Search Results

Search found 6020 results on 241 pages for 'valid'.

Page 219/241 | < Previous Page | 215 216 217 218 219 220 221 222 223 224 225 226  | Next Page >

  • LINQ Query returns false when it should be true.

    - by deliriousDev
    I have the following LINQ query written by a former developer and it isn't working when it should. public bool IsAvailable(Appointment appointment) { var appointments = _appointmentRepository.Get; var shifts = _scheduleRepository.Get; var city = _customerRepository.Find(appointment.CustomerId).City ?? appointment.Customer.City; const int durationHour = 1; DateTime scheduledEndDate = appointment.ScheduledTime.Add(new TimeSpan(durationHour, 0, 0)); var inWorkingHours = shifts .Where(x => //Check if any available working hours x.Employee.City == city && x.ShiftStart <= appointment.ScheduledTime && x.ShiftEnd >= scheduledEndDate && //check if not booked yet !appointments .Where(a => (appointment.Id == 0 || a.Id != appointment.Id) && a.Employee.Id == x.Employee.Id && ( (a.ScheduledTime <= appointment.ScheduledTime && appointment.ScheduledTime <= EntityFunctions.AddHours(a.ScheduledTime, durationHour)) || (a.ScheduledTime <= scheduledEndDate && scheduledEndDate <= EntityFunctions.AddHours(a.ScheduledTime, durationHour)) )) .Select(a => a.Employee.Id) .Contains(x.Employee.Id) ); if (inWorkingHours.Any()) { var assignedEmployee = inWorkingHours.FirstOrDefault().Employee; appointment.EmployeeId = assignedEmployee.Id; appointment.Employee = assignedEmployee; return true; } return false; } The query is suppose to handle the following scenarios Given An Appointment With A ScheduledTime Between A ShiftStart and ShiftEnd time But Does not match any employees in same city - (Return true, Assign as "Unassigned") Given An Appointment With A ScheduledTime Between A ShiftStart and ShiftEnd time AND Employee for that shift is in the same city as the customer (Return True AND Assign to the employee) If the customer is NOT in the same city as an employee we assign the appointment as "Unassigned" as along as the scheduledTime is within an of the employees shift start/end times If the customer is in the same city as an employee we assign the appointment to one of the employees (firstOrdefault) and occupy that timeslot. Appointments CAN NOT overlap (Assigned Ones). Unassigned can't overlap each other. This query use to work (I've been told). But now it doesn't and I have tried refactoring it and various other paths with no luck. I am now on week two and just don't know where the issue in the query is or how to write it. Let me know if I need to post anything further. I have verified appointments, shifts, city all populate with valid data so the issue doesn't appear to be with null or missing data.

    Read the article

  • dbms_xmlschema fail to validate with complexType

    - by Andrew
    Preface: This works on one Oracle 11gR1 (Solaris 64) database and not on a second and we can't figure out the difference between the two databases. Somehow the complexType causes the validation to fail with this error: ORA-31154: invalid XML document ORA-19202: Error occurred in XML processing LSX-00200: element "shiporder" not empty ORA-06512: at "SYS.XMLTYPE", line 354 ORA-06512: at line 13 But the schema is valid (passes this online test: http://www.xmlme.com/Validator.aspx) -- Cleanup any existing schema begin dbms_xmlschema.deleteschema('shiporder.xsd',dbms_xmlschema.DELETE_CASCADE); end; -- Define the problem schema (adapted from http://www.w3schools.com/schema/schema_example.asp) begin dbms_xmlschema.registerSchema('shiporder.xsd','<?xml version="1.0" encoding="ISO-8859-1" ?> <xs:schema xmlns:xs="http://www.w3.org/2001/XMLSchema"> <xs:element name="shiporder"> <xs:complexType> <xs:sequence> <xs:element name="orderperson" type="xs:string"/> </xs:sequence> </xs:complexType> </xs:element> </xs:schema>',owner=>'SCOTT'); end; -- Attempt to validate declare bbb xmltype; begin bbb := XMLType('<?xml version="1.0" encoding="ISO-8859-1"?> <shiporder xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:noNamespaceSchemaLocation="shiporder.xsd"> <orderperson>John Smith</orderperson> </shiporder>'); XMLType.schemaValidate(bbb); end; Now if I gut the schema definition and leave only a string in the XML then the validation passes: begin dbms_xmlschema.deleteschema('shiporder.xsd',dbms_xmlschema.DELETE_CASCADE); end; begin dbms_xmlschema.registerSchema('shiporder.xsd','<?xml version="1.0" encoding="ISO-8859-1" ?> <xs:schema xmlns:xs="http://www.w3.org/2001/XMLSchema"> <xs:element name="shiporder" type="xs:string"/> </xs:schema>',owner=>'SCOTT'); end; DECLARE xml XMLTYPE; BEGIN xml := XMLTYPE('<?xml version="1.0" encoding="ISO-8859-1"?> <shiporder xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:noNamespaceSchemaLocation="shiporder.xsd"> John Smith </shiporder>'); XMLTYPE.schemaValidate(xml); END;

    Read the article

  • Checking if an int is prime more efficiently

    - by SipSop
    I recently was part of a small java programming competition at my school. My partner and I have just finished our first pure oop class and most of the questions were out of our league so we settled on this one (and I am paraphrasing somewhat): "given an input integer n return the next int that is prime and its reverse is also prime for example if n = 18 your program should print 31" because 31 and 13 are both prime. Your .class file would then have a test case of all the possible numbers from 1-2,000,000,000 passed to it and it had to return the correct answer within 10 seconds to be considered valid. We found a solution but with larger test cases it would take longer than 10 seconds. I am fairly certain there is a way to move the range of looping from n,..2,000,000,000 down as the likely hood of needing to loop that far when n is a low number is small, but either way we broke the loop when a number is prime under both conditions is found. At first we were looping from 2,..n no matter how large it was then i remembered the rule about only looping to the square root of n. Any suggestions on how to make my program more efficient? I have had no classes dealing with complexity analysis of algorithms. Here is our attempt. public class P3 { public static void main(String[] args){ long loop = 2000000000; long n = Integer.parseInt(args[0]); for(long i = n; i<loop; i++) { String s = i +""; String r = ""; for(int j = s.length()-1; j>=0; j--) r = r + s.charAt(j); if(prime(i) && prime(Long.parseLong(r))) { System.out.println(i); break; } } System.out.println("#"); } public static boolean prime(long p){ for(int i = 2; i<(int)Math.sqrt(p); i++) { if(p%i==0) return false; } return true; } } ps sorry if i did the formatting for code wrong this is my first time posting here. Also the output had to have a '#' after each line thats what the line after the loop is about Thanks for any help you guys offer!!!

