Search Results

Search found 52179 results on 2088 pages for 'command line interface'.

Page 221/2088 | < Previous Page | 217 218 219 220 221 222 223 224 225 226 227 228  | Next Page >

  • java.util.logging: how to suppress date line

    - by andrews
    I'm trying to suppress output of the date line durinng logging when using the default logger in java.util.logging. For example, here is a typical output: Jun 1, 2010 10:18:12 AM gamma.utility.application info INFO: ping: db-time=2010-06-01 10:18:12.0, local-time=20100601t101812, duration=180000 Jun 1, 2010 10:21:12 AM gamma.utility.application info INFO: ping: db-time=2010-06-01 10:21:12.0, local-time=20100601t102112, duration=180000 I would like to get rid of the Jun 1, 2010... lines, they just clutter my log output. How can I do this?

    Read the article

  • Partial generic type inference possible in C#?

    - by Lasse V. Karlsen
    I am working on rewriting my fluent interface for my IoC class library, and when I refactored some code in order to share some common functionality through a base class, I hit upon a snag. Note: This is something I want to do, not something I have to do. If I have to make do with a different syntax, I will, but if anyone has an idea on how to make my code compile the way I want it, it would be most welcome. I want some extension methods to be available for a specific base-class, and these methods should be generic, with one generic type, related to an argument to the method, but the methods should also return a specific type related to the particular descendant they're invoked upon. Better with a code example than the above description methinks. Here's a simple and complete example of what doesn't work: using System; namespace ConsoleApplication16 { public class ParameterizedRegistrationBase { } public class ConcreteTypeRegistration : ParameterizedRegistrationBase { public void SomethingConcrete() { } } public class DelegateRegistration : ParameterizedRegistrationBase { public void SomethingDelegated() { } } public static class Extensions { public static ParameterizedRegistrationBase Parameter<T>( this ParameterizedRegistrationBase p, string name, T value) { return p; } } class Program { static void Main(string[] args) { ConcreteTypeRegistration ct = new ConcreteTypeRegistration(); ct .Parameter<int>("age", 20) .SomethingConcrete(); // <-- this is not available DelegateRegistration del = new DelegateRegistration(); del .Parameter<int>("age", 20) .SomethingDelegated(); // <-- neither is this } } } If you compile this, you'll get: 'ConsoleApplication16.ParameterizedRegistrationBase' does not contain a definition for 'SomethingConcrete' and no extension method 'SomethingConcrete'... 'ConsoleApplication16.ParameterizedRegistrationBase' does not contain a definition for 'SomethingDelegated' and no extension method 'SomethingDelegated'... What I want is for the extension method (Parameter<T>) to be able to be invoked on both ConcreteTypeRegistration and DelegateRegistration, and in both cases the return type should match the type the extension was invoked on. The problem is as follows: I would like to write: ct.Parameter<string>("name", "Lasse") ^------^ notice only one generic argument but also that Parameter<T> returns an object of the same type it was invoked on, which means: ct.Parameter<string>("name", "Lasse").SomethingConcrete(); ^ ^-------+-------^ | | +---------------------------------------------+ .SomethingConcrete comes from the object in "ct" which in this case is of type ConcreteTypeRegistration Is there any way I can trick the compiler into making this leap for me? If I add two generic type arguments to the Parameter method, type inference forces me to either provide both, or none, which means this: public static TReg Parameter<TReg, T>( this TReg p, string name, T value) where TReg : ParameterizedRegistrationBase gives me this: Using the generic method 'ConsoleApplication16.Extensions.Parameter<TReg,T>(TReg, string, T)' requires 2 type arguments Using the generic method 'ConsoleApplication16.Extensions.Parameter<TReg,T>(TReg, string, T)' requires 2 type arguments Which is just as bad. I can easily restructure the classes, or even make the methods non-extension-methods by introducing them into the hierarchy, but my question is if I can avoid having to duplicate the methods for the two descendants, and in some way declare them only once, for the base class. Let me rephrase that. Is there a way to change the classes in the first code example above, so that the syntax in the Main-method can be kept, without duplicating the methods in question? The code will have to be compatible with both C# 3.0 and 4.0. Edit: The reason I'd rather not leave both generic type arguments to inference is that for some services, I want to specify a parameter value for a constructor parameter that is of one type, but pass in a value that is a descendant. For the moment, matching of specified argument values and the correct constructor to call is done using both the name and the type of the argument. Let me give an example: ServiceContainerBuilder.Register<ISomeService>(r => r .From(f => f.ConcreteType<FileService>(ct => ct .Parameter<Stream>("source", new FileStream(...))))); ^--+---^ ^---+----^ | | | +- has to be a descendant of Stream | +- has to match constructor of FileService If I leave both to type inference, the parameter type will be FileStream, not Stream.

