perform cascading manually? Is that normal behavior? For instance: @Entity class Report { @OneToOne(cascade = CascadeType.ALL) public File getPdf() { return pdf; } } Here I have set cascade to ALL. However, when running show create table Report Report | CREATE TABLE `Report` ( `id` bigint(20) NOT NULL AUTO_INCREMENT, `pdf_id` bigint(20) DEFAULT NULL, PRIMARY KEY (`id`), KEY `FK91B14154FDE6543A` (`pdf_id`), CONSTRAINT `FK91B14154FDE6543A` FOREIGN KEY (`pdf_id`) REFERENCES `File` (`id`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 | It doesn't say anything about cascading other then the foreign key. In my opinion, it should have added the ON DELETE CASCADE ON DELETE UPDATE

    Read the article

  • How do I get query string value from script path?

    - by TruMan1
    I am adding my Javsacript file in pages with different query strings in the script path like this: Page1: <script type="text/javascript" src="file.js?abc=123"></script> Page2: <script type="text/javascript" src="file.js?abc=456"></script> Page3: <script type="text/javascript" src="file.js?abc=789"></script> In my Javascript file, how can I get the value of the "abc" param? I tried using window.location for this, but that does not work. In case it helps, below is a function I use to find the value of a query string param: function getQuerystring(key, defaultValue) { if (defaultValue == null) defaultValue = ""; key = key.replace(/[\[]/, "\\\[").replace(/[\]]/, "\\\]"); var regex = new RegExp("[\\?&]" + key + "=([^&#]*)"); var qs = regex.exec(window.location.href); if (qs == null) return defaultValue; else return qs[1]; }

    Read the article

  • MySQL access classes in PHP

    - by Mike
    I have a connection class for MySQL that looks like this: class MySQLConnect { private $connection; private static $instances = 0; function __construct() { if(MySQLConnect::$instances == 0) { //Connect to MySQL server $this->connection = mysql_connect(MySQLConfig::HOST, MySQLConfig::USER, MySQLConfig::PASS) or die("Error: Unable to connect to the MySQL Server."); MySQLConnect::$instances = 1; } else { $msg = "Close the existing instance of the MySQLConnector class."; die($msg); } } public function singleQuery($query, $databasename) { mysql_select_db(MySQLConfig::DB, $this->connection) or die("Error: Could not select database " . MySQLConfig::DB . " from the server."); $result = mysql_query($query) or die('Query failed.'); return $result; } public function createResultSet($query, $databasename) { $rs = new MySQLResultSet($query, MySQLConfig::DB, $this->connection ) ; return $rs; } public function close() { MySQLConnect::$instances = 0; if(isset($this->connection) ) { mysql_close($this->connection) ; unset($this->connection) ; } } public function __destruct() { $this->close(); } } The MySQLResultSet class looks like this: class MySQLResultSet implements Iterator { private $query; private $databasename; private $connection; private $result; private $currentRow; private $key = 0; private $valid; public function __construct($query, $databasename, $connection) { $this->query = $query; //Select the database $selectedDatabase = mysql_select_db($databasename, $connection) or die("Error: Could not select database " . $this->dbname . " from the server."); $this->result = mysql_query($this->query) or die('Query failed.'); $this->rewind(); } public function getResult() { return $this->result; } // public function getRow() // { // return mysql_fetch_row($this->result); // } public function getNumberRows() { return mysql_num_rows($this->result); } //current() returns the current row public function current() { return $this->currentRow; } //key() returns the current index public function key() { return $this->key; } //next() moves forward one index public function next() { if($this->currentRow = mysql_fetch_array($this->result) ) { $this->valid = true; $this->key++; }else{ $this->valid = false; } } //rewind() moves to the starting index public function rewind() { $this->key = 0; if(mysql_num_rows($this->result) > 0) { if(mysql_data_seek($this->result, 0) ) { $this->valid = true; $this->key = 0; $this->currentRow = mysql_fetch_array($this->result); } } else { $this->valid = false; } } //valid returns 1 if the current position is a valid array index //and 0 if it is not valid public function valid() { return $this->valid; } } The following class is an example of how I am accessing the database: class ImageCount { public function getCount() { $mysqlConnector = new MySQLConnect(); $query = "SELECT * FROM images;"; $resultSet = $mysqlConnector->createResultSet($query, MySQLConfig::DB); $mysqlConnector->close(); return $resultSet->getNumberRows(); } } I use the ImageCount class like this: if(!ImageCount::getCount()) { //Do something } Question: Is this an okay way to access the database? Could anybody recommend an alternative method if it is bad? Thank-you.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Best way to model map values in Grails?

