Search Results

Search found 7511 results on 301 pages for 'synchronized block'.

Page 220/301 | < Previous Page | 216 217 218 219 220 221 222 223 224 225 226 227  | Next Page >

  • Convert HTACCESS mod_rewrite directives to nginx format?

    - by Chris
    I'm brand new to nginx and I am trying to convert the app I wrote over from Apache as I need the ability to serve a lot of clients at once without a lot of overhead! I'm getting the hang of setting up nginx and FastCGI PHP but I can't wrap my head around nginx's rewrite format just yet. I know you have to write some simple script that goes in the server {} block in the nginx config but I'm not yet familiar with the syntax. Could anyone with experience with both Apache and nginx help me convert this to nginx format? Thanks! # ------------------------------------------------------ # # Rewrite from canonical domain (remove www.) # # ------------------------------------------------------ # RewriteCond %{HTTP_HOST} ^www.domain.com RewriteRule (.*) http://domain.com/$1 [R=301,L] # ------------------------------------------------------ # # This redirects index.php to / # # ------------------------------------------------------ # RewriteCond %{THE_REQUEST} ^[A-Z]+\ /(index|index\.php)\ HTTP/ RewriteRule ^(index|index\.php)$ http://domain.com/ [R=301,L] # ------------------------------------------------------ # # This rewrites 'directories' to their PHP files, # # fixes trailing-slash issues, and redirects .php # # to 'directory' to avoid duplicate content. # # ------------------------------------------------------ # RewriteCond %{DOCUMENT_ROOT}/$1.php -f RewriteRule ^(.*)$ $1.php [L] RewriteCond %{DOCUMENT_ROOT}/$1.php -f RewriteRule ^(.*)/$ http://domain.com/$1 [R=301,L] RewriteCond %{THE_REQUEST} ^[A-Z]+\ /[^.]+\.php\ HTTP/ RewriteCond %{DOCUMENT_ROOT}/$1.php -f RewriteRule ^([^.]+)\.php$ http://domain.com/$1 [R=301,L] # ------------------------------------------------------ # # If it wasn't redirected previously and is not # # a file on the server, rewrite to image generation # # ------------------------------------------------------ # RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d RewriteRule ^([a-z0-9_\-@#\ "'\+]+)/?([a-z0-9_\-]+)?(\.png|/)?$ generation/image.php?user=${escapemap:$1}&template=${escapemap:$2} [NC,L]

    Read the article

  • Backing up VMs to a tape drive

    - by Aljoscha Vollmerhaus
    I've got myself one of these fancy tape drives, HP LTO2 with 200/400 GB cartridges. The st driver reports it like this: scsi 1:0:0:0: Sequential-Access HP Ultrium 2-SCSI T65D I can store and retrieve files like a charm using tar, both tar cf /dev/st0 somedirectory and tar xf /dev/st0 work flawless. However, what I really would like to backup are LVM LVs. They contain entire virtual machines with varying partition layouts, so using mount and tar is not an option. I've tried using something like dd if=/dev/VG/LV bs=64k of=/dev/st0 to achieve this, but there seem to be various problems associated with this approach. Firstly, I would like to be able to store more than 1 LV on a single tape. Now I guess I could seek to concatenate the data on the tape, but I think this would not work very well in an automated scenario with many different LVs of various sizes. Secondly, I would like to store a small XML file along with the raw data that contains some information about the VM contained in the LV. I could dump everything to a directory and tar it up - not very desirable, I would have to set aside huge amounts of scratch space. Is there an easier way to achieve this? Thirdly, from googling around it seems like it would be wise to use something like mbuffer when writing to the tape, to prevent what wikipedia calls "shoe-shining" the tape. However, I can't get anything useful done with mbuffer. The mbuffer man page suggests this for writing to a tape device: mbuffer -t -m 10M -p 80 -f -o $TAPE So I've tried this: dd if=/dev/VG/LV | mbuffer -t -m 10M -p 80 -f -d 64k -o /dev/st0 Note the added "-d 64k" to account for the 64k block size of the tape. However, reading data back from a tape written in this way never seems to yield any useful results - dd has been running for ages now, and managed to transfer only 361M of data from the tape. What's wrong here?

