Search Results

Search found 12194 results on 488 pages for 'reference counting'.

Page 22/488 | < Previous Page | 18 19 20 21 22 23 24 25 26 27 28 29  | Next Page >

  • Counting combinations in c or in python

    - by Dennis
    Hello I looked a bit on this topic here but I found nothing that could help me. I need a program in Python or in C that will give me all possible combinations of a and b that will meet the requirement n=2*a+b, for n from 0 to 10. a, b and n are integers. For example if n=0 both a and b must be 0. For n=1 a must be zero and b must be 1, for n=2 a can be 1 and b=0, or a=0 and b=2, etc. I'm not that good with programming. I made this: #include <stdio.h> int main(void){ int a,b,n; for(n = 0; n <= 10; n++){ for(a = 0; a <= 10; a++){ for(b = 0; b <= 10; b++) if(n == 2*a + b) printf("(%d, %d), ", (a,b)); } printf("\n"); } } But it keeps getting strange results like this: (0, -1079628000), (1, -1079628000), (2, -1079628000), (0, -1079628000), (3, -1079628000), (1, -1079628000), (4, -1079628000), (2, -1079628000), (0, -1079628000), (5, -1079628000), (3, -1079628000), (1, -1079628000), (6, -1079628000), (4, -1079628000), (2, -1079628000), (0, -1079628000), (7, -1079628000), (5, -1079628000), (3, -1079628000), (1, -1079628000), (8, -1079628000), (6, -1079628000), (4, -1079628000), (2, -1079628000), (0, -1079628000), (9, -1079628000), (7, -1079628000), (5, -1079628000), (3, -1079628000), (1, -1079628000), (10, -1079628000), (8, -1079628000), (6, -1079628000), (4, -1079628000), (2, -1079628000), (0, -1079628000), ideone Any idea what is wrong? Also if I could do this for Python it would be even cooler. :D

    Read the article

  • Java Counting # of occurrences of a word in a string

    - by Doug
    I have a large text file I am reading from and I need to find out how many times some words come up. For example, the word "the". I'm doing this line by line each line is a string. I need to make sure that I only count legit "the"'s the the in other would not count. This means I know I need to use regular expressions in some way. What I was trying so far is this: numSpace += line.split("[^a-z]the[^a-z]").length; I realize the regular expression may not be correct at the moment but I tried without that and just tried to find occurrences of the word the and I get wrong numbers to. I was under the impression this would split the string up into an array and how many times that array was split up was how many times the word is in the string. Any ideas I would be grateful.

    Read the article

  • question about counting sort

    - by davit-datuashvili
    hi i have write following code which prints elements in sorted order only one big problem is that it use two additional array here is my code public class occurance{ public static final int n=5; public static void main(String[]args){ // n is maximum possible value what it should be in array suppose n=5 then array may be int a[]=new int[]{3,4,4,2,1,3,5};// as u see all elements are less or equal to n //create array a.length*n int b[]=new int[a.length*n]; int c[]=new int[b.length]; for (int i=0;i<b.length;i++){ b[i]=0; c[i]=0; } for (int i=0;i<a.length;i++){ if (b[a[i]]==1){ c[a[i]]=1; } else{ b[a[i]]=1; } } for (int i=0;i<b.length;i++){ if (b[i]==1) { System.out.println(i); } if (c[i]==1){ System.out.println(i); } } } } // 1 2 3 3 4 4 5 1.i have two question what is complexity of this algorithm?i mean running time 2. how put this elements into other array with sorted order? thanks

    Read the article

  • Could not load file or assembly error even when reference has been removed

    - by twal
    Could not load file or assembly 'Payflow_dotNET_2.0' or one of its dependencies. The located assembly's manifest definition does not match the assembly reference. (Exception from HRESULT: 0x80131040) I tried to reference the payflow SDK and got this error.But I am no longer trying to reference it. I have removed all references to this dll. and Now I am just trying to get the project to start in VS but I still get this error. I am not trying to add the dll anymore.If i have removed the reference to this, why am I still getting this error? How can I remove anything else that may still be causing my program to look for this file? Thanks!