    Read the article

  • Javascript AJAX function not working in IE?

    - by Sam152
    I have this code: function render_message(id) { var xmlHttp; xmlHttp=new XMLHttpRequest(); xmlHttp.onreadystatechange=function() { if(xmlHttp.readyState==4) { document.getElementById('message').innerHTML=xmlHttp.responseText; document.getElementById('message').style.display=''; } } var url="include/javascript/message.php"; url=url+"?q="+id; xmlHttp.open("GET",url,true); xmlHttp.send(null); } For some reason it does not work in IE and an error is being reported on this line "document.getElementById('message').innerHTML=xmlHttp.responseText;" with an "Unknown Runtime Error". Can anyone help? Edit: The code being added to the div is valid code ect. Here is the response: <div style="margin-left:auto;margin-right:auto;width:400px;"> <img src="/forum/img/avatars/2.gif" width="90" height="89" style="float:left;"> <div style="margin-left:100px;"> <span style="font-size:16pt;">Sam152</a></span><br> <span style="font-size:10pt;text-transform:uppercase;font-weight:bold;">From Sam152</span><br> <span style="font-size:10pt;font-weight:bold;">Recieved April 17, 2009, 9:44 am</span><br> <br><br> </div> </div> <div style="margin-left:auto;margin-right:auto;width:400px;"> asd</div> <div style="margin-left:auto;margin-right:auto;width:400px;text-align:right;padding-top:10px;"> <span onClick="requestPage('http://www.gametard.com/include/scripts/delete_message.php?id=14');document.getElementById('message14').style.display='none';document.getElementById('message').style.display='none';" class="button">Delete</span> <span onClick="document.getElementById('message').style.display='none';" class="button">Close</span> <span onClick="document.getElementById('to').value ='Sam152';document.getElementById('to').style.color ='#000';document.getElementById('newmessage').style.display='';" class="button">Reply</span> </div>

    Read the article

  • std::ostream interface to an OLE IStream

    - by PaulH
    I have a Visual Studio 2008 C++ application using IStreams. I would like to use the IStream connection in a std::ostream. Something like this: IStream* stream = /*create valid IStream instance...*/; IStreamBuf< WIN32_FIND_DATA > sb( stream ); std::ostream os( &sb ); WIN32_FIND_DATA d = { 0 }; // send the structure along the IStream os << d; To accomplish this, I've implemented the following code: template< class _CharT, class _Traits > inline std::basic_ostream< _CharT, _Traits >& operator<<( std::basic_ostream< _CharT, _Traits >& os, const WIN32_FIND_DATA& i ) { const _CharT* c = reinterpret_cast< const _CharT* >( &i ); const _CharT* const end = c + sizeof( WIN32_FIND_DATA ) / sizeof( _CharT ); for( c; c < end; ++c ) os << *c; return os; } template< typename T > class IStreamBuf : public std::streambuf { public: IStreamBuf( IStream* stream ) : stream_( stream ) { setp( reinterpret_cast< char* >( &buffer_ ), reinterpret_cast< char* >( &buffer_ ) + sizeof( buffer_ ) ); }; virtual ~IStreamBuf() { sync(); }; protected: traits_type::int_type FlushBuffer() { int bytes = std::min< int >( pptr() - pbase(), sizeof( buffer_ ) ); DWORD written = 0; HRESULT hr = stream_->Write( &buffer_, bytes, &written ); if( FAILED( hr ) ) { return traits_type::eof(); } pbump( -bytes ); return bytes; }; virtual int sync() { if( FlushBuffer() == traits_type::eof() ) return -1; return 0; }; traits_type::int_type overflow( traits_type::int_type ch ) { if( FlushBuffer() == traits_type::eof() ) return traits_type::eof(); if( ch != traits_type::eof() ) { *pptr() = ch; pbump( 1 ); } return ch; }; private: /// data queued up to be sent T buffer_; /// output stream IStream* stream_; }; // class IStreamBuf Yes, the code compiles and seems to work, but I've not had the pleasure of implementing a std::streambuf before. So, I'd just like to know if it's correct and complete. Thanks, PaulH

    Read the article

  • Cannot interact with checkbox in FireFox or Chrome. Works in IE.

    - by Darxide
    Title says it all. Here's the code: <div id="regpage"> <form action="" method="post"> <fieldset style="border:none;"> <div class="label">Username:</div> <input type="text" name="username" class="item" value="" /><br /> <div class="caption">Must be 5-15 characters</div><br /> <div style="clear:both;"></div> <div class="label">Password:</div> <input type="password" name="password" class="item" value="" /><br /> <div class="caption">Must be 6-20 characters</div><br /> <div style="clear:both;"></div> <div class="label">Email:</div> <input type="text" name="email" class="item" value="" /><br /> <div class="caption">Valid email address is required</div><br /> <div style="clear:both;"></div> <input name="terms" type="checkbox" id="terms" value="agree" /><div class="caption2"><label for="terms">I agree to the terms and conditions</label></div> <p><input type="submit" name="register" value="Register" id="register" style="float:left;border:1px solid #999;background:#E4E4E4;margin-top:5px;" /></p><br /> </fieldset> </form> </div> And the id "regpage" is definded in the style.css as: #regpage { width: 356px; height: 150px; color: #000000; font-family: "Tahoma", Arial, Helvetica, sans-serif; font-size: 13px; } If I move the checkbox OUT of it works just fine. But inside it will not interact in Mozilla. I've even tried adding onclick='this.checked="checked"' and it still does not interact. You can click until your blue in the face and nothing will happen. What's the deal! This is REALLY driving me batty.