    Read the article

  • Setup site folders on Apache and PHP

    - by Cobus Kruger
    I'm trying to set up my first Apache server on my Windows PC at home and I have real trouble finding out which configuration settings go where. I downloaded and installed XAMPP which seemed to get everything nicely set up and can see a working website on http://localhost. So far so good. The point of this is to develop a website of course, and to make my life easier (irony?), I wanted to let the web site root point to my Eclipse project folder. So I opened httpd-vhosts.conf, uncommented a VirtualHost block and changed its DocumentRoot to my local path. Now when I try to load http://localhost I get a 403 (Access denied) error. So where do I configure permissions for my folder? And is that all I need to let my site run from the folder specified or am I going to have to clear another hurdle? Update: I tried to simplify things a little, so I reinstalled XAMPP and got back to a working http://localhost. Then I confirmed that httpd-vhosts.conf is included in httpd.conf and made the following changes to httpd-vhosts.conf: Uncommented the line NameVirtualHost *:80 Added a virtual host shown below. Restarted Apache and saw the expected page on http://localhost <VirtualHost *:80> DocumentRoot "C:/xampp/htdocs/" ServerName localhost ErrorLog "logs/dummy-host2.localhost-error.log" CustomLog "logs/dummy-host2.localhost-access.log" combined </VirtualHost> I then created a new folder named C:\testweb, added an index.html file and changed the DocumentRoot line shown above. For all intents and purposes I would then expect the two configurations to be equivalent. But this setup gives me an error 403. Even though the C:\testweb folder already had the same permissions as the C:\xampp\htdocs folder, I then went further and gave the Everyone group full control of C:\testweb and got exactly the same problem. So what did I miss?

    Read the article

  • MS SQL Server slows down over time?

    - by Dave Holland
    Have any of you experienced the following, and have you found a solution: A large part of our website's back-end is MS SQL Server 2005. Every week or two weeks the site begins running slower - and I see queries taking longer and longer to complete in SQL. I have a query that I like to use: USE master select text,wait_time,blocking_session_id AS "Block", percent_complete, * from sys.dm_exec_requests CROSS APPLY sys.dm_exec_sql_text(sql_handle) AS s2 order by start_time asc Which is fairly useful... it gives a snapshot of everything that's running right at that moment against your SQL server. What's nice is that even if your CPU is pegged at 100% for some reason and Activity Monitor is refusing to load (I'm sure some of you have been there) this query still returns and you can see what query is killing your DB. When I run this, or Activity Monitor during the times that SQL has begun to slow down I don't see any specific queries causing the issue - they are ALL running slower across the board. If I restart the MS SQL Service then everything is fine, it speeds right up - for a week or two until it happens again. Nothing that I can think of has changed, but this just started a few months ago... Ideas? --Added Please note that when this database slowdown happens it doesn't matter if we are getting 100K page views an hour (busier time of day) or 10K page views an hour (slow time) the queries all take a longer time to complete than normal. The server isn't really under stress - the CPU isn't high, the disk usage doesn't seem to be out of control... it feels like index fragmentation or something of the sort but that doesn't seem to be the case. As far as pasting results of the query I pasted above I really can't do that. The Query above lists the login of the user performing the task, the entire query, etc etc.. and I'd really not like to hand out the names of my databases, tables, columns and the logins online :)... I can tell you that the queries running at that time are normal, standard queries for our site that run all the time, nothing out of the norm.

    Read the article

  • Is On-The-Fly string replacement possible using GreaseMonkey and Firefox

    - by Gary M. Mugford
    I have looked for means to stop Brightcove videos from autostarting in Firefox and have come to the conclusion it isn't possible without external programming via something like Grease Monkey. However, I'm not proficient in javascript let alone GM. So I thought I'd ask here first whether what I want to do is feasible, or whether it's a fool's errand. What I want to accomplish is have a site specific script executed to replace a string value on the run in that site's code. Specifically, what I am looking for is something GM-style that would do this: if site_domain = 'www.SiteWithAutoPlayVideos.com' then replace_all('<param name="autoStart" value="true" />', '<param name="autoStart" value="false" />'); Having looked through Super User for anything GreaseMonkey that might relate, I see notices that the sandbox GM executes scripts in has to remain separate for security reasons. So, I suspect I might be in for disappointment. BUT if it is accomplishable and somebody here can confirm it, then I will do my best to struggle through the learning curve and get this noisome little problem put to rest. Yes, I have tried Flash Block and FlashDisable in order to attack this issue with no avail. Thanks in advance for your time.

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Identifying mail account used in CRAM-MD5 transaction

    - by ManiacZX
    I suppose this is one of those where the tool for identifying the problem is also the tool used for taking advantage of it. I have a mail server that I am seeing emails that spam is being sent through it. It is not an open relay, the messages in question are being sent by someone authenticating to the smtp with CRAM-MD5. However, the logs only capture the actual data passed, which has been hashed so I cannot see what user account is being used. My suspicion is a simple username/password combo or a user account's password has otherwise been compromised, but I cannot do much about it without knowing what user it is. Of course I can block the IP that is doing it, but that doesn't fix the real problem. I have both the CRAM-MD5 Base64 challenge string and the hashed client auth string containing the username, password and challenge string. I am looking for a way to either reverse this (which I haven't been able to find any information on) or otherwise I suppose I need a dictionary attack tool designed for CRAM-MD5 to run through two lists, one for username and one for password and the constant of the challenge string until it finds a matching result of the authentication string I have logged. Any information on reversing using the data I have logged, a tool to identify it or any alternative methods you have used for this situation would be greatly appreciated.