    Read the article

  • Counting array in API JSON Response

    - by bryan
    I'm trying to do a simple count of how many refunds are in my Stripe Response but count() isn't working and I don't really know any other way of achieving this. Could anyone point me in the right direction? $retrieve_event = Stripe_Event::retrieve("evt_00000000000000"); $event_json_id = json_decode($retrieve_event); $refund_array = $event_json_id->{'data'}->{'object'}->{'refunds'}; die(count($refund_array)); This is the response of $retrieve_event { "created": 1326853478, "livemode": false, "id": "evt_00000000000000", "type": "charge.refunded", "object": "event", "request": null, "data": { "object": { "id": "ch_00000000000000", "object": "charge", "created": 1402433517, "livemode": false, "paid": true, "amount": 1000, "currency": "usd", "refunded": true, "card": { "id": "card_00000000000000", "object": "card", "last4": "0028", "type": "Visa", "exp_month": 8, "exp_year": 2015, "fingerprint": "a5KWlTcrmCYk5DIYa", "country": "US", "name": "First Last", "address_line1": "null", "address_line2": null, "address_city": "null", "address_state": "null", "address_zip": "null", "address_country": "US", "cvc_check": null, "address_line1_check": "fail", "address_zip_check": "pass", "customer": "cus_00000000000000" }, "captured": true, "refunds": [ { "id": "re_104CKt4uGeYuVLAahMwLA2TK", "amount": 100, "currency": "usd", "created": 1402433533, "object": "refund", "charge": "ch_104CKt4uGeYuVLAazSyPqqLV", "balance_transaction": "txn_104CKt4uGeYuVLAaSNZCR867", "metadata": {} }, { "id": "re_104CKt4uGeYuVLAaDIMHoIos", "amount": 200, "currency": "usd", "created": 1402433539, "object": "refund", "charge": "ch_104CKt4uGeYuVLAazSyPqqLV", "balance_transaction": "txn_104CKt4uGeYuVLAaqSwkNKPO", "metadata": {} }, { "id": "re_4CL6n1r91dY5ME", "amount": 700, "currency": "usd", "created": 1402434306, "object": "refund", "charge": "ch_4CL6FNWhGzVuAV", "balance_transaction": "txn_4CL6qa4vwlVaDJ" } ], "balance_transaction": "txn_00000000000000", "failure_message": null, "failure_code": null, "amount_refunded": 1000, "customer": "cus_00000000000000", "invoice": null, "description": "this is a description", "dispute": null, "metadata": {}, "statement_description": "this is a description", "fee": 0 } } }

    Read the article

  • Excel - Counting unique values that meet multiple criteria

    - by wotaskd
    I'm trying to use a function to count the number of unique cells in a spreadsheet that, at the same time, meet multiple criteria. Given the following example: A B C QUANT STORE# PRODUCT 1 75012 banana 5 orange 6 56089 orange 3 89247 orange 7 45321 orange 2 apple 4 45321 apple In the example above, I need to know how many unique stores with a valid STORE# have received oranges OR apples. In the case above, the result should be 3 (stores 56089, 89247 and 45321). This is how I started to try solving the problem: =SUM(IF(FREQUENCY(B2:B9,B2:B9)>0,1)) The above formula will yield the number of unique stores with a valid store#, but not just the ones that have received oranges or bananas. How can I add that extra criteria?