    Read the article

  • jQuery Table - Reference User Input Row Names and Values

    - by Vic
    I have several tables which are generated by another application, which I have no control over. I am totally new to jQuery and ajax, and have only a limited knowledge of jsp. Two sample rows are: <table class="sicknessForm"> <tr id="row_0" class="datarow"> <td id="col_2"><input name="row_0-col_2" class="tabcell" value="Injuries"></td> <td id="col_4"><input name="row_0-col_4" class="tabcell" value="01"></td> <td id="col_5"><input name="row_0-col_5" class="tabcell" value="2"></td> <td id="col_6"><input name="row_0-col_6" class="tabcell" value="5"></td> </tr> <tr id="row_1" class="datarow"> <td id="col_2"><input name="row_1-col_2" class="tabcell" value="Absences"></td> <td id="col_4"><input name="row_1-col_4" class="tabcell" value="100"></td> <td id="col_5"><input name="row_1-col_5" class="tabcell" value="102"></td> <td id="col_6"><input name="row_1-col_6" class="tabcell" value="105"></td> </tr> </table> There are more rows and columns in the actual tables. What I need to do is to pass the ordered row information to the database, e.g.: Injuries, 1, 2, 5 .... Absences 100, 102, 105... I can retrieve the values for each input using: $('#SicknessForm .userInput').each(function() { alert($(this).val()); }); 1) How can I loop through each row, get the value from the first column (Injuries) and place the data into an array to send to the server? 2) How do I reference the first row of each column to disable user input on it? $(:HowDoIReferenceThis).attr('disabled', ''); 3) I need to validate that each cell is numeric, other than the first column. Any pointers on this (otherwise I can check it in my servlet), especially on how to loop through all valid input cells (everything except 'Injuries','Abences', ... cells). Many Thanks! Vic

    Read the article

  • How to deal with class composition when components cannot be accessed from the outside?

    - by Chathuranga
    For example if I say I have three classes A, B, and C where B and C have a composition relation ship with A. That means the life of B and C is handled by A, and also B and C cannot access directly from the outside. For some reason my DataService class needs to return objects of B and C as It cant return a object of A as B and C cannot be initialized at the same time. (to be able to initializeC you have to initializeB first). So that I'm returning DataTables from DataService and then inside the class A those data tables are converted to B / C objects. If B and C objects cannot be initialized at the same time is it valid to say that B and C have a composition relationship with A? If its composition is it must to generate A with B and C inside? What is the proper way to handle this sort of a problem? EDIT: Following code explains the way I'm doing it now with DataTables. Example: class A { private List<B> B; private List <C> C; public A() { B= new List<B>(); C= new List<C>(); } public List<B> GetB( DataTable dt) { // Create a B list from dt return B; } } class Presenter { private void Show B() { _View.DataGrid = A.GetB(DataService.GetAListOfB()); } } The actual scenario is I have a class called WageInfo and classes Earning and Deduction having a composition relationship in the design. But for you to generate Deductions first you should Generate earnings and should be saved in a table. Then only you can generate deductions for the earnings to calculate balance wages. Also note that these contained classes have a one to many relationship with the containing class WageInfo. So actually WageInfo has a List<Earnings> and List<Deduction> My initial question was, is it ok if my DataService class returns Deductions / Earnings objects (actually lists) not a WageInfo? Still not clear?

    Read the article

  • Simplest way to flatten document to a view in RavenDB

    - by degorolls
    Given the following classes: public class Lookup { public string Code { get; set; } public string Name { get; set; } } public class DocA { public string Id { get; set; } public string Name { get; set; } public Lookup Currency { get; set; } } public class ViewA // Simply a flattened version of the doc { public string Id { get; set; } public string Name { get; set; } public string CurrencyName { get; set; } // View just gets the name of the currency } I can create an index that allows client to query the view as follows: public class A_View : AbstractIndexCreationTask<DocA, ViewA> { public A_View() { Map = docs => from doc in docs select new ViewA { Id = doc.Id, Name = doc.Name, CurrencyName = doc.Currency.Name }; Reduce = results => from result in results group on new ViewA { Id = result.Id, Name = result.Name, CurrencyName = result.CurrencyName } into g select new ViewA { Id = g.Key.Id, Name = g.Key.Name, CurrencyName = g.Key.CurrencyName }; } } This certainly works and produces the desired result of a view with the data transformed to the structure required at the client application. However, it is unworkably verbose, will be a maintenance nightmare and is probably fairly inefficient with all the redundant object construction. Is there a simpler way of creating an index with the required structure (ViewA) given a collection of documents (DocA)? FURTHER INFORMATION The issue appears to be that in order to have the index hold the data in the transformed structure (ViewA), we have to do a Reduce. It appears that a Reduce must have both a GROUP ON and a SELECT in order to work as expected so the following are not valid: INVALID REDUCE CLAUSE 1: Reduce = results => from result in results group on new ViewA { Id = result.Id, Name = result.Name, CurrencyName = result.CurrencyName } into g select g.Key; This produces: System.InvalidOperationException: Variable initializer select must have a lambda expression with an object create expression Clearly we need to have the 'select new'. INVALID REDUCE CLAUSE 2: Reduce = results => from result in results select new ViewA { Id = result.Id, Name = result.Name, CurrencyName = result.CurrencyName }; This prduces: System.InvalidCastException: Unable to cast object of type 'ICSharpCode.NRefactory.Ast.IdentifierExpression' to type 'ICSharpCode.NRefactory.Ast.InvocationExpression'. Clearly, we also need to have the 'group on new'. Thanks for any assistance you can provide. (Note: removing the type (ViewA) from the constructor calls has no effect on the above)