    Read the article

  • How can I erase the traces of Folder Redirection from the Default Domain Policy

    - by bruor
    I've taken over from an IT outsourcer and have found a struggle now that we're starting a migration to windows 7. Someone decided that they would setup Folder redirection in the Default Domain Policy. I've since configured redirection in another policy at an OU level. No matter what I do, the windows 7 systems pick up the Default Domain Policy folder redirection settings only. I keep getting entries in the event log showing that the previously redirected folders "need to be redirected" with a status of 0x80000004. From what I can tell this just means that it's redirecting them locally. Is there a way I can wipe that section of the GPO clean so it's no longer there? I'm hesitant to try to reset the default domain policy to complete defaults. ***UPDATE 6-26 I found that the following condition occurred and was causing the grief here. I've already implemented the new policies for clients, and for some reason, XP was working great, 7 was refusing to process. The DDP was enforced. Because of this, and the fact that the folder redirection policies were set to redirect back to the local profile upon removal, it was forcing clients to pick up it's "redirect to local" settings. Requirements for to recreate the issue. -Create a new test OU and policy. -Create some folder redirection settings, set them to redirect to local upon removal -Remove settings on that GPO -Refresh your view of the GPO and check the settings. -You'll notice that the settings show "not configured" entries for folder redirection. -Enforce this GPO -Create another sub-OU -Create a GPO linked to this sub-ou and configure some folder redirection settings. -Watch as the enforced GPOs "not configured" setting overrides the policy you just defined. I've had to relink the DDP to all OU's that have "block inheritance" enabled, and disable the "enforced" option on the DDP as a workaround. I'd love to re-enable enforcement of the DDP, but until I can erase the traces of folder redirection settings from the DDP, I think I'm stuck.

    Read the article

  • How do I use a self encrypting drive?

    - by Unique_Key
    I recently purchased a Micron RealSSD c400 self encrypting drive, and I am having a few issues when trying to get it recognized by my laptop (HP Elitebook 8440p running Windows 7 x64; also tried on a custom-built desktop). When I try to initialize the drive from disk management, I get a CRC error; also, when attempting to partition it from Windows setup, the program can't create the partitions. I also tried with UBCD, nothing. I assume this is due to drive security, but I haven't been able to find much information about this online; do I need a management software or something? I'm completely stumped here. EDIT As requested, when I try partitioning the device from Windows setup I get a 0x80300024 error; when I try initializing it from disk management, I get a "Data error (cyclic redundancy check)" message, and the event log shows the following under System: Source: VDS Basic Provider, message: unexpected failure. error code 490@01010004 (2x) Source: Virtual Disk Service, message: VDS fails to write boot code on a disk during clean operation. Error code: 80070001@02070008 (1x) Source: Disk, message: The device \Device\Harddisk2\DR2 has a bad block (2x) The security logs show nothing related. Also, when attempting to configure it from UBCD (utility: HDAT2), I get an error along the lines of "can't edit partition information" or something to that tune.

    Read the article

  • Error with procmail script to use Maildir format

    - by bradlis7
    I have this code in /etc/procmailrc: DROPPRIVS=yes DEFAULT=$HOME/Maildir/ :0 * ? /usr/bin/test -d $DEFAULT || /bin/mkdir $DEFAULT { } :0 E { # Bail out if directory could not be created EXITCODE=127 HOST=bail.out } MAILDIR=$HOME/Maildir/ But, when the directory already exists, sometimes it will send a return email with this error: 554 5.3.0 unknown mailer error 127. The email still gets delivered, mind you, but it sends back an error code to the sending user as well. I fixed this temporarily by commenting out the EXITCODE and HOST lines, but I'd like to know if there is a better solution. I found this block of code in multiple places across the net, but couldn't really find why this error was coming back to me. It seems to happen when I send an email to a local user. Sometimes the user has a .forward file to send it on to other users, sometimes not, but the result has been the same. I also tried removing DROPPRIVS, just in case it was messing up the forwarding, but it did not seem to affect it. Is the line starting with * ? /usr/bin/test a problem? The * signifies a regex, but the ? makes it return an integer value, correct? What is the integer being matched against? Or is it just comparing the integer return value? Do I need a space between the two blocks? Thanks for the help.

    Read the article

  • chrooting php-fpm with nginx

    - by dragonmantank
    I'm setting up a new server with PHP 5.3.9 and nginx, so I compiled PHP with the php-fpm SAPI options. By itself it works great using the following server entry in nginx: server { listen 80; server_name domain.com www.domain.com; root /var/www/clients/domain.com/www/public; index index.php; log_format gzip '$remote_addr - $remote_user [$time_local] "$request" $status $bytes_sent "$http_referer" "$http_user_agent" "$gzip_ratio"'; access_log /var/www/clients/domain.com/logs/www-access.log; error_log /var/www/clients/domain.com/logs/www-error.log error; location ~\.php$ { fastcgi_pass 127.0.0.1:9001; fastcgi_index index.php; fastcgi_param SCRIPT_FILENAME /var/www/clients/domain.com/www/public$fastcgi_script_name; fastcgi_param PATH_INFO $fastcgi_script_name; include /etc/nginx/fastcgi_params; } } It servers my PHP files just fine. For added security I wanted to chroot my FPM instance, so I added the following lines to my conf file for this FPM instance: # FPM config chroot = /var/www/clients/domain.com and changed the nginx config: #nginx config for chroot location ~\.php$ { fastcgi_pass 127.0.0.1:9001; fastcgi_index index.php; fastcgi_param SCRIPT_FILENAME www/public$fastcgi_script_name; fastcgi_param PATH_INFO $fastcgi_script_name; include /etc/nginx/fastcgi_params; } With those changes, nginx gives me a File not found message for any PHP scripts. Looking in the error log I can see that it's prepending the root path to my DOCUMENT_ROOT variable that's passed to fastcgi, so I tried to override it in the location block like this: fastcgi_param DOCUMENT_ROOT /www/public/; fastcgi_param SCRIPT_FILENAME $fastcgi_script_name; but I still get the same error, and the debug log shows the full, unchrooted path being sent to PHP-FPM. What am I missing to get this to work?