    Read the article

  • problem in counting two fields in one query

    - by Mac Taylor
    hey guys i need to count new private messages and old one from a table so first thing come to mind is using mysql_num_rows and easy thing to do // check new pms $user_id = $userinfo['user_id']; $sql = "SELECT author_id FROM bb3privmsgs_to WHERE user_id='$user_id' AND (pm_new='1' OR pm_unread='1')"; $result = $db->sql_query($sql) ; $new_pms = $db->sql_numrows($result); $db->sql_freeresult($result); // check old pms $sql = "SELECT author_id FROM bb3privmsgs_to WHERE user_id='$user_id' AND (pm_new='0' OR pm_unread='0')"; $result = $db->sql_query($sql) ; $old_pms = $db->sql_numrows($result); $db->sql_freeresult($result); but how can i count these two fields just in one statement and shorter lines ?~

    Read the article

  • Counting vowels

    - by user74283
    Can anyone please tell me what is wrong with this script. I am a python newb but i cant seem to figure out what might be causing it not to function. def find_vowels(sentence): """ >>> find_vowels(test) e """ count = 0 vowels = "aeiuoAEIOU" for letter in sentence: if letter in vowels: count += 1 print count if __name__ == '__main__': import doctest doctest.testmod()

    Read the article

  • Reference manager for Ubuntu

    - by user36511
    I'm in dire need of a reference/citation manager in Ubuntu. The features I need the most are: 1) Metadata extraction/editing of pdf 2) Fetch metadata from online databases such as Google Scholar 3) Attach pdf or other file to reference 4) Tag references and recall those with a given tag or set of tags 5) Provide APA style citation for references (in integration with OOffice and/or Latex) Optional: Would be great if it can annotate/highlight pdfs. Mendeley probably does all of these, but it's behavior has driven me insane, especially when the number of references it's trying to handle is large. It constantly tries to sync with the web and creates duplicate references. I've tried JabRef, and while it looks like a decent piece of freeware, it doesn't do some of the above. I found others like Bibus, Referencer, etc. to be lacking or buggy or inactive development. Is there another option, or should I give up the search.

    Read the article

  • data structure for counting frequencies in a database table-like format

    - by user373312
    i was wondering if there is a data structure optimized to count frequencies against data that is stored in a database table-like format. for example, the data comes in a (comma) delimited format below. col1, col2, col3 x, a, green x, b, blue ... y, c, green now i simply want to count the frequency of col1=x or col1=x and col2=green. i have been storing the data in a database table, but in my profiling and from empirical observation, database connection is the bottle-neck. i have tried using in-memory database solutions too, and that works quite well; the only problem is memory requirements and quirky init/destroy calls. also, i work mainly with java, but have experience with .net, and was wondering if there was any api to work with "tabular" data in a linq way using java. any help is appreciated.

    Read the article

  • how to add a reference to assembly

    - by Gold
    hi i try to run pdf to text C# code, i have reference to 2 dll and i get this error when i try to run the program: how to add a reference to assembly ? the type 'java.io.File' is defined in an assembly that is not referenced. You must add a reference to assembly 'IKVM.GNU.Classpath, Version=0.20.0.0, Culture=neutral, PublicKeyToken=13235d27fcbfff58'. thank's in advance

    Read the article

  • Counting point size based on chart area during zooming/unzoomin

    - by Gacek
    Hi folks. I heave a quite simple task. I know (I suppose) it should be easy, but from the reasons I cannot understand, I try to solve it since 2 days and I don't know where I'm making the mistake. So, the problem is as follows: - we have a chart with some points - The chart starts with some known area and points have known size - we would like to "emulate" the zooming effect. So when we zoom to some part of the chart, the size of points is getting proportionally bigger. In other words, the smaller part of the chart we select, the bigger the point should get. So, we have something like that. We know this two parameters: initialArea; // Initial area - area of the whole chart, counted as width*height initialSize; // initial size of the points Now lets assume we are handling some kind of OnZoom event. We selected some part of the chart and would like to count the current size of the points float CountSizeOnZoom() { float currentArea = CountArea(...); // the area is counted for us. float currentSize = initialSize * initialArea / currentArea; return currentSize; } And it works. But the rate of change is too fast. In other words, the points are getting really big too soon. So I would like the currentSize to be invertly proportional to currentArea, but with some scaling coefficient. So I created the second function: float CountSizeOnZoom() { float currentArea = CountArea(...); % the area is counted for us. // Lets assume we want the size of points to change ten times slower, than area of the chart changed. float currentSize = initialSize + 0.1f* initialSize * ((initialArea / currentArea) -1); return currentSize; } Lets do some calculations in mind. if currentArea is smaller than initialArea, initialArea/currentArea > 1 and then we add "something" small and postive to initialSize. Checked, it works. Lets check what happens if we would un-zoom. currentArea will be equal to initialArea, so we would have 0 at the right side (1-1), so new size should be equal to initialSize. Right? Yeah. So lets check it... and it doesn't work. My question is: where is the mistake? Or maybe you have any ideas how to count this scaled size depending on current area in some other way?