    - by Mulone
    Hi guys, I have to implement map values in my Grails app. I have a class that can contain 0..N OsmTags, and the key is unique. In Java I would model this with a Map in each object, but I don't know how to map classes in Grails. So I defined this class: class OsmTag { /** OSM tag name, e.g. natural */ String key /** OSM tag value, e.g. park */ String value static constraints = { key blank:false, size:2..80,matches:/[\S]+/, unique:false value blank:false, size:1..250,matches:/[\S]+/, unique:false } } That works ok, but it's actually quite ugly because the tag key is not unique. Is there a better way to model this issue? Cheers

    Read the article

  • Unable to create application factory of class org.apache.wicket.spring.SpringWebApplicationFactory

    - by theJava
    org.apache.wicket.protocol.http.WebApplicationFactoryCreationException: Unable to create application factory of class org.apache.wicket.spring.SpringWebApplicationFactory at org.apache.wicket.protocol.http.WicketFilter.getApplicationFactory(WicketFilter.java:228) at org.apache.wicket.protocol.http.WicketFilter.init(WicketFilter.java:271) at org.apache.wicket.protocol.http.WicketFilter.init(WicketFilter.java:252) at org.mortbay.jetty.servlet.FilterHolder.doStart(FilterHolder.java:97) at org.mortbay.component.AbstractLifeCycle.start(AbstractLifeCycle.java:50) at org.mortbay.jetty.servlet.ServletHandler.initialize(ServletHandler.java:713) at org.mortbay.jetty.servlet.Context.startContext(Context.java:140) at org.mortbay.jetty.webapp.WebAppContext.startContext(WebAppContext.java:1282) at org.mortbay.jetty.handler.ContextHandler.doStart(ContextHandler.java:518) at org.mortbay.jetty.webapp.WebAppContext.doStart(WebAppContext.java:499) at org.mortbay.jetty.plugin.Jetty6PluginWebAppContext.doStart(Jetty6PluginWebAppContext.java:115) at org.mortbay.component.AbstractLifeCycle.start(AbstractLifeCycle.java:50) at org.mortbay.jetty.handler.HandlerCollection.doStart(HandlerCollection.java:152) at org.mortbay.jetty.handler.ContextHandlerCollection.doStart(ContextHandlerCollection.java:156) at org.mortbay.component.AbstractLifeCycle.start(AbstractLifeCycle.java:50) at org.mortbay.jetty.handler.HandlerCollection.doStart(HandlerCollection.java:152) at org.mortbay.component.AbstractLifeCycle.start(AbstractLifeCycle.java:50) at org.mortbay.jetty.handler.HandlerWrapper.doStart(HandlerWrapper.java:130) at org.mortbay.jetty.Server.doStart(Server.java:224) at org.mortbay.component.AbstractLifeCycle.start(AbstractLifeCycle.java:50) at org.mortbay.jetty.plugin.Jetty6PluginServer.start(Jetty6PluginServer.java:132) at org.mortbay.jetty.plugin.AbstractJettyMojo.startJetty(AbstractJettyMojo.java:454) at org.mortbay.jetty.plugin.AbstractJettyMojo.execute(AbstractJettyMojo.java:396) at org.mortbay.jetty.plugin.AbstractJettyRunMojo.execute(AbstractJettyRunMojo.java:210) at org.mortbay.jetty.plugin.Jetty6RunMojo.execute(Jetty6RunMojo.java:184) at org.apache.maven.plugin.DefaultBuildPluginManager.executeMojo(DefaultBuildPluginManager.java:107) at org.apache.maven.lifecycle.internal.MojoExecutor.execute(MojoExecutor.java:195) at org.apache.maven.lifecycle.internal.MojoExecutor.execute(MojoExecutor.java:148) at org.apache.maven.lifecycle.internal.MojoExecutor.execute(MojoExecutor.java:140) at