    Read the article

  • How do you monitor SSD wear in Windows when the drives are presented as 'generic' devices?

    - by MikeyB
    Under Linux, we can monitor SSD wear fairly easily with smartmontools whether the drive is presented as a normal block device or a generic device (which happens when the drive has been hardware RAIDed by certain controllers such as the one on the IBM HS22). How can we do the equivalent under Windows? Does anyone actually use smartmontools? Or are there other packages out there? The problem is that SCSI Generic devices just don't show up in Windows. If the drives aren't RAIDed we can see them fine. How I'd do it in Linux: sles11-live:~ # lsscsi -g [1:0:0:0] disk SMART USB-IBM 8989 /dev/sda /dev/sg0 [2:0:0:0] disk ATA MTFDDAK256MAR-1K MA44 - /dev/sg1 [2:0:1:0] disk ATA MTFDDAK256MAR-1K MA44 - /dev/sg2 [2:1:8:0] disk LSILOGIC Logical Volume 3000 /dev/sdb /dev/sg3 sles11-live:~ # smartctl -l ssd /dev/sg1 smartctl 5.42 2011-10-20 r3458 [x86_64-linux-2.6.32.49-0.3-default] (local build) Copyright (C) 2002-11 by Bruce Allen, http://smartmontools.sourceforge.net Device Statistics (GP Log 0x04) Page Offset Size Value Description 7 ===== = = == Solid State Device Statistics (rev 1) == 7 0x008 1 26~ Percentage Used Endurance Indicator |_ ~ normalized value sles11-live:~ # smartctl -l ssd /dev/sg2 smartctl 5.42 2011-10-20 r3458 [x86_64-linux-2.6.32.49-0.3-default] (local build) Copyright (C) 2002-11 by Bruce Allen, http://smartmontools.sourceforge.net Device Statistics (GP Log 0x04) Page Offset Size Value Description 7 ===== = = == Solid State Device Statistics (rev 1) == 7 0x008 1 3~ Percentage Used Endurance Indicator |_ ~ normalized value

    Read the article

  • How to whitelist external access to an internal webserver via Cisco ACLs?

    - by Josh
    This is our company's internet gateway router. This is what I want to accomplish on our Cisco 2691 router: All employees need to be able to have unrestricted access to the internet (I've blocked facebook with an ACL, but other than that, full access) There is an internal webserver that should be accessible from any internal IP address, but only a select few external IP addresses. Basically, I want to whitelist access from outside the network. I don't have a hardware firewall appliance. Until now, the webserver has not needed to be accessible externally... or in any case, the occasional VPN has sufficed when needed. As such, the following config has been sufficient: access-list 106 deny ip 66.220.144.0 0.0.7.255 any access-list 106 deny ip ... (so on for the Facebook blocking) access-list 106 permit ip any any ! interface FastEthernet0/0 ip address x.x.x.x 255.255.255.248 ip access-group 106 in ip nat outside fa0/0 is the interface with the public IP However, when I add... ip nat inside source static tcp 192.168.0.52 80 x.x.x.x 80 extendable ...in order to forward web traffic to the webserver, that just opens it up entirely. That much makes sense to me. This is where I get stumped though. If I add a line to the ACL to explicitly permit (whitelist) an IP range... something like this: access-list 106 permit tcp x.x.x.x 0.0.255.255 192.168.0.52 0.0.0.0 eq 80 ... how do I then block other external access to the webserver while still maintaining unrestricted internet access for internal employees? I tried removing the access-list 106 permit ip any any. That ended up being a very short-lived config :) Would something like access-list 106 permit ip 192.168.0.0 0.0.0.255 any on an "outside-inbound" work?

    Read the article

  • How to combine try_files and sendfile on Nginx?