    Read the article

  • Why SQL2008 debugger would NOT step into a certain child stored procedure

    - by John Galt
    I'm encountering differences in T-SQL with SQL2008 (vs. SQL2000) that are leading me to dead-ends. I've verified that the technique of sharing #TEMP tables between a caller which CREATES the #TEMP and the child sProc which references it remain valid in SQL2008 See recent SO question. My core problem remains a critical "child" stored procedure that works fine in SQL2000 but fails in SQL2008 (i.e. a FROM clause in the child sProc is coded as: SELECT * FROM #AREAS A) despite #AREAS being created by the calling parent. Rather than post snippets of the code now, here is another symptom that may help you suggest something. I fired up the new debugger in SQL Mgmt Studio: EXEC dbo.AMS1 @S1='06',@C1='037',@StartDate='01/01/2008',@EndDate='07/31/2008',@Type=1,@ACReq = 1,@Output = 0,@NumofLines = 30,@SourceTable = 'P',@LoanPurposeCatg='P' This is a very large sProc and the key snippet that is weird is the following: **create table #Areas ( State char(2) , County char(3) , ZipCode char(5) NULL , CityName varchar(28) NULL , PData varchar(3) NULL , RData varchar(3) NULL , SMSA_CD varchar(10) NULL , TypeCounty varchar(50) , StateAbbr char(2) ) EXECUTE dbo.AMS_I_GetAreasV5 -- this child populates #Areas @SMSA = @SMSA , @S1 = @S1 , @C1 = @C1 , @Z1 = @Z1 , @SourceTable = @SourceTable , @CustomID = @CustomID , @UserName = @UserName , @CityName = @CityName , @Debug=0 EXECUTE dbo.AMS_I_GetAreas_FixAC -- this child cannot reference #Areas @StartDate = @StartDate , @EndDate = @EndDate , @SMSA_CD = @SMSA_CD , @S1 = @S1 , @C1 = @C1 , @Z1 = @Z1 , @CityName = @CityName , @CustomID = @CustomID , @Debug=0 -- continuation of the parent sProc** I can step through the execution of the parent stored procedure. When I get to the first child sproc above, I can either STEP INTO dbo.AMS_I_GetAreasV5 or STEP OVER its execution. When I arrive at the invocation of the 2nd child sProc - dbo.AMS_I_GetAreas_FixAC - I try to STEP INTO it (because that is where the problem statement is) and STEP INTO is ignored (i.e. treated like STEP OVER instead; yet I KNOW I pressed F11 not F10). It WAS executed however, because when control is returned to the statement after the EXECUTE, I click Continue to finish execution and the results windows shows the errors in the dbo.AMS_I_GetAreas_FixAC (i.e. the 2nd child) stored procedure. Is there a way to "pre-load" an sProc with the goal of setting a breakpoint on its entry so that I can pursue execution inside it? In summary, I wonder if the inability to step into a given child sproc might be related to the same inability of this particular child to reference a #temp created by its parent (caller).

    Read the article

  • IPHONE DEVELOPMENT PROFILE EXPIRED - I TRIED EVERYTHING AND YES, I READ THE DOCS

    - by theiphoneguy
    I really combed this site and others. I read and re-read the related links here and the Apple docs. I'm sorry, but either I am obviously missing something right under my nose, or this Apple profile/certificate stuff is a bit convoluted. Here it is: I have a product in the App Store. I have updated it several times and users like it. My development profile recently expired just when I was improving the app for its next release. I can run the app in the simulator. I can compile and put the distribution build on my iPhone just fine. I went to the Apple portal and renewed the development profile. I downloaded it and installed it in Xcode. I see it in the Organize window. I see it on my iPhone. I CANNOT put the debug build on my iPhone to debug or run with Instruments. The message is that either there is not a valid signed profile or it is untrusted. I subsequently tried to download and install the certificate to my Mac's keychain. Still no success. I checked the code signing section of Project settings and also for the target and the root. All appears to indicate that it is using the expected development profile for debug. Yes, I had deleted the old profile from my iPhone, from the Organizer. I cleaned the Xcode cache and all targets. I have done all of this several times and in varying sequences to try to cover every possibility. I am ready to do anything to be able to debug with Instruments in order to check for leaks or high memory usage. Even though the distribution compile runs fine on my iPhone and plays well with other running processes, I will not release anything without a leaks/memory test. Any ideas will be appreciated. If I missed something obvious, please forgive me - it was not due to just posting a question without searching for similar postings. Thanks!

    Read the article

  • PHP 'instanceof' failing with class constant

    - by Nathan Loding
    I'm working on a framework that I'm trying to type as strongly as I possibly can. (I'm working within PHP and taking some of the ideas that I like from C# and trying to utilize them within this framework.) I'm creating a Collection class that is a collection of domain entities/objects. It's kinda modeled after the List<T> object in .Net. I've run into an obstacle that is preventing me from typing this class. If I have a UserCollection, it should only allow User objects into it. If I have a PostCollection, it should only allow Post objects. All Collections in this framework need to have certain basic functions, such as add, remove, iterate. I created an interface, but found that I couldn't do the following: interface ICollection { public function add($obj) } class PostCollection implements ICollection { public function add(Post $obj) {} } This broke it's compliance with the interface. But I can't have the interface strongly typed because then all Collections are of the same type. So I attempted the following: interface ICollection { public function add($obj) } abstract class Collection implements ICollection { const type = 'null'; } class PostCollection { const type = 'Post'; public function add($obj) { if(!($obj instanceof self::type)) { throw new UhOhException(); } } } When I attempt to run this code, I get syntax error, unexpected T_STRING, expecting T_VARIABLE or '$' on the instanceof statement. A little research into the issue and it looks like the root of the cause is that $obj instanceof self is valid to test against the class. It appears that PHP doesn't process the entire self::type constant statement in the expression. Adding parentheses around the self::type variable threw an error regarding an unexpected '('. An obvious workaround is to not make the type variable a constant. The expression $obj instanceof $this->type works just fine (if $type is declared as a variable, of course). I'm hoping that there's a way to avoid that, as I'd like to define the value as a constant to avoid any possible change in the variable later. Any thoughts on how I can achieve this, or have I take PHP to it's limit in this regard? Is there a way of "escaping" or encapsulating self::this so that PHP won't die when processing it?

    Read the article

  • Improving performance on data pasting 2000 rows with validations

    - by Lohit
    I have N rows (which could be nothing less than 1000) on an excel spreadsheet. And in this sheet our project has 150 columns like this: Now, our application needs data to be copied (using normal Ctrl+C) and pasted (using Ctrl+V) from the excel file sheet on our GUI sheet. Copy pasting 1000 records takes around 5-6 seconds which is okay for our requirement, but the problem is when we need to make sure the data entered is valid. So we have to validate data in each row generate appropriate error messages and format the data as per requirement. So we need to at runtime parse and evaluate data in each row. Now all the formatting of data and validations come from the back-end database and we have it in a data-table (dtValidateAndFormatConditions). The conditions would be around 50. So you can see how slow this whole process becomes since N X 150 X 50 operations are required to complete this whole process. Initially it took approximately 2-3 minutes but now i have reduced it to 20 - 30 seconds. However i have increased the speed by making an expression parser of my own - and not by any algorithm, is there any other way i can improve performance, by using Divide and Conquer or some other mechanism. Currently i am not really sure how to go about this. Here is what part of my code looks like: public virtual void ValidateAndFormatOnCopyPaste(DataTable DtCopied, int CurRow) { foreach (DataRow dRow in dtValidateAndFormatConditions.Rows) { string Condition = dRow["Condition"]; string FormatValue = Value = dRow["Value"]; GetValidatedFormattedData(DtCopied,ref Condition, ref FormatValue ,iRowIndex); Condition = Parse(Condition); dRow["Condition"] = Condition; FormatValue = Parse(FormatValue ); dRow["Value"] = FormatValue; } } The above code gets called row-wise like this: public override void ValidateAndFormat(DataTable dtChangedRecords, CellRange cr) { int iRowStart = cr.Row, iRowEnd = cr.Row + cr.RowCount; for (int iRow = iRowStart; iRow < iRowEnd; iRow++) { ValidateAndFormatOnCopyPaste(dtChangedRecords,iRow); } } Please know my question needs a more algorithmic solution than code optimization, however any answers containing code related optimizations will be appreciated as well. (Tagged Linq because although not seen i have been using linq in some parts of my code).