org.apache.maven.lifecycle.internal.LifecycleModuleBuilder.buildProject(LifecycleModuleBuilder.java:84) at org.apache.maven.lifecycle.internal.LifecycleModuleBuilder.buildProject(LifecycleModuleBuilder.java:59) at org.apache.maven.lifecycle.internal.LifecycleStarter.singleThreadedBuild(LifecycleStarter.java:183) at org.apache.maven.lifecycle.internal.LifecycleStarter.execute(LifecycleStarter.java:161) at org.apache.maven.DefaultMaven.doExecute(DefaultMaven.java:314) at org.apache.maven.DefaultMaven.execute(DefaultMaven.java:151) at org.apache.maven.cli.MavenCli.execute(MavenCli.java:445) at org.apache.maven.cli.MavenCli.doMain(MavenCli.java:168) at org.apache.maven.cli.MavenCli.main(MavenCli.java:132) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.codehaus.plexus.classworlds.launcher.Launcher.launchEnhanced(Launcher.java:290) at org.codehaus.plexus.classworlds.launcher.Launcher.launch(Launcher.java:230) at org.codehaus.plexus.classworlds.launcher.Launcher.mainWithExitCode(Launcher.java:409) at org.codehaus.plexus.classworlds.launcher.Launcher.main(Launcher.java:352) 2010-12-28 14:51:46.213:INFO::Started [email protected]:8080 I am using Wicket 1.5 M3, Spring 3.0 and i am getting this error. Below is my Web.xml config. <?xml version="1.0" encoding="ISO-8859-1"?> <web-app xmlns="http://java.sun.com/xml/ns/j2ee" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://java.sun.com/xml/ns/j2ee http://java.sun.com/xml/ns/j2ee/web-app_2_4.xsd" version="2.4"> <display-name>mysticpaste</display-name> <!-- There are three means to configure Wickets configuration mode and they are tested in the order given. 1) A system property: -Dwicket.configuration 2) servlet specific <init-param> 3) context specific <context-param> The value might be either "development" (reloading when templates change) or "deployment". If no configuration is found, "development" is the default. --> <filter> <filter-name>wicket.mysticpaste</filter-name> <filter-class> org.apache.wicket.protocol.http.WicketFilter </filter-class> <init-param> <param-name>applicationFactoryClassName</param-name> <param-value>org.apache.wicket.spring.SpringWebApplicationFactory</param-value> </init-param> </filter> <context-param> <param-name>contextConfigLocation</param-name> <param-value>classpath:com/mysticcoders/mysticpaste/spring/application-context.xml</param-value> </context-param> <listener> <listener-class> org.springframework.web.context.ContextLoaderListener </listener-class> </listener> <filter> <filter-name>wicket.session</filter-name> <filter-class>org.apache.wicket.protocol.http.servlet.WicketSessionFilter</filter-class> <init-param> <param-name>filterName</param-name> <param-value>wicket.mysticpaste</param-value> </init-param> </filter> <filter-mapping> <filter-name>wicket.session</filter-name> <url-pattern>/servlet/*</url-pattern> </filter-mapping> <filter> <filter-name>open.hibernate.session.in.view</filter-name> <filter-class>org.springframework.orm.hibernate3.support.OpenSessionInViewFilter</filter-class> </filter> <!-- Important! This filter mapping must come before Wicket's! --> <filter-mapping> <filter-name>open.hibernate.session.in.view</filter-name> <url-pattern>/*</url-pattern> </filter-mapping> </web-app>