    - by hcalves
    I need Nginx to serve a file relative from document root if it exists, then fallback to an upstream server if it doesn't. This can be accomplished with something like: server { listen 80; server_name localhost; location / { root /var/www/nginx/; try_files $uri @my_upstream; } location @my_upstream { internal; proxy_pass http://127.0.0.1:8000; } } Fair enough. The problem is, my upstream is not serving the contents of URI directly, but instead, returning X-Accel-Redirect with a location relative to document root (it generates this file on-the-fly): % curl -I http://127.0.0.1:8000/animals/kitten.jpg__100x100__crop.jpg HTTP/1.0 200 OK Date: Mon, 26 Nov 2012 20:58:25 GMT Server: WSGIServer/0.1 Python/2.7.2 X-Accel-Redirect: animals/kitten.jpg__100x100__crop.jpg Content-Type: text/html; charset=utf-8 Apparently, this should work. The problem though is that Nginx tries to serve this file from some internal default document root instead of using the one specified in the location block: 2012/11/26 18:44:55 [error] 824#0: *54 open() "/usr/local/Cellar/nginx/1.2.4/htmlanimals/kitten.jpg__100x100__crop.jpg" failed (2: No such file or directory), client: 127.0.0.1, server: localhost, request: "GET /animals/kitten.jpg__100x100__crop.jpg HTTP/1.1", upstream: "http://127.0.0.1:8000/animals/kitten.jpg__100x100__crop.jpg", host: "127.0.0.1:80" How do I force Nginx to serve the file relative to the right document root? According to XSendfile documentation the returned path should be relative, so my upstream is doing the right thing.

    Read the article

  • postgresql No space left on device

    - by pstanton
    Postgres is reporting that it is out of disk space while performing a rather large aggregation query: Caused by: org.postgresql.util.PSQLException: ERROR: could not write block 31840050 of temporary file: No space left on device at org.postgresql.core.v3.QueryExecutorImpl.receiveErrorResponse(QueryExecutorImpl.java:1592) at org.postgresql.core.v3.QueryExecutorImpl.processResults(QueryExecutorImpl.java:1327) at org.postgresql.core.v3.QueryExecutorImpl.execute(QueryExecutorImpl.java:192) at org.postgresql.jdbc2.AbstractJdbc2Statement.execute(AbstractJdbc2Statement.java:451) at org.postgresql.jdbc2.AbstractJdbc2Statement.executeWithFlags(AbstractJdbc2Statement.java:350) at org.postgresql.jdbc2.AbstractJdbc2Statement.executeUpdate(AbstractJdbc2Statement.java:304) at org.hibernate.engine.query.NativeSQLQueryPlan.performExecuteUpdate(NativeSQLQueryPlan.java:189) ... 8 more However the disk has quite a lot of space: Filesystem Size Used Avail Use% Mounted on /dev/sda1 386G 123G 243G 34% / udev 5.9G 172K 5.9G 1% /dev none 5.9G 0 5.9G 0% /dev/shm none 5.9G 628K 5.9G 1% /var/run none 5.9G 0 5.9G 0% /var/lock none 5.9G 0 5.9G 0% /lib/init/rw The query is doing the following: INSERT INTO summary_table SELECT t.a, t.b, SUM(t.c) AS c, COUNT(t.*) AS count, t.d, t.e, DATE_TRUNC('month', t.start) AS month, tt.type AS type, FALSE, tt.duration FROM detail_table_1 t, detail_table_2 tt WHERE t.trid=tt.id AND tt.type='a' AND DATE_PART('hour', t.start AT TIME ZONE 'Australia/Sydney' AT TIME ZONE 'America/New_York')>=23 OR DATE_PART('hour', t.start AT TIME ZONE 'Australia/Sydney' AT TIME ZONE 'America/New_York')<13 GROUP BY month, type, t.a, t.b, t.d, t.e, FALSE, tt.duration any tips?

    Read the article

  • How can i get more low memory with the following setup:

    - by user539484
    Modules using memory below 1 MB: Name Total = Conventional + Upper Memory -------- ---------------- ---------------- ---------------- MSDOS 14 317 (14K) 14 317 (14K) 0 (0K) HIMEM 1 120 (1K) 1 120 (1K) 0 (0K) EMM386 3 120 (3K) 3 120 (3K) 0 (0K) OAKCDROM 36 064 (35K) 36 064 (35K) 0 (0K) POWER 80 (0K) 80 (0K) 0 (0K) NLSFUNC 2 784 (3K) 2 784 (3K) 0 (0K) COMMAND 2 928 (3K) 2 928 (3K) 0 (0K) MSCDEX 15 712 (15K) 15 712 (15K) 0 (0K) SMARTDRV 30 384 (30K) 13 984 (14K) 16 400 (16K) KEYB 6 752 (7K) 6 752 (7K) 0 (0K) MOUSE 17 296 (17K) 17 296 (17K) 0 (0K) DISPLAY 8 336 (8K) 0 (0K) 8 336 (8K) SETVER 512 (1K) 0 (0K) 512 (1K) DOSKEY 4 144 (4K) 0 (0K) 4 144 (4K) POWER 4 672 (5K) 0 (0K) 4 672 (5K) Free 552 944 (540K) 539 088 (526K) 13 856 (14K) Memory Summary: Type of Memory Total = Used + Free ---------------- ---------- ---------- ---------- Conventional 653 312 114 224 539 088 Upper 47 920 34 064 13 856 Reserved 0 0 0 Extended (XMS)* 64 898 256 2 671 824 62 226 432 ---------------- ---------- ---------- ---------- Total memory 65 599 488 2 820 112 62 779 376 Total under 1 MB 701 232 148 288 552 944 Total Expanded (EMS) 33 947 648 (33 152K Free Expanded (EMS)* 33 538 048 (32 752K * EMM386 is using XMS memory to simulate EMS memory as needed. Free EMS memory may change as free XMS memory changes. Largest executable program size 538 976 (526K) Largest free upper memory block 7 488 (7K) MS-DOS is resident in the high memory area. I'm running MS-DOS 6.22 on VMWare virtual hardware. This is memory state after memmaker pass, so i'm looking for optimization beyond memmaker. Note: NLS drivers (DISPLAY, KEYB, NSLFUNC) are essential for me. Thanks to @mtone for valuable reminder about MSCDEX /E which gave me 16KiB of low memory (see the diff)!