    Read the article

  • Code Golf: Counting XML elements in file on Android

    - by CSharperWithJava
    Take a simple XML file formatted like this: <Lists> <List> <Note/> ... <Note/> </List> <List> <Note/> ... <Note/> </List> </Lists> Each node has some attributes that actually hold the data of the file. I need a very quick way to count the number of each type of element, (List and Note). Lists is simply the root and doesn't matter. I can do this with a simple string search or something similar, but I need to make this as fast as possible. Design Parameters: Must be in java (Android application). Must AVOID allocating memory as much as possible. Must return the total number of Note elements and the number of List elements in the file, regardless of location in file. Number of Lists will typically be small (1-4), and number of notes can potentially be very large (upwards of 1000, typically 100) per file. I look forward to your suggestions.

    Read the article

  • Counting vowels in a string using recursion

    - by Daniel Love Jr
    In my python class we are learning about recursion. I understand that it's when a function calls itself, however for this particular assignment I can't figure out how exactly to get my function to call it self to get the desired results. I need to simply count the vowels in the string given to the function. def recVowelCount(s): 'return the number of vowels in s using a recursive computation' vowelcount = 0 vowels = "aEiou".lower() if s[0] in vowels: vowelcount += 1 else: ??? I'm really not sure where to go with this, it's quite frustrating. I came up with this in the end, thanks to some insight from here. def recVowelCount(s): 'return the number of vowels in s using a recursive computation' vowels = "aeiouAEIOU" if s == "": return 0 elif s[0] in vowels: return 1 + recVowelCount(s[1:]) else: return 0 + recVowelCount(s[1:])

    Read the article

  • Ruby: counters, counting and incrementing

    - by Shyam
    Hi, If you have seen my previous questions, you'd already know I am a big nuby when it comes to Ruby. So, I discovered this website which is intended for C programming, but I thought whatever one can do in C, must be possible in Ruby (and more readable too). The challenge is to print out a bunch of numbers. I discovered this nifty method .upto() and I used a block (and actually understanding its purpose). However, in IRb, I got some unexpected behavior. class MyCounter def run 1.upto(10) { |x| print x.to_s + " " } end end irb(main):033:0> q = MyCounter.new => #<MyCounter:0x5dca0> irb(main):034:0> q.run 1 2 3 4 5 6 7 8 9 10 => 1 I have no idea where the = 1 comes from :S Should I do this otherwise? I am expecting to have this result: 1 2 3 4 5 6 7 8 9 10 Thank you for your answers, comments and feedback!

    Read the article

  • Restoring web reference in Visual Studio 2008

    - by Mark Cheeseborough
    I had a web reference set in my VS2008 ASP.NET project, but due to some source control weirdness it is no longer listed in the project. I have the set of files in the Web References folder under my project. There's a .wsdl, .disco and several .datasource files. Is there any way to re-add this web reference through the existing files rather than using the "Add Web Reference" dialog?