    Read the article

  • Django unit testing: South-migrated DB works in MySQL, throws duplicate PK error in PostGreSQL. Am I

    - by unclaimedbaggage
    Hi folks, (Worth starting off with a disclaimer: I'm very new to PostGreSQL) I have a django site which involves a standard app/tests.py testing file. If I migrate the DB to MySQL (through South),, the tests all pass. However in PostGresQL, I'm getting the following error: IntegrityError: duplicate key value violates unique constraint "business_contact_pkey" Note this happens while unit testing only - the actual page runs fine in both MySQL & PostGresql. Really having a heckuva time figuring this one out. Anyone have ideas? Below are the Postgresql "\d business_contact" & offending tests.py method if they help. No changes made to either DB except the (same) South migrations Thanks first_name | character varying(200) | not null mobile_phone | character varying(100) | surname | character varying(200) | not null business_id | integer | not null created | timestamp with time zone | not null deleted | boolean | not null default false updated | timestamp with time zone | not null slug | character varying(150) | not null phone | character varying(100) | email | character varying(75) | id | integer | not null default nextval('business_contact_id_seq'::regclass) Indexes: "business_contact_pkey" PRIMARY KEY, btree (id) "business_contact_slug_key" UNIQUE, btree (slug) "business_contact_business_id" btree (business_id) Foreign-key constraints: "business_id_refs_id_772cc1b7b40f4b36" FOREIGN KEY (business_id) REFERENCES business(id) DEFERRABLE INITIALLY DEFERRED Referenced by: TABLE "business" CONSTRAINT "primary_contact_id_refs_id_dfaf59c4041c850" FOREIGN KEY (primary_contact_id) REFERENCES business_contact(id) DEFERRABLE INITIALLY DEFERRED TEST DEF: def test_add_business_contact(self): """ Add a business contact """ contact_slug = 'test-new-contact-added-new-adf' business_id = 1 business = Business.objects.get(id=business_id) postdata = { 'first_name': 'Test', 'surname': 'User', 'business': '1', 'slug': contact_slug, 'email': '[email protected]', 'phone': '12345678', 'mobile_phone': '9823452', 'business': 1, 'business_id': 1, } #Test to ensure contacts that should not exist are not returned contact_not_exists = Contact.objects.filter(slug=contact_slug) self.assertFalse(contact_not_exists) #Add the contact and ensure it is present in the DB afterwards """ contact_add_url = '%s%s/contact/add/' % (settings.BUSINESS_URL, business.slug) self.client.post(contact_add_url, postdata) added_contact = Contact.objects.filter(slug=contact_slug) print added_contact try: self.assertTrue(added_contact) except: formset = ContactForm(postdata) print formset.errors self.assertFalse(True, "Contact not found in the database - most likely, the post values in the test didn't validate against the form")

    Read the article

  • How to get started with testing(jMock)

    - by London
    Hello, I'm trying to learn how to write tests. I'm also learning Java, I was told I should learn/use/practice jMock, I've found some articles online that help to certain extend like : http://www.theserverside.com/news/1365050/Using-JMock-in-Test-Driven-Development http://jeantessier.com/SoftwareEngineering/Mocking.html#jMock And most articles I found was about test driven development, write tests first then write code to make the test pass. I'm not looking for that at the moment, I'm trying to write tests for already existing code with jMock. The official documentation is vague to say the least and just too hard for me. Does anybody have better way to learn this. Good books/links/tutorials would help me a lot. thank you EDIT - more concrete question : http://jeantessier.com/SoftwareEngineering/Mocking.html#jMock - from this article Tried this to mock this simple class : import java.util.Map; public class Cache { private Map<Integer, String> underlyingStorage; public Cache(Map<Integer, String> underlyingStorage) { this.underlyingStorage = underlyingStorage; } public String get(int key) { return underlyingStorage.get(key); } public void add(int key, String value) { underlyingStorage.put(key, value); } public void remove(int key) { underlyingStorage.remove(key); } public int size() { return underlyingStorage.size(); } public void clear() { underlyingStorage.clear(); } } Here is how I tried to create a test/mock : public class CacheTest extends TestCase { private Mockery context; private Map mockMap; private Cache cache; @Override @Before public void setUp() { context = new Mockery() { { setImposteriser(ClassImposteriser.INSTANCE); } }; mockMap = context.mock(Map.class); cache = new Cache(mockMap); } public void testCache() { context.checking(new Expectations() {{ atLeast(1).of(mockMap).size(); will(returnValue(int.class)); }}); } } It passes the test and basically does nothing, what I wanted is to create a map and check its size, and you know work some variations try to get a grip on this. Understand better trough examples, what else could I test here or any other exercises would help me a lot. tnx

    Read the article

  • How can I ensure that a Java object (containing cryptographic material) is zeroized?

    - by Jeremy Powell
    My concern is that cryptographic keys and secrets that are managed by the garbage collector may be copied and moved around in memory without zeroization. As a possible solution, is it enough to: public class Key { private char[] key; // ... protected void finalize() throws Throwable { try { for(int k = 0; k < key.length; k++) { key[k] = '\0'; } } catch (Exception e) { //... } finally { super.finalize(); } } // ... }

    Read the article

  • How can I optimize this subqueried and Joined MySQL Query?