    Read the article

  • Xen guests accessing LUNs

    - by mechcow
    We are using RHEL5.3 with a Clarion SAN attached by FC. Our situation is that we have a number of LUNs presented to Hosts and we want to dynamically present the LUNs to Xen Guests. We are not sure on what the best practice approach is to set this up. The Xen guests will form a cluster together and need the LUNs only for data partitions, i.e. when they are actively running services. So one approach would be to always present all disks to all Xen guests, and then rely up on the cluster software, and mount itself, to not mount the disk twice in two locations. This sounds kinda risky and also is not very secure (one cracked guest can see/destroy all the data). Another approach would be to dynamically add and remove the disks from the Xen guests at the dom0 level (using xm block-attach). This could work but sounds slightly complicated, I'm wondering whether Red Hat Cluster Suite supports this in some way or whether there are scripts to do this. Yet another approach would be to have the LUNs endpointed at the Xen guests themselves - I'm not sure whether this is technically possible since the multipathing has to be done at the Host level.

    Read the article

  • Using mixed disks and OpenFiler to create RAID storage

    - by Cylindric
    I need to improve my home storage to add some resilience. I currently have four disks, as follows: D0: 500Gb (System, Boot) D1: 1Tb D2: 500Gb D3: 250Gb There's a mix of partitions on there, so it's not JBOD, but data is pretty spread out and not redundant. As this is my primary PC and I don't want to give up the entire OS to storage, my plan is to use OpenFiler in a VM to create a virtual SAN. I will also use Windows Software RAID to mirror the OS. Partitions will be created as follows: D0 P1: 100Mb: System-Reserved Boot D0 P2: 50Gb: Virtual Machine VMDKs for OS D0 P3: 350Gb: Data D1 P1: 100Mb: System-Reserved Boot D1 P2: 50Gb: Virtual Machine VMDKs for OS D1 P3: 800Gb: Data D2 P1: 450Gb: Data D3 P1: 200Gb: Data This will result in: Mirrored boot partition Mirrored Operating system Mirrored Virtual machine O/S disks Four partitions for data In the four data partitions I will create several large VMDK files, which I will "mount" into OpenFiler as block-storage devices, combined into three RAID arrays (due to the differing disk sizes) In effect, I'll end up with the following usable partitions SYSTEM 100Mb the small boot partition created by the Windows 7 installer (RAID-1) HOST 50Gb the Windows 7 partition (RAID-1) GUESTS 50Gb Virtual machine Guest VMDK's (RAID-1) VG1 900Gb Volume group consisting of a RAID-5 and two RAID-1 VG2 300Gb Volume group consisting of a single disk On VG1 I can dynamically assign storage for my media, photographs, documents, whatever, and it will be safe. On VG2 I can dynamically assign storage for my data that is not critical, and easily recoverable, as it is not safe. Are there any particular 'gotchas' when implementing a virtual OpenFiler like this? Is the recovery process for a failing disk going to be very problematic? Thanks.

    Read the article

  • Squid Authentication & streaming

    - by Steve Butler
    I've got squid setup using Kerberos authentication. I'm also using squidguard as an URL redirector to block out the usual nastiness of the web. There are some sites though that we allow certain users to, and others not. This all works well, assuming I'm not using any streaming. From what i can determine from the squid logs and the wireshark traces I've done, when the initial request to stream is sent, everything is good, the authenticated username is sent with the request to squidguard. The problem is that on subsequent traffic the username is not sent to squidguard, causing it to be blocked based on default policy. I've tried using the squid built-in allow/deny stuff, but its relatively clunky, and so far squidguard has been pretty easy and fast. Here comes the question(s): How do i get Squid to pass username on all requests? (something tells me this isn't the best way) How do i get squidguard to see traffic is authenticated to a specific user even when a username isn't passed? Is there any other way of accomplishing this? A few details that may be of importance: I'm using a list of users stored in a text file for squidguard to compare against. I'm using full kerberos auth with Squid. CentOS 6.0 Squid 3.1.4 Squidguard 1.3