    Read the article

  • What are the weaknesses of this user authentication method?

    - by byronh
    I'm developing my own PHP framework. It seems all the security articles I have read use vastly different methods for user authentication than I do so I could use some help in finding security holes. Some information that might be useful before I start. I use mod_rewrite for my MVC url's. Passwords are sha1 and md5 encrypted with 24 character salt unique to each user. mysql_real_escape_string and/or variable typecasting on everything going in, and htmlspecialchars on everything coming out. Step-by step process: Top of every page: session_start(); session_regenerate_id(); If user logs in via login form, generate new random token to put in user's MySQL row. Hash is generated based on user's salt (from when they first registered) and the new token. Store the hash and plaintext username in session variables, and duplicate in cookies if 'Remember me' is checked. On every page, check for cookies. If cookies set, copy their values into session variables. Then compare $_SESSION['name'] and $_SESSION['hash'] against MySQL database. Destroy all cookies and session variables if they don't match so they have to log in again. If login is valid, some of the user's information from the MySQL database is stored in an array for easy access. So far, I've assumed that this array is clean so when limiting user access I refer to user.rank and deny access if it's below what's required for that page. I've tried to test all the common attacks like XSS and CSRF, but maybe I'm just not good enough at hacking my own site! My system seems way too simple for it to actually be secure (the security code is only 100 lines long). What am I missing? I've also spent alot of time searching for the vulnerabilities with mysql_real_escape string but I haven't found any information that is up-to-date (everything is from several years ago at least and has apparently been fixed). All I know is that the problem was something to do with encoding. If that problem still exists today, how can I avoid it? Any help will be much appreciated.

    Read the article

  • Facebook Like box and Like buttons return Error

    - by spartan
    I'm integrating FB social plugins - Like box and Like buttons (as iframes) - on a web page, but they don't work. When I click on Like in "Like box", I get "Error" text with link, which displays a message dialog "The page at https://www.facebook.com/provocateur.eu could not be reached.". JSON response is: for (;;);{"__ar":1,"payload":{"requires_login":false,"success":false,"already_connected":false,"is_admin":false,"show_error":true,"error_info":{"brief":"Website Inaccessible","full":"The page at https:\/\/www.facebook.com\/provocateur.eu could not be reached.","errorUri":"\/connect\/connect_to_node_error.php?title=Website+Inaccessible&body=The+page+at+https\u00253A\u00252F\u00252Fwww.facebook.com\u00252Fprovocateur.eu+could+not+be+reached.&hash=AQARp73z7huT0Eiu"}}} When I click on the Like button, the JSON response is: for (;;);{"__ar":1,"payload":{"requires_login":false,"success":false,"already_connected":false,"is_admin":false,"show_error":true,"error_info":{"brief":"An error occurred.","full":"There was an error liking the page. If you are the page owner, please try running your page through the linter on the Facebook devsite (https:\/\/developers.facebook.com\/tools\/lint\/) and fixing any errors.","errorUri":"\/connect\/connect_to_node_error.php?title=An+error+occurred.&body=There+was+an+error+liking+the+page.+If+you+are+the+page+owner\u00252C+please+try+running+your+page+through+the+linter+on+the+Facebook+devsite+\u002528https\u00253A\u00252F\u00252Fdevelopers.facebook.com\u00252Ftools\u00252Flint\u00252F\u002529+and+fixing+any+errors.&hash=AQAFI_8ieMUGPPxS"}}} This is the "Like box" iframe code: <iframe frameborder="0" scrolling="no" style="border:none; overflow:hidden; width:240px; height:70px;" src="//www.facebook.com/plugins/likebox.php?href=http%3A%2F%2Fwww.facebook.com%2Fprovocateur.eu&width=240&height=70&colorscheme=dark&show_faces=false&border_color&stream=false&header=true&appId=283499041689204"></iframe> and this is the "Like button" iframe code: <iframe frameborder="0" scrolling="no" style="border:none; overflow:hidden; width:203px; height:21px;" src="//www.facebook.com/plugins/like.php?href&amp;send=false&amp;layout=button_count&amp;width=203&amp;show_faces=false&amp;action=like&amp;colorscheme=light&amp;font=arial&amp;height=21&amp;appId=283499041689204"></iframe> The behaviour is the same for admin and non-admin visitors and for any browser. I created application with the same name as FB page with appId 283499041689204. Web page is XHTML transitional valid, and it contains no errors according FB debugger/linter. Formely there was age restriction (17+), but I removed it and for the moment it is accessible for anyone (13+). URL of web page: http://provocateur.eu/ URL of FB page: in the first error message Any help appriciated. Thanks in advance.