    - by kevzettler
    I'm pretty green on mysql and I need some tips on cleaning up a query. It is used in several variations through out a site. Its got some subquerys derived tables and fun going on. Heres the query: # Query_time: 2 Lock_time: 0 Rows_sent: 0 Rows_examined: 0 SELECT * FROM ( SELECT products . *, categories.category_name AS category, ( SELECT COUNT( * ) FROM distros WHERE distros.product_id = products.product_id) AS distro_count, (SELECT COUNT(*) FROM downloads WHERE downloads.product_id = products.product_id AND WEEK(downloads.date) = WEEK(curdate())) AS true_downloads, (SELECT COUNT(*) FROM views WHERE views.product_id = products.product_id AND WEEK(views.date) = WEEK(curdate())) AS true_views FROM products INNER JOIN categories ON products.category_id = categories.category_id ORDER BY created_date DESC, true_views DESC ) AS count_table WHERE count_table.distro_count > 0 AND count_table.status = 'published' AND count_table.active = 1 LIMIT 0, 8 Heres the explain: +----+--------------------+------------+-------+---------------+-------------+---------+------------------------------------+------+----------------------------------------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+--------------------+------------+-------+---------------+-------------+---------+------------------------------------+------+----------------------------------------------+ | 1 | PRIMARY | <derived2> | ALL | NULL | NULL | NULL | NULL | 232 | Using where | | 2 | DERIVED | categories | index | PRIMARY | idx_name | 47 | NULL | 13 | Using index; Using temporary; Using filesort | | 2 | DERIVED | products | ref | category_id | category_id | 4 | digizald_db.categories.category_id | 9 | | | 5 | DEPENDENT SUBQUERY | views | ref | product_id | product_id | 4 | digizald_db.products.product_id | 46 | Using where | | 4 | DEPENDENT SUBQUERY | downloads | ref | product_id | product_id | 4 | digizald_db.products.product_id | 14 | Using where | | 3 | DEPENDENT SUBQUERY | distros | ref | product_id | product_id | 4 | digizald_db.products.product_id | 1 | Using index | +----+--------------------+------------+-------+---------------+-------------+---------+------------------------------------+------+----------------------------------------------+ 6 rows in set (0.04 sec) And the Tables: mysql> describe products; +---------------+--------------------------------------------------+------+-----+-------------------+----------------+ | Field | Type | Null | Key | Default | Extra | +---------------+--------------------------------------------------+------+-----+-------------------+----------------+ | product_id | int(10) unsigned | NO | PRI | NULL | auto_increment | | product_key | char(32) | NO | | NULL | | | title | varchar(150) | NO | | NULL | | | company | varchar(150) | NO | | NULL | | | user_id | int(10) unsigned | NO | MUL | NULL | | | description | text | NO | | NULL | | | video_code | text | NO | | NULL | | | category_id | int(10) unsigned | NO | MUL | NULL | | | price | decimal(10,2) | NO | | NULL | | | quantity | int(10) unsigned | NO | | NULL | | | downloads | int(10) unsigned | NO | | NULL | | | views | int(10) unsigned | NO | | NULL | | | status | enum('pending','published','rejected','removed') | NO | | NULL | | | active | tinyint(1) | NO | | NULL | | | deleted | tinyint(1) | NO | | NULL | | | created_date | datetime | NO | | NULL | | | modified_date | timestamp | NO | | CURRENT_TIMESTAMP | | | scrape_source | varchar(215) | YES | | NULL | | +---------------+--------------------------------------------------+------+-----+-------------------+----------------+ 18 rows in set (0.00 sec) mysql> describe categories -> ; +------------------+------------------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +------------------+------------------+------+-----+---------+----------------+ | category_id | int(10) unsigned | NO | PRI | NULL | auto_increment | | category_name | varchar(45) | NO | MUL | NULL | | | parent_id | int(10) unsigned | YES | MUL | NULL | | | category_type_id | int(10) unsigned | NO | | NULL | | +------------------+------------------+------+-----+---------+----------------+ 4 rows in set (0.00 sec) mysql> describe compatibilities -> ; +------------------+------------------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +------------------+------------------+------+-----+---------+----------------+ | compatibility_id | int(10) unsigned | NO | PRI | NULL | auto_increment | | name | varchar(45) | NO | | NULL | | | code_name | varchar(45) | NO | | NULL | | | description | varchar(128) | NO | | NULL | | | position | int(10) unsigned | NO | | NULL | | +------------------+------------------+------+-----+---------+----------------+ 5 rows in set (0.01 sec) mysql> describe distros -> ; +------------------+--------------------------------------------------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +------------------+--------------------------------------------------+------+-----+---------+----------------+ | id | int(10) unsigned | NO | PRI | NULL | auto_increment | | product_id | int(10) unsigned | NO | MUL | NULL | | | compatibility_id | int(10) unsigned | NO | MUL | NULL | | | user_id | int(10) unsigned | NO | | NULL | | | status | enum('pending','published','rejected','removed') | NO | | NULL | | | distro_type | enum('file','url') | NO | | NULL | | | version | varchar(150) | NO | | NULL | | | filename | varchar(50) | YES | | NULL | | | url | varchar(250) | YES | | NULL | | | virus | enum('READY','PASS','FAIL') | YES | | NULL | | | downloads | int(10) unsigned | NO | | 0 | | +------------------+--------------------------------------------------+------+-----+---------+----------------+ 11 rows in set (0.01 sec) mysql> describe downloads; +------------+------------------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +------------+------------------+------+-----+---------+----------------+ | id | int(10) unsigned | NO | PRI | NULL | auto_increment | | product_id | int(10) unsigned | NO | MUL | NULL | | | distro_id | int(10) unsigned | NO | MUL | NULL | | | user_id | int(10) unsigned | NO | MUL | NULL | | | ip_address | varchar(15) | NO | | NULL | | | date | datetime | NO | | NULL | | +------------+------------------+------+-----+---------+----------------+ 6 rows in set (0.01 sec) mysql> describe views -> ; +------------+------------------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +------------+------------------+------+-----+---------+----------------+ | id | int(10) unsigned | NO | PRI | NULL | auto_increment | | product_id | int(10) unsigned | NO | MUL | NULL | | | user_id | int(10) unsigned | NO | MUL | NULL | | | ip_address | varchar(15) | NO | | NULL | | | date | datetime | NO | | NULL | | +------------+------------------+------+-----+---------+----------------+ 5 rows in set (0.00 sec)