    Read the article

  • Tracking/Counting Word Frequency

    - by Joel Martinez
    I'd like to get some community consensus on a good design to be able to store and query word frequency counts. I'm building an application in which I have to parse text inputs and store how many times a word has appeared (over time). So given the following inputs: "To Kill a Mocking Bird" "Mocking a piano player" Would store the following values: Word Count ------------- To 1 Kill 1 A 2 Mocking 2 Bird 1 Piano 1 Player 1 And later be able to quickly query for the count value of a given arbitrary word. My current plan is to simply store the words and counts in a database, and rely on caching word count values ... But I suspect that I won't get enough cache hits to make this a viable solution long term. Can anyone suggest algorithms, or data structures, or any other idea that might make this a well-performing solution?

    Read the article

  • jquery parent/children selector for counting <li>

    - by Kreker
    Hi. I have this piece of HTML <div id="fileTreeInviati"> <ul class="php-file-tree"> <li class="pft-directory"> <a href="#" class="" name="101">A006 - SOMETEXT (<span name="contaNew"></span>)</a> <img src="./moduli/home/images/info.png" title="Informazioni Azienda" class="imgInfo"/> <ul style="display: none;"> <li class="pft-file ext-png"> <a href="javascript:getInfoFile('4');" class="" id="4">cut.png</a> </li> <li class="pft-file ext-dll"> <a href="javascript:getInfoFile('27');" class="new" id="27">Safari.dll</a> </li> </ul> </li> <li class="pft-directory"> <a href="#" class="" name="102">A012 - SOMETEXT (<span name="contaNew"></span>)</a> <img src="./moduli/home/images/info.png" title="Informazioni Azienda" class="imgInfo"/> <ul style="display: none;"> <li class="pft-file ext-jpg"> <a href="javascript:getInfoFile('19');" class="new" id="19">04.jpg</a> </li> <li class="pft-file ext-dll"> <a href="javascript:getInfoFile('24');" class="new" id="24">Safari.dll</a> </li> </ul> </li> <li class="pft-directory"> <a href="#" class="" name="103">A014 - SOMETEXT (<span name="contaNew"></span>)</a> <img src="./moduli/home/images/info.png" title="Informazioni Azienda" class="imgInfo"/> <ul style="display: none;"> <li class="pft-file ext-txt"> <a href="javascript:getInfoFile('17');" class="new" id="17">acu.txt</a> </li> <li class="pft-file ext-dll"> <a href="javascript:getInfoFile('22');" class="new" id="22">Safari.dll</a> </li> </ul> </li> </ul> I'm working on a js snippet that cycle through all "a" of the "li" and checks if it has the class "new" if yes increment a counter by one. This counter now has to be printed on the relative "li" "span" 3 level before. So I have the number of the element with the "new" class. The js snippet is this $("#fileTreeInviati .php-file-tree .pft-directory li").each(function(){ $(this).children("a").each(function(i,e){ if ($(e).hasClass("new")){ cont++; console.log($(e).text()); $(this).parent().parent().parent().children("a").children("span").text(cont); } }) cont = 0; }); I think I'm almost there but the counter is always 1. I think there is something mess with .children, maybe it can handle only the first occurrence? Thanks for help

    Read the article

  • Counting number of GC cleanups on an object

    - by tsps
    How do I keep a count of the number of times that objects of a specific class (type?) are getting disposed in the lifetime of my application. Imagine I have a class A, now, I want to count how many times the objects of A get collected by the GC. I hope I am phrasing this right because I was asked this in an interview today and the answer I gave did not satisfy the interviewer. And this is what I imagine he was trying to ask. What I said was that one could keep a static field called count in the class A and increment it in the Finalize() call of that object. The answer he was expecting was something called a static block. I've never heard of this in .NET/C#. Can someone explain what's this static block?