    Read the article

  • Joining an Ubuntu 14.04 machine to active directory with realm and sssd

    - by tubaguy50035
    I've tried following this guide to set up realmd and sssd with active directory: http://funwithlinux.net/2014/04/join-ubuntu-14-04-to-active-directory-domain-using-realmd/ When I run the command realm –verbose join domain.company.com –user-principal=c-u14-dev1/[email protected] –unattended everything seems to connect. My sssd.conf looks like the following: [nss] filter_groups = root filter_users = root reconnection_retries = 3 [pam] reconnection_retries = 3 [sssd] domains = DOMAIN.COMPANY.COM config_file_version = 2 services = nss, pam [domain/DOMAIN.COMPANY.COM] ad_domain = DOMAIN.COMPANY.COM krb5_realm = DOMAIN.COMPANY.COM realmd_tags = manages-system joined-with-adcli cache_credentials = True id_provider = ad krb5_store_password_if_offline = True default_shell = /bin/bash ldap_id_mapping = True use_fully_qualified_names = True fallback_homedir = /home/%d/%u access_provider = ad My /etc/pam.d/common-auth looks like this: auth [success=3 default=ignore] pam_krb5.so minimum_uid=1000 auth [success=2 default=ignore] pam_unix.so nullok_secure try_first_pass auth [success=1 default=ignore] pam_sss.so use_first_pass # here's the fallback if no module succeeds auth requisite pam_deny.so # prime the stack with a positive return value if there isn't one already; # this avoids us returning an error just because nothing sets a success code # since the modules above will each just jump around auth required pam_permit.so # and here are more per-package modules (the "Additional" block) auth optional pam_cap.so However, when I try to SSH into the machine with my active directory user, I see the following in auth.log: Aug 21 10:35:59 c-u14-dev1 sshd[11285]: Invalid user nwalke from myip Aug 21 10:35:59 c-u14-dev1 sshd[11285]: input_userauth_request: invalid user nwalke [preauth] Aug 21 10:36:10 c-u14-dev1 sshd[11285]: pam_krb5(sshd:auth): authentication failure; logname=nwalke uid=0 euid=0 tty=ssh ruser= rhost=myiphostname Aug 21 10:36:10 c-u14-dev1 sshd[11285]: pam_unix(sshd:auth): check pass; user unknown Aug 21 10:36:10 c-u14-dev1 sshd[11285]: pam_unix(sshd:auth): authentication failure; logname= uid=0 euid=0 tty=ssh ruser= rhost=myiphostname Aug 21 10:36:10 c-u14-dev1 sshd[11285]: pam_sss(sshd:auth): authentication failure; logname= uid=0 euid=0 tty=ssh ruser= rhost=myiphostname user=nwalke Aug 21 10:36:10 c-u14-dev1 sshd[11285]: pam_sss(sshd:auth): received for user nwalke: 10 (User not known to the underlying authentication module) Aug 21 10:36:12 c-u14-dev1 sshd[11285]: Failed password for invalid user nwalke from myip port 34455 ssh2 What do I need to do to allow active directory users the ability to log in?

    Read the article

  • Best way to mount 3-4 monitor like this?

    - by jasondavis
    I just purchased 2 HP 2009m widescreen monitors, they are not the biggest thing on the block, they are like 19-20" and are only around 150-200$ so I think they are perfect. I bought 2 of them just to make sure I like them, with the full intention of purchasing more to make either a tripple or quad display. I now I am stuck trying to decide, if I purchase 1 more to have a tripple display I would then like to just wrap the third monitor to either the rigth or left side, I could do this without a mount most likely pretty easy. If I decide to go with 2 more monitors to make a quad display then I would like to add the 2 new monitor directly above the 2 that I have now. So it would make a grid of 2 wide and 2 high. I have posted a few photos belwo to show them now with the 2 I have, you will notice that I have them tilted inwards to make more of a "V" shape instead of them being side by side and "STRAIGHT". Now if I decide to make thegrid of 4 then I will need to buy or build a stand to hold them all tightly together (no whitespace or gap between the grid of monitors) but I would like to still have both rows invert to make the slight "V". Do you know of any existing stands I could purchase that would hold all 4 monitors without making them be STARIGHT without the "V" shape? Any tips appreciated please, also they do have holes in the back for VESA. a few photos... (they are from iphone and lighting made them note very good but you can see what I am working with here)