    Read the article

  • Implementing a logging library in .NET with a database as the storage medium

    - by Dave
    I'm just starting to work on a logging library that everyone can use to keep track of any sort of system information while the user is running our application. The simplest example so far is to track Info, Warnings, and Errors. I want all plugins to be able to use this feature, but since each developer might have a different idea of what's important to report, I want to keep this as generic as possible. In the C++ world, I would normally use something like a stl::pair<string,string> to act as a key value pair structure, and have a stl::list of these to act as a "row" in the log. The log cache would then be a list<list<pair<string,string>>> (ugh!). This way, the developers can use a const string key like INFO, WARNING, ERROR to have a consistent naming for a column in the database (for SELECTing specific types of information). I'd like the database to be able to deal with any number of distinct column names. For example, John might have an INFO row with a column called USER, and Bill might have an INFO row with a column called FILENAME. I want the log viewer to be able to display all information, and if one report doesn't have a value for INFO / FILENAME, those fields should just appear blank. So one option is to use List<List<KeyValuePair<String,String>>, and the another is to have the log library consumer somehow "register" its schema, and then have the database do an ALTER TABLE to handle this situation. Yet another idea is to have a table that's just for key value pairs, with a foreign key that maps the key value pairs back to the original log entry. I obviously don't want logging to bog down the system, so I only lock the log cache to make a copy of the data (and remove the already-copied data), then a background thread will dump the information to the database. My specific questions regarding this are: Do you see any performance issues? In other words, have you ever tried something like this and found that certain things just don't work well in practice? Is there a more .NETish way to implement the key value pairs, other than List<List<KeyValuePair<String,String>>>? Even if there is a way to do #2 better, is the ALTER TABLE idea I proposed above a Bad Thing? Would you recommend multiple databases over a single one? I don't yet have an idea of how frequently the log would get written to, but we ideally would like to have lots of low level information. Perhaps there should be a DB with a fixed schema only for the low level stuff, and then another DB that's more flexible for reporting information back to users.

    Read the article

  • SSL Authentication with Certificates: Should the Certificates have a hostname?