    Read the article

  • Java - Counting how many characters show up in another string

    - by Vu Châu
    I am comparing two strings, in Java, to see how many characters from the first string show up in the second string. The following is some expectations: matchingChars("AC", "BA") ? 1 matchingChars("ABBA", "B") ? 2 matchingChars("B", "ABBA") ? 1 My approach is as follows: public int matchingChars(String str1, String str2) { int count = 0; for (int a = 0; a < str1.length(); a++) { for (int b = 0; b < str2.length(); b++) { char str1Char = str1.charAt(a); char str2Char = str2.charAt(b); if (str1Char == str2Char) { count++; str1 = str1.replace(str1Char, '0'); } } } return count; } I know my approach is not the best, but I think it should do it. However, for matchingChars("ABBA", "B") ? 2 My code yields "1" instead of "2". Does anyone have any suggestion or advice? Thank you very much.

    Read the article

  • Creating LINQ to SQL for counting a parameter

    - by Matt
    I'm trying to translate a sql query into LINQ to SQL. I keep getting an error "sequence operators not supported for type 'system.string'" If I take out the distinct count part, it works. Is it not because I'm using the GROUP BY? SELECT COUNT(EpaValue) AS [Leak Count], Location, EpaValue AS [Leak Desc.] FROM ChartMes.dbo.RecourceActualEPA_Report WHERE (EpaName = N'LEAK1') AND (Timestamp) '20100429030000' GROUP BY EpaValue, Location ORDER BY Location, [Leak Count] DESC Dim temp = (From p In db2.RecourceActualEPA_Reports _ Where (p.Timestamp = str1stShiftStart) And (p.Timestamp < str2ndShiftCutoff) _ And (p.EpaName = "Leak1") _ Select p.EpaName.Distinct.Count(), p.Location, p.EpaValue)

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Counting unique values in a column with a shell script

    - by Lilly Tooner
    Hello. I have a tab delimited file with 5 columns and need to retrieve a count of just the number of unique lines from column 2. I would normally do this with Perl/Python but I am forced to use the shell for this one. I have successfully in the past used *nix uniq function piped to wc but it looks like I am going to have to use awk in here. Any advice would be greatly appreciated. (I have asked a similar question previously about column checks using awk but this is a little different and I wanted to separate it so if someone in the future has this question this will be here) Many many thanks! Lilly

    Read the article

  • How do C++ compilers actually pass reference parameters?

    - by T.E.D.
    This question came about as a result of some mixed-langauge programming. I had a Fortran routine I wanted to call from C++ code. Fortran passes all its parameters by reference (unless you tell it otherwise). So I thought I'd be clever (bad start right there) in my C++ code and define the Fortran routine something like this: extern "C" void FORTRAN_ROUTINE (unsigned & flag); This code worked for a while but (of course right when I needed to leave) suddenly started blowing up on a return call. Clear indication of a munged call stack. Another engineer came behind me and fixed the problem, declaring that the routine had to be deinfed in C++ as extern "C" void FORTRAN_ROUTINE (unsigned * flag); I'd accept that except for two things. One is that it seems rather counter-intuitive for the compiler to not pass reference parameters by reference, and I can find no documentation anywhere that says that. The other is that he changed a whole raft of other code in there at the same time, so it theoretically could have been another change that fixed whatever the issue was. So the question is, how does C++ actually pass reference parameters? Is it perhaps free to do copy-in, copy-out for small values or something? In other words, are reference parameters utterly useless in mixed-language programming? I'd like to know so I don't make this same code-killing mistake ever again.

    Read the article

  • Why is the 'this' keyword not a reference type in C++ [closed]

    - by Dave Tapley
    Possible Duplicates: Why ‘this’ is a pointer and not a reference? SAFE Pointer to a pointer (well reference to a reference) in C# The this keyword in C++ gets a pointer to the object I currently am. My question is why is the type of this a pointer type and not a reference type. Are there any conditions under which the this keyword would be NULL? My immediate thought would be in a static function, but Visual C++ at least is smart enough to spot this and report static member functions do not have 'this' pointers. Is this in the standard?

    Read the article

< Previous Page | 18 19 20 21 22 23 24 25 26 27 28 29  | Next Page >