    Read the article

  • Keyboard's media keys are blocked by a program

    - by Mike Hanson
    I've got a Microsoft Natural Ergonomic Keyboard 4000. In addition to the regular keys, it's also got keys for Web/Home, Search, Mail, Favorites (5), Calculator, and Media functions (Mute, Volume Up/Down, and Play/Pause). Everything works most of the time, and the exception is rather odd. I use a programming system called Clarion. When that has focus, the Media keys don't work. (All the others still do.) I've also discovered that programs that I create using Clarion also block the media keys (only when they have focus). This indicates that it's probably something in Clarion's Run-Time Library (RTL) that's causing the trouble. The keys will work if I click on a non-Clarion window before hitting the media key, but that's an undesirable hassle. The odd thing is that I have many colleagues with the same keyboard, and they have no problem. When I recently upgraded from Vista Professional to Win7 Ultimate, I noticed that various things "appear" differently. For example, with my old system, when I changed the volume or muted the volume bar visualization always appeared at the bottom right on the screen. Now it doesn't appear in certain programs, even when it works. This indicates an order of precedence for visual elements. I'm fairly certain a similar order of precedence exists for keyboard hooks. Depending on how the hooks are defined, and the order in which they're applied, it would seem that sometimes the IntelliType drivers don't see the media keystrokes. The Media keys probably behave differently than the rest of the "special" keys, because they are more of a standard across all keyboards, so perhaps are handled by a different driver hooking mechanism. Does anyone have any suggestions of how I might fix this problem? Is there some way to change the order of hooks? Delay the loading of the IntelliType driver? Thanks in advance!

    Read the article

  • How to prevent blocking http auth popups on firefox restart with many tabs open

    - by Glen S. Dalton
    I am using the latest firefox with tab mix plus and tabgoups manager. I have maybe 50 or 100 tabs oben in different tab groups. When I shutdown firefox and start it again all tabs and tab groups are perfectly rebuilt. But I have also many pages open that are behind a standard http auth, and these pages all request their usernames and passwords. So during startup firefox pops up all these pages' http auth windows. And they block everything else in firefox, they are like modal windows. (I am involved in website development and the beta versions are behind apache http auth.) I have to click many times the OK button in the popups, before I can do anything. All the usernames and passwords are already filled in. (And the firefox taskbar entry blinks and the firefox window heading also blinks, and focus switches back and foth, which also annoys me. And sometimes the popups do not react to my clicks, because firefox is maybe just switching focus somewhere else. This is the worst.) I want a plugin or some way to skip those popups. There are some plugins I tried some time ago, but they did not do what I need, because they require a mouse click for each login, which is no improvement over the situation like it already is. This is not about password storage (because firefox already stores them). But of course, if some password storing plugin could heal this it would be great.

    Read the article

  • Change the number of consecutive frequent ssh login before temporary blocking the user login

    - by Kenneth
    my server currently would temporarily refuse a user to login for certain amount of time (maybe ~20min) if the user consecutively frequent ssh login for 3 times. Can I change this behaviour (say relaxed the definition of frequent maybe from 'within 5 sec' to 'within 10 sec'; or increase the # of consecutive login from 3 to 5)? Thanks. Added: Ah.. now I think the problem was not with the ssh. I just tried on another newly installed server. consecutive successful login won't block the user. I have no sudo permission on the server I mentioned above. Now I suspect this behaviour may cause by the firewall in the system. Thanks everyone's comments. ADDED 2: Ah... after some searches. I think the server is using /sbin/iptables to do it as I can see the iptables program is there even though I don't have permission to list the rules. Thanks everyone, special thank to jaume and Mark!

    Read the article

  • How to HIDE "client denied by server configuration:" error in log

    - by Keith
    I want to block access to my web server by default as a precaution but I keep getting the following errors showing up in my error log. [Wed Jun 27 23:30:54 2012] [error] [client 86.77.20.107] client denied by server configuration: /home/www/default/Edu.jar [Wed Jun 27 23:32:40 2012] [error] [client 86.77.20.107] client denied by server configuration: /home/www/default/REST.jar [Wed Jun 27 23:35:39 2012] [error] [client 86.77.20.107] client denied by server configuration: /home/www/default/Set.jar [Thu Jun 28 01:01:17 2012] [error] [client 58.218.199.227] client denied by server configuration: /home/www/default/proxyheader.php [Thu Jun 28 02:34:57 2012] [error] [client 58.218.199.227] client denied by server configuration: /home/www/default/proxy.php [Thu Jun 28 05:41:33 2012] [error] [client 58.218.199.227] client denied by server configuration: /home/www/default/proxyheader.php [Thu Jun 28 06:55:10 2012] [error] [client 180.76.6.20] client denied by server configuration: /home/www/default/ [Thu Jun 28 07:31:26 2012] [error] [client 86.77.20.107] client denied by server configuration: /home/www/default/Edu.jar [Thu Jun 28 07:32:25 2012] [error] [client 86.77.20.107] client denied by server configuration: /home/www/default/REST.jar [Thu Jun 28 07:36:10 2012] [error] [client 86.77.20.107] client denied by server configuration: /home/www/default/Set.jar I don't really want these errors to show up but whatever I do, I can't get rid of them. Does anyone know how I can achieve this? Here is a copy of my configuration. <VirtualHost *:80> DocumentRoot /home/www/default <Directory /> AllowOverride None Order Deny,Allow Deny from all </Directory> #ErrorLog /var/log/apache2/error.log #LogLevel warn CustomLog /var/log/apache2/access.log combined </VirtualHost>

    Read the article

< Previous Page | 216 217 218 219 220 221 222 223 224 225 226 227  | Next Page >