    - by sixtyfootersdude
    Summary JBoss allows clients and servers to authenticate using certificates and ssl. One thing that seems strange is that you are not required to give your hostname on the certificate. I think that this means if Server B is in your truststore, Sever B can pretend to be any server that they want. (And likewise: if Client B is in your truststore...) Am I missing something here? Authentication Steps (Summary of Wikipeida Page) Client Server ================================================================================================= 1) Client sends Client Hello ENCRIPTION: None - highest TLS protocol supported - random number - list of cipher suites - compression methods 2) Sever Hello ENCRIPTION: None - highest TLS protocol supported - random number - choosen cipher suite - choosen compression method 3) Certificate Message ENCRIPTION: None - 4) ServerHelloDone ENCRIPTION: None 5) Certificate Message ENCRIPTION: None 6) ClientKeyExchange Message ENCRIPTION: server's public key => only server can read => if sever can read this he must own the certificate - may contain a PreMasterSecerate, public key or nothing (depends on cipher) 7) CertificateVerify Message ENCRIPTION: clients private key - purpose is to prove to the server that client owns the cert 8) BOTH CLIENT AND SERVER: - use random numbers and PreMasterSecret to compute a common secerate 9) Finished message - contains a has and MAC over previous handshakes (to ensure that those unincripted messages did not get broken) 10) Finished message - samething Sever Knows The client has the public key for the sent certificate (step 7) The client's certificate is valid because either: it has been signed by a CA (verisign) it has been self-signed BUT it is in the server's truststore It is not a replay attack because presumably the random number (step 1 or 2) is sent with each message Client Knows The server has the public key for the sent certificate (step 6 with step 8) The server's certificate is valid because either: it has been signed by a CA (verisign) it has been self-signed BUT it is in the client's truststore It is not a replay attack because presumably the random number (step 1 or 2) is sent with each message Potential Problem Suppose the client's truststore has certs in it: Server A Server B (malicous) Server A has hostname www.A.com Server B has hostname www.B.com Suppose: The client tries to connect to Server A but Server B launches a man in the middle attack. Since server B: has a public key for the certificate that will be sent to the client has a "valid certificate" (a cert in the truststore) And since: certificates do not have a hostname feild in them It seems like Server B can pretend to be Server A easily. Is there something that I am missing?

    Read the article

  • Entity Framework 4 Self Many-To-Many with Properties

    - by csharpnoob
    UPDATE: Solved by myself. Tricky but works. If you know a better solution, feel free to correct me. DESIGNER: CODE: Product product1 = new Product{key = "Product 1"}; sd.AddToProducts(product1); Product product2 = new Product{key = "Product 2"}; sd.AddToProducts(product2); Product product3 = new Product{key = "Product 3"}; ProductRelated pr = new ProductRelated(); pr.Products.Add(product1); pr.Products.Add(product2); product3.ProductRelateds.Add(pr); sd.AddToProducts(product3); CODE VIEW: foreach(var x in (from b in sd.Products select b)) { %><%=x.key %><br /> <% foreach (var y in x.ProductRelateds) { foreach (var k in y.Products) { %>- <%=k.key%><br /><%} } } OUTPUT Product1 Product2 Product3 - Product2 - Product1 QUESTION: Hi, i want to have a Self Reference for Releated Products on a Product Entity, something like here: http://my.safaribooksonline.com/9781430227038/modeling_a_many-to-many_comma_self-refer But i also want on the Many-To-Many Reference addional Properties like deleted, created etc. I tried to do it by another Entity "Related", but somehow it won't work. Does anyone had this Problem before? Is there any other Example? Thanks

    Read the article

  • Make dictionary from list with python

    - by prosseek
    I need to transform a list into dictionary as follows. The odd elements has the key, and even number elements has the value. x = (1,'a',2,'b',3,'c') - {1: 'a', 2: 'b', 3: 'c'} def set(self, val_): i = 0 for val in val_: if i == 0: i = 1 key = val else: i = 0 self.dict[key] = val My solution seems to long, is there a better way to get the same results?

    Read the article

  • Combining 2 Linq queries into 1

    - by Mike Fielden
    Given the following information, how can I combine these 2 linq queries into 1. Having a bit of trouble with the join statement. 'projectDetails' is just a list of ProjectDetails ProjectDetails (1 to many) PCardAuthorizations ProjectDetails (1 to many) ExpenditureDetails Notice I am grouping by the same information and selecting the same type of information var pCardAccount = from c in PCardAuthorizations where projectDetails.Contains(c.ProjectDetail) && c.RequestStatusId == 2 group c by new { c.ProjectDetail, c.ProgramFund } into g select new { Key = g.Key, Sum = g.Sum(x => x.Amount) }; var expenditures = from d in ExpenditureDetails where projectDetails.Contains(d.ProjectDetails) && d.Expenditures.ExpenditureTypeEnum == 0 group d by new { d.ProjectDetails, d.ProgramFunds } into g select new { Key = g.Key, Sum = g.Sum(y => y.ExpenditureAmounts.FirstOrDefault(a => a.IsCurrent && !a.RequiresAudit).CommittedMonthlyRecords.ProjectedEac) };

    Read the article

  • Exporting dates properly formatted on Google Appengine in Python

    - by Chris M
    I think this is right but google appengine seems to get to a certain point and cop-out; Firstly is this code actually right; and secondly is there away to skip the record if it cant output (like an ignore errors and continue)? class TrackerExporter(bulkloader.Exporter): def __init__(self): bulkloader.Exporter.__init__(self, 'SearchRec', [('__key__', lambda key:key.name(), None), ('WebSite', str, None), ('DateStamp', lambda x: datetime.datetime.strptime(x, '%d-%m-%Y').date(), None), ('IP', str, None), ('UserAgent', str, None)]) Thanks

    Read the article

  • Ways to update a dependent table in the same MySQL transaction?