    Read the article

  • Deterministic key serialization

    - by Mike Boers
    I'm writing a mapping class which uses SQLite as the storage backend. I am currently allowing only basestring keys but it would be nice if I could use a couple more types hopefully up to anything that is hashable (ie. same requirements as the builtin dict). To that end I would like to derive a deterministic serialization scheme. Ideally, I would like to know if any implementation/protocol combination of pickle is deterministic for hashable objects (e.g. can only use cPickle with protocol 0). I noticed that pickle and cPickle do not match: >>> import pickle >>> import cPickle >>> def dumps(x): ... print repr(pickle.dumps(x)) ... print repr(cPickle.dumps(x)) ... >>> dumps(1) 'I1\n.' 'I1\n.' >>> dumps('hello') "S'hello'\np0\n." "S'hello'\np1\n." >>> dumps((1, 2, 'hello')) "(I1\nI2\nS'hello'\np0\ntp1\n." "(I1\nI2\nS'hello'\np1\ntp2\n." Another option is to use repr to dump and ast.literal_eval to load. This would only be valid for builtin hashable types. I have written a function to determine if a given key would survive this process (it is rather conservative on the types it allows): def is_reprable_key(key): return type(key) in (int, str, unicode) or (type(key) == tuple and all( is_reprable_key(x) for x in key)) The question for this method is if repr itself is deterministic for the types that I have allowed here. I believe this would not survive the 2/3 version barrier due to the change in str/unicode literals. This also would not work for integers where 2**32 - 1 < x < 2**64 jumping between 32 and 64 bit platforms. Are there any other conditions (ie. do strings serialize differently under different conditions)? (If this all fails miserably then I can store the hash of the key along with the pickle of both the key and value, then iterate across rows that have a matching hash looking for one that unpickles to the expected key, but that really does complicate a few other things and I would rather not do it.) Any insights?

    Read the article

  • getline() sets failbit and skips last line

    - by Thanatos
    I'm using std::getline() to enumerate through the lines in a file, and it's mostly working. It's left me curious however - std::getline() is skipping the very last line in my file, but only if it's blank. Using this minimal example: #include <iostream> #include <string> int main() { std::string line; while(std::getline(std::cin, line)) std::cout << "Line: “" << line << "”\n"; return 0; } If I feed it this: Line A Line B Line C I get those lines back at me. But this: Line A Line B Line C [* line is present but blank, ie, the file end is: "...B\nLine C\n" *] (I unfortunately can't have a blank line in SO's little code box thing...) So, first file has three lines ( ["Line A", "Line B", "Line C"] ), second file has four ( ["Line A", "Line B", "Line C", ""] ) This to me seems wrong - I have a four line file, and enumerating it with getline() leaves me with 3. What's really got me scratching my head is that this is exactly what the standard says it should do. (21.3.7.9) Even Python has similar behaviour (but it gives me the newlines too - C++ chops them off.) Is this some weird thing where C++ is expected lines to be terminated, and not separated by '\n', and I'm feeding it differently? Edit Clearly, I need to expand a bit here. I've met up with two philosophies of determining what a "line" in a file is: Lines are terminated by newlines - Dominant in systems such as Linux, and editors like vim. Possible to have a slightly "odd" file by not having a final '\n' (a "noeol" in vim). Impossible to have a blank line at the end of a file. Lines are separated by newlines - Dominant in just about every Windows editor I've ever come across. Every file is valid, and it's possible to have the last line be blank. Of course, YMMV as to what a newline is. I've always treated these as two completely different schools of thought. One earlier point I tried to make was to ask if the C++ standard was explicitly or merely implicitly following the first. (Curiously, where is Mac? terminated or separated?)

    Read the article

  • Android Bluetooth Fails to Pair

    - by CaseyB
    I am having a problem getting my devices to pair in Android. If I go into the settings and pair them manually I can get them to connect using the following code: Server // Make sure the device it discoverable mServerSocket = mAdapter.listenUsingRfcommWithServiceRecord("Moo Productions Bluetooth Server", mUUID); mState = State.ACCEPTING; BluetoothSocket socket = mServerSocket.accept(); mServerSocket.close(); connected(socket); Client Set<BluetoothDevice> pairedDevices = mAdapter.getBondedDevices(); BluetoothSocket socket = null; // Search the list of paired devices for the right one for(BluetoothDevice device : pairedDevices) { try { mState = State.SEARCHING; socket = device.createRfcommSocketToServiceRecord(mUUID); mState = State.CONNECTING; socket.connect(); connected(socket); break; } catch (IOException e) { socket = null; continue; } } But if the devices hadn't already been paired it gets out of the foreach without connecting to a valid socket. In that case I start discovering. // If that didn't work, discover if(socket == null) { mState = State.SEARCHING; mReceiver = new SocketReceiver(); mContext.registerReceiver(mReceiver, new IntentFilter(BluetoothDevice.ACTION_FOUND)); mAdapter.startDiscovery(); } // ... Later ... private class SocketReceiver extends BroadcastReceiver { @Override public void onReceive(Context context, Intent intent) { if(BluetoothDevice.ACTION_FOUND.equals(intent.getAction())) { try { // Get the device and try to open a socket BluetoothDevice device = intent.getParcelableExtra(BluetoothDevice.EXTRA_DEVICE); BluetoothSocket socket = device.createRfcommSocketToServiceRecord(mUUID); mState = State.CONNECTING; socket.connect(); // This is our boy, so stop looking mAdapter.cancelDiscovery(); mContext.unregisterReceiver(mReceiver); connected(socket); } catch (IOException ioe) { ioe.printStackTrace(); } } } } But it will never find the other device. I never get a pairing dialog and when I step through I see that it discovers the correct device, but it fails to connect with this exception java.io.IOException: Service discovery failed. Any ideas as to what I'm missing?

    Read the article

  • Copy all childNodes to an other element. In javascript native way.

    - by kroko
    Hello I have to change "unknown" contents of XML. The structure and content itself is valid. Original <blabla foo="bar"> <aa>asas</aa> <ff> <cc> <dd /> </cc> </ff> <gg attr2="2"> </gg> ... ... </blabla> becomes <blabla foo="bar"> <magic> <aa>asas</aa> <ff> <cc> <dd /> </cc> </ff> <gg attr2="2"> </gg> ... ... </magic> </blabla> thus, adding a child straight under document root node (document.documentElement) and "pushing" the "original" children under that. Here it has to be done in plain javascript (ecmascript). The idea now is to // Get the root node RootNode = mymagicdoc.documentElement; // Create new magic element (that will contain contents of original root node) var magicContainer = mymagicdoc.createElement("magic"); // Copy all root node children (and their sub tree - deep copy) to magic node /* ????? here RootNodeClone = RootNode.cloneNode(true); RootNodeClone.childNodes...... */ // Remove all children from root node while(RootNode.hasChildNodes()) RootNode.removeChild(RootNode.firstChild); // Now when root node is empty add the magicContainer // node in it that contains all the children of original root node RootNode.appendChild(magicContainer); How to do that /* */ step? Or maybe someone has a much better solution in general for achieving the desirable result? Thank you in advance!