    Read the article

  • loading multiple line query in one row

    - by bharath
    Hi, How to load a multiple line query in one row using mysql.The data is stored in a text file. For example: "GGAGTTGTGGGAGTGGAGGAGGAAGAGGCGGTGGGGAGTACGGGGGCTGGTCCCAGAAGATGGCGGAGGC GGGGGATTTCTGGTAGGTCCTACTTTAGGACAAGATGTGGTGGTACTGTTGAAGCGTCAGTCTTTGATTC" Thanks in advance.

    Read the article

  • How to transform multiple line into one line in bash stdout ?

    - by Samantha
    Hello, I sometimes do this in my shell : sam@sam-laptop:~/shell$ ps aux | grep firefox | awk '{print $2}' 2681 2685 2689 4645 $ kill -9 2681 2685 2689 4645 Is there a way I can transform the multiple lines containing the PIDs into one line separated by spaces ? (It's a little bit annoying to type the PIDs every time and I really would like to learn :) ) Thanks a lot.

    Read the article

  • NetBeans Java code formatter: logical operators on new line

    - by mizipzor
    My code looks like this: if (firstCondition() && secondCondition()) { // ... code } The default settings for the code formatter in NetBeans wants to put the && on a new line, like this: if (firstCondition() && secondCondition()) { // ... code } The formatter works well so I would just like to find the setting so it doesnt change the code to the latter. Whats the setting called?

    Read the article

  • Animating gradient displays line artifacts in ActionScript

    - by TheDarkIn1978
    i've programatically created a simple gradient (blue to red) sprite rect using my own basic class called GradientRect, but moving or animation the sprite exhibits line artifacts. when the sprite is rotating, it kind of resembles bad reception of an old television set. i'm almost certain the cause is because each line slice of the gradient is vector so there are gaps between the lines - this is visible when the sprite is zoomed in. var colorPickerRect:GradientRect = new GradientRect(200, 200, 0x0000FF, 0xFF0000); addChild(colorPickerRect); colorPickerRect.cacheAsBitmap = true; colorPickerRect.x = colorPickerRect.y = 100; colorPickerRect.addEventListener(Event.ENTER_FRAME, rotate); function rotate(evt:Event):void { evt.target.rotation += 1; } ________________________ //CLASS PACKAGE package { import flash.display.CapsStyle; import flash.display.GradientType; import flash.display.LineScaleMode; import flash.display.Sprite; import flash.geom.Matrix; public class GradientRect extends Sprite { public function GradientRect(gradientRectWidth:Number, gradientRectHeight:Number, ...leftToRightColors) { init(gradientRectWidth, gradientRectHeight, leftToRightColors); } private function init(gradientRectWidth:Number, gradientRectHeight:Number, leftToRightColors:Array):void { var leftToRightAlphas:Array = new Array(); var leftToRightRatios:Array = new Array(); var leftToRightPartition:Number = 255 / (leftToRightColors.length - 1); var pixelColor:Number; var i:int; //Push arrays for (i = 0; i < leftToRightColors.length; i++) { leftToRightAlphas.push(1); leftToRightRatios.push(i * leftToRightPartition); } //Graphics matrix and lineStyle var leftToRightColorsMatrix:Matrix = new Matrix(); leftToRightColorsMatrix.createGradientBox(gradientRectWidth, 1); graphics.lineStyle(1, 0, 1, false, LineScaleMode.NONE, CapsStyle.NONE); for (i = 0; i < gradientRectWidth; i++) { graphics.lineGradientStyle(GradientType.LINEAR, leftToRightColors, leftToRightAlphas, leftToRightRatios, leftToRightColorsMatrix); graphics.moveTo(i, 0); graphics.lineTo(i, gradientRectHeight); } } } } how can i solve this problem?

    Read the article

  • Getting following exception javax.sound.sampled.LineUnavailableException: line with format ULAW 800

    - by angelina
    Dear All, I tried to play and get duration of a wave file using code below but got following exception.please resolve.I m using a wave file format. URL url = new URL("foo.wav"); Clip clip = AudioSystem.getClip(); AudioInputStream ais = AudioSystem.getAudioInputStream(url); clip.open(ais); System.out.println(clip.getMicrosecondLength()); **javax.sound.sampled.LineUnavailableException: line with format ULAW 8000.0 Hz, 8 bit, mono, 1 bytes/frame, not supported.**

    Read the article

  • Convert Line breaks to html break for all field getters in Symfony project

    - by Ben
    I am working on a Symfony project and I currently have this: <?php echo preg_replace('/\n/','<br />', $review->getComments()); ?> and would very much like to be able to make all getters add html line breaks so i don't have to pepper my code with preg_replace. the $object-getFieldname methods are work automatically so I am looking to extend this somewhere to globally add a new method. What is the best approach here?