    - by codie
    I need to update two tables inside a single transaction. The individual queries look something like this: 1. INSERT INTO t1 (col1, col2) VALUES (val1, val2) ON DUPLICATE KEY UPDATE col2 = val2; If the above query causes an insert then I need to run the following statement on the second table: 2. INSERT INTO t2 (col1, col2) VALUES (val1, val2) ON DUPLICATE KEY UPDATE col2 = col2 + val2; otherwise, 3. UPDATE t2 SET col2 = col2 - old_val2 + val2 WHERE col1 = val1; -- old_val2 is the value of t1.col2 before it was updated Right now I run a SELECT on t1 first, to determine whether statement 1 will cause an insert or update on t1. Then I run statement 1 and either of 2 and 3 inside a transaction. What are the ways in which I can do all of these inside one transaction itself? The approach I was thinking of is the following: UPDATE t2, t1 set t2.col2 = t2.col2 - t1.col2 WHERE t1.col1 = t2.col2 and t1.col1 = val1; INSERT INTO t1 (col1, col2) VALUES (val1, val2) ON DUPLICATE KEY UPDATE col2 = val2; INSERT INTO t2, t1 (t2.col1, t2.col2) VALUES (t1.col1, t1.col2) ON DUPLICATE KEY UPDATE t2.col2 = t2.col2 + t1.col2 WHERE t1.col1 = t2.col2 and t1.col1 = val1; Unfortunately, there's no multi-table INSERT... ON DUPLICATE KEY UPDATE in MySQL 5.0. What else could I do?

    Read the article

  • VB.NET: Dialog exits when enter pressed?

    - by Camilo Martin
    Hi all; My problem seems to be quite simple, but it's not working the intuitive way. I'm designing a Windows Forms Application, and there is a dialog that should NOT exit when the enter key is pressed, instead it has to validate data first, in case enter was pressed after changing the text of a ComboBox. I've tried by telling it what to do on KeyPress event of the ComboBox if e is the Enter key: Private Sub ComboBoxSizeChoose_KeyPress(ByVal sender As System.Object, ByVal e As System.Windows.Forms.KeyPressEventArgs) Handles ComboBoxSizeChoose.KeyPress If e.KeyChar = Convert.ToChar(Keys.Enter) Then Try TamanhoDaNovaFonte = Single.Parse(ComboBoxSizeChoose.Text) Catch ex As Exception Dim Dialogo2 As New Dialog2 Dialog2.ShowDialog() ComboBoxSizeChoose.Text = TamanhoDaNovaFonte End Try End If End Sub But no success so far. When the Enter key is pressed, even with the ComboBox on focus, the whole dialog is closed, returning to the previous form. The validation is NOT done at all, and it has to be done before exiting. In fact, I don't even want to exit on the form's enter KeyPress, the only purpose of the enter key on the whole dialog is to validate the ComboBox (but only when in focus, for the sake of an intuitive UI). I've also tried appending the validation to the KeyPress event of the whole dialog's form, if the key is Enter. NO SUCCESS! It's like my code wasn't there at all. What should I do? (Visual Studio 2008, VB.NET)

    Read the article

  • PHPMailer attachment type and size limit

    - by SomeoneS
    i have one form and i am using PHPMailer to send data from that form to my email. Users can send attachments as well, but i have one rpoblem: how to make PHPMailer to deny attachments larger than 2Mb and to allow only iamge attachments (no other types of documents)? This is code i using for multiply email attachments with PHPMailer: foreach(array_keys($_FILES['fileAttach']['name']) as $key) { $source = $_FILES['fileAttach']['tmp_name'][$key]; $filename = $_FILES['fileAttach']['name'][$key]; $mail->AddAttachment($source, $filename); }

    Read the article

< Previous Page | 211 212 213 214 215 216 217 218 219 220 221 222  | Next Page >