    Read the article

  • check if directory exists c#

    - by Ant
    I am trying to see if a directory exists based on an input field from the user. When the user types in the path, I want to check if the path actually exists. I have some c# code already. It returns 1 for any local path, but always returns 0 when I am checking a network path. static string checkValidPath(string path) { //Insert your code that runs under the security context of the authenticating user here. using (ImpersonateUser user = new ImpersonateUser(user, "", password)) { //DirectoryInfo d = new DirectoryInfo(quotelessPath); bool doesExist = Directory.Exists(path); //if (d.Exists) if(doesExist) { user.Dispose(); return "1"; } else { user.Dispose(); return "0"; } } } public class ImpersonateUser : IDisposable { [DllImport("advapi32.dll", SetLastError = true)] private static extern bool LogonUser(string lpszUsername, string lpszDomain, string lpszPassword, int dwLogonType, int dwLogonProvider, out IntPtr phToken); [DllImport("kernel32", SetLastError = true)] private static extern bool CloseHandle(IntPtr hObject); private IntPtr userHandle = IntPtr.Zero; private WindowsImpersonationContext impersonationContext; public ImpersonateUser(string user, string domain, string password) { if (!string.IsNullOrEmpty(user)) { // Call LogonUser to get a token for the user bool loggedOn = LogonUser(user, domain, password, 9 /*(int)LogonType.LOGON32_LOGON_NEW_CREDENTIALS*/, 3 /*(int)LogonProvider.LOGON32_PROVIDER_WINNT50*/, out userHandle); if (!loggedOn) throw new Win32Exception(Marshal.GetLastWin32Error()); // Begin impersonating the user impersonationContext = WindowsIdentity.Impersonate(userHandle); } } public void Dispose() { if (userHandle != IntPtr.Zero) CloseHandle(userHandle); if (impersonationContext != null) impersonationContext.Undo(); } } Any help is appreciated. Thanks! EDIT 3: updated code to use BrokenGlass's impersonation functions. However, I need to initialize "password" to something... EDIT 2: I updated the code to try and use impersonation as suggested below. It still fails everytime. I assume I am using impersonation improperly... EDIT: As requested by ChrisF, here is the function that calls the checkValidPath function. Frontend aspx file... $.get('processor.ashx', { a: '7', path: x }, function(o) { alert(o); if (o=="0") { $("#outputPathDivValid").dialog({ title: 'Output Path is not valid! Please enter a path that exists!', width: 500, modal: true, resizable: false, buttons: { 'Close': function() { $(this).dialog('close'); } } }); } }); Backend ashx file... public void ProcessRequest (HttpContext context) { context.Response.Cache.SetExpires(DateTime.Now); string sSid = context.Request["sid"]; switch (context.Request["a"]) {//a bunch of case statements here... case "7": context.Response.Write(checkValidPath(context.Request["path"].ToString())); break;

    Read the article

  • Jquery $.post and PHP - Prevent the ability to use script outside of main website.

    - by Tim
    I have a PHP script setup using Jquery $.post which would return a response or do an action within the targeted .php file within $.post. Eg. My page has a form where you type in your Name. Once you hit the submit form button, $.post is called and sends the entered Name field value into "mywebsite.xyz/folder/ajaxscript.php" If a user was to visit "mywebsite.xyz/folder/ajaxscript.php" directly and somehow POST the data to the script, the script would return a response / do an action, based on the submitted POST data. The problem is, I don't want others to be able to periodically "call" an action or request a response from my website without using the website directly. Theoretically, right now you could determine what Name values my website allows without even visiting it, or you could call an action without going through the website, by simply visiting "mywebsite.xyz/folder/ajaxscript.php" So, what measures can I take to prevent this from happening? So far my idea is to ensure that it is a $_POST and not a $_GET - so they cannot manually enter it into the browser, but they could still post data to the script... Another measure is to apply a session key that expires, and is only valid for X amount of visits until they revisit the website. ~ Or, just have a daily "code" that changes and they'd need to grab this code from the website each day to keep their direct access to the script working (eg. I pass the daily "code" into each post request. I then check that code matches in the ajax php script.) However, even with these meaures, they will STILL have access to the scripts so long as they know how to POST the data, and also get the new code each day. Also, having a daily code requirement will cause issues when visiting the site at midnight (12:00am) as the code will change and the script will break for someone who is on the website trying to call the script, with the invalid code being passed still. I have attempted using .htaccess however using: order allow,deny deny from all Prevents legitimate access, and I'd have to add an exception so the website's IP is allowed to access it.. which is a hassle to update I think. Although, if it's the only legitimate solution I guess I'll have to. If I need to be more clear please let me know.

    Read the article

  • What is fastest way to convert bool to byte?

    - by Amir Rezaei
    What is fastest way to convert bool to byte? I want this mapping: False=0, True=1 Note: I don't want to use any if statement. Update: I don't want to use conditional statement. I don't want the CPU to halt or guess next statement. I want to optimize this code: private static string ByteArrayToHex(byte[] barray) { char[] c = new char[barray.Length * 2]; byte k; for (int i = 0; i < barray.Length; ++i) { k = ((byte)(barray[i] >> 4)); c[i * 2] = (char)(k > 9 ? k + 0x37 : k + 0x30); k = ((byte)(barray[i] & 0xF)); c[i * 2 + 1] = (char)(k > 9 ? k + 0x37 : k + 0x30); } return new string(c); } Update: The length of the array is very large, it's in terabyte order! Therefore I need to do optimization if possible. I shouldn't need to explain my self. The question is still valid. Update: I'm working on a project and looking at others code. That's why I didn't provide with the function at first place. I didn't want to spend time on explaining for people when they have opinion about the code. I shouldn’y need to provide in my question the background of my work, and a function that is not written by me. I have started to optimize it part by part. If I needed help with the whole function I would asked that in another question. That is why I asked this very simple at the beginning. Unfortunately people couldn’t keep themselves to the question. So please if you want to help answer the question. Update: For dose who want to see the point of this question. This example shows how two if statement are reduced from the code. byte A = k > 9 ; //If it was possible (k>9) == 0 || 1 c[i * 2] = A * (k + 0x30) - (A - 1) * (k + 0x30);

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Looking for an Open Source Project in need of help