    Read the article

  • Current Line For Visual Studio Macros

    - by Vadim
    How can I read text of a current line (where cursor is situated) from Macros? I'm going to use such a fucntion: Public Sub AddTextToChangeLogFile() Dim textOnACurrentLine As ??? textOnACurrentLine = ??? If textOnACurrentLine.Text <> String.Empty Then Dim sw As New StreamWriter("C:\###\Changes.txt", True) sw.WriteLine(textOnACurrentLine + ". file: " + DTE.ActiveDocument.Name) sw.Close() End If End Sub

    Read the article

  • Python: try statement single line

    - by Brant
    Is there a way in python to turn a try/except into a single line? something like... b = 'some variable' a = c | b #try statement goes here Where b is a declared variable and c is not... so c would throw an error and a would become b...

    Read the article

  • Powershell $LastExitCode=0 but $?=False . Redirecting stderr to stdout gives NativeCommandError

    - by Colonel Panic
    Can anyone explain Powershell's surprising behaviour in the second example below? First, a example of sane behaviour: PS C:\> & cmd /c "echo Hello from standard error 1>&2"; echo "`$LastExitCode=$LastExitCode and `$?=$?" Hello from standard error $LastExitCode=0 and $?=True No surprises. I print a message to standard error (using cmd's echo). I inspect the variables $? and $LastExitCode. They equal to True and 0 respectively, as expected. However, if I ask Powershell to redirect standard error to standard output over the first command, I get a NativeCommandError: PS C:\> & cmd /c "echo Hello from standard error 1>&2" 2>&1; echo "`$LastExitCode=$LastExitCode and `$?=$?" cmd.exe : Hello from standard error At line:1 char:4 + cmd <<<< /c "echo Hello from standard error 1>&2" 2>&1; echo "`$LastExitCode=$LastExitCode and `$?=$?" + CategoryInfo : NotSpecified: (Hello from standard error :String) [], RemoteException + FullyQualifiedErrorId : NativeCommandError $LastExitCode=0 and $?=False My first question, why the NativeCommandError ? Secondly, why is $? False when cmd ran successfully and $LastExitCode is 0? Powershell's docs about_Automatic_Variables don't explicitly define $?. I always supposed it is True if and only if $LastExitCode is 0 but my example contradicts that. Here's how I came across this behaviour in the real-world (simplified). It really is FUBAR. I was calling one Powershell script from another. The inner script: cmd /c "echo Hello from standard error 1>&2" if (! $?) { echo "Job failed. Sending email.." exit 1 } # do something else Running this simply .\job.ps1, it works fine, no email is sent. However, I was calling it from another Powershell script, logging to a file .\job.ps1 2>&1 > log.txt. In this case, an email is sent! Here, the act of observing a phenomenon changes its outcome. This feels like quantum physics rather than scripting! [Interestingly: .\job.ps1 2>&1 may or not blow up depending on where you run it]

    Read the article

  • Simple Tableless Positioning issue: Trying to float Div right on same line

    - by MrEnder
    Ok I just started a template for a website http://clickforclicks.com/design1/ I'm trying to make it tableless. Notice I have a red div along the side. I tried to get one on the otherside aswell that looked the same. But when I do it. It goes to a new line =[ How might I get this effect without using Javascript or Absolute positioning that wont look proper on all resolution sizes.

    Read the article

  • multi-line pattern matching in pyhon

    - by Horace Ho
    A periodic computer generated message (simplified): Hello user123, - (604)7080900 - 152 - minutes Regards Using python, how can I extract "(604)7080900", "152", "minutes" (i.e. any text following a leading "- " pattern) between the two empty lines (empty line is the \n\n after "Hello user123" and the \n\n before "Regards"). Even better if the result string list are stored in an array. Thanks!

    Read the article

  • Can you reverse order a string in one line with LINQ or a LAMBDA expression

    - by Student for Life
    Not that I would want to use this practically (for many reasons) but out of strict curiousity I would like to know if there is a way to reverse order a string using LINQ and/or LAMBDA expressions in one line of code, without utilising any framework "Reverse" methods. e.g. string value = "reverse me"; string reversedValue = (....); and reversedValue will result in "em esrever" EDIT Clearly an impractical problem/solution I know this, so don't worry it's strictly a curiosity question around the LINQ/LAMBDA construct.

    Read the article

  • vim: How do I line up ruby options?

    - by TheDeeno
    With vim how do I to turn this: t.string :crypted_password :null => false t.string :password_salt, :null => false into this: t.string :crypted_password, :null => false t.string :password_salt, :null => false without manually adding the spaces to each line?

    Read the article

  • Line appears on paper each time HTML file is printed

    - by theshadeck
    My application builds and prints HTML reports using AxWebBrowser.ExecWb method. Lately each time a report is printed a thin horizontal line is printed across it. It's not supposed to be there, it doesn't appear in any preview (Word, browser), but it's always there on the paper, always at the same absolute location and regardless of the printer type. Any ideas?

    Read the article

< Previous Page | 217 218 219 220 221 222 223 224 225 226 227 228  | Next Page >