    - by hvidgaard
    Hi StackOverflow! I'm a CS student on well on my way to graduate. I have had a difficult time of finding relevant student jobs (they seems to be taken merely hours after the notice gets on the board) , so instead I'm looking for an open source project in need of help. I'm aware that I should choose one that I use, but I'm not aware of any OS-project that I use that needs help. That's why I'm asking you. I don't have any deep experience, but I here are some of my biggest projects so far: BitTorrent-ish client in Python (a subset of BitTorrent) HTTP 1.1 webserver in Java Compiler from a subset of Java to run on JRE Flash-framework project to model an iPad look and feel (not to run actual iPad programs) complete with an API for programs. Complete MySQL database for a booking system, with departure and arrival times, so you could only book valid tickets (with a Java frontend). I know, Java and languages like AS3 and C# feels natural per se, Python, and have done a fair bit of hacking around in C, but I don't feel very comfortable with it. Mostly I'm afraid to make a fuckup because I have such a high degree of control. I would like to think I'm well aware of good software design practices, but in reality what I do is ask myself "would I like to use/maintain this?", and I love to refactor my code because I see optimizations. I love algorithms and to make them run in the best possible time. I don't have any preferred domain to work in, but I wouldn't mind it to be graphics or math heavy. Ideally I'm looking for a project in C++ to learn the in's and out's of it, but I'm well aware that I don't know that language very well. I would like to have a mentor-like figure until I'm confident enough to stand on my own, not one to review all my code (I'm sure someone will to start with anyway), but to ask questions about the project and language in question. I do have a wife and two children, so don't expect me to put in 10+ hours every week. In return I can work on my own, I strive to program modular and maintainable code. Know how to read an API, use Google, StackOverflow and online resources in general. If you have any questions, shoot. I'm looking forward to your suggestions.

    Read the article

  • Exception showing a erroneous web page in a WPF frame

    - by H4mm3rHead
    I have a small application where i need to navigate to an url, I use this method to get the Frame: public override System.Windows.UIElement GetPage(System.Windows.UIElement container) { XmlDocument doc = new XmlDocument(); doc.Load(Location); string webSiteUrl = doc.SelectSingleNode("website").InnerText; Frame newFrame = new Frame(); if (!webSiteUrl.StartsWith("http://")) { webSiteUrl = "http://" + webSiteUrl; } newFrame.Source = new Uri(webSiteUrl); return newFrame; } My problem is now that the page im trying to show generates a error (or so i think), when i load the page in a browser it never fully loads, keeps saying "loading1 element" in the load bar and the green progress line (IE 8) keeps showing. When i attach my debugger i get this error: System.ArgumentException was unhandled Message="Parameter and value pair is not valid. Expected form is parameter=value." Source="WindowsBase" StackTrace: at MS.Internal.ContentType.ParseParameterAndValue(String parameterAndValue) at MS.Internal.ContentType..ctor(String contentType) at MS.Internal.WpfWebRequestHelper.GetContentType(WebResponse response) at System.Windows.Navigation.NavigationService.GetObjectFromResponse(WebRequest request, WebResponse response, Uri destinationUri, Object navState) at System.Windows.Navigation.NavigationService.HandleWebResponse(IAsyncResult ar) at System.Windows.Navigation.NavigationService.<>c__DisplayClassc.<HandleWebResponseOnRightDispatcher>b__8(Object unused) at System.Windows.Threading.ExceptionWrapper.InternalRealCall(Delegate callback, Object args, Boolean isSingleParameter) at System.Windows.Threading.ExceptionWrapper.TryCatchWhen(Object source, Delegate callback, Object args, Boolean isSingleParameter, Delegate catchHandler) at System.Windows.Threading.DispatcherOperation.InvokeImpl() at System.Threading.ExecutionContext.runTryCode(Object userData) at System.Runtime.CompilerServices.RuntimeHelpers.ExecuteCodeWithGuaranteedCleanup(TryCode code, CleanupCode backoutCode, Object userData) at System.Threading.ExecutionContext.Run(ExecutionContext executionContext, ContextCallback callback, Object state) at System.Windows.Threading.DispatcherOperation.Invoke() at System.Windows.Threading.Dispatcher.ProcessQueue() at System.Windows.Threading.Dispatcher.WndProcHook(IntPtr hwnd, Int32 msg, IntPtr wParam, IntPtr lParam, Boolean& handled) at MS.Win32.HwndWrapper.WndProc(IntPtr hwnd, Int32 msg, IntPtr wParam, IntPtr lParam, Boolean& handled) at MS.Win32.HwndSubclass.DispatcherCallbackOperation(Object o) at System.Windows.Threading.ExceptionWrapper.InternalRealCall(Delegate callback, Object args, Boolean isSingleParameter) at System.Windows.Threading.ExceptionWrapper.TryCatchWhen(Object source, Delegate callback, Object args, Boolean isSingleParameter, Delegate catchHandler) ved System.Windows.Threading.Dispatcher.InvokeImpl(DispatcherPriority priority, TimeSpan timeout, Delegate method, Object args, Boolean isSingleParameter) at MS.Win32.HwndSubclass.SubclassWndProc(IntPtr hwnd, Int32 msg, IntPtr wParam, IntPtr lParam) at MS.Win32.UnsafeNativeMethods.DispatchMessage(MSG& msg) at System.Windows.Threading.Dispatcher.TranslateAndDispatchMessage(MSG& msg) at System.Windows.Threading.Dispatcher.PushFrameImpl(DispatcherFrame frame) at System.Windows.Application.RunInternal(Window window) at GreenWebPlayerWPF.App.Main() i C:\Development\Hvarregaard\GWDS\GreenWeb\GreenWebPlayerWPF\obj\Debug\App.g.cs:linje 0 at System.AppDomain._nExecuteAssembly(Assembly assembly, String[] args) at Microsoft.VisualStudio.HostingProcess.HostProc.RunUsersAssembly() at System.Threading.ExecutionContext.Run(ExecutionContext executionContext, ContextCallback callback, Object state) at System.Threading.ThreadHelper.ThreadStart() InnerException: Anyone? Or any way to capture it and respond to it, tried a try/catch around my code, but its not caught - seems something deep inside the guts of the CLR is failing.

    Read the article

< Previous Page | 215 216 217 218 219 220 221 222 223 224 225 226  | Next Page >