Search Results

Search found 7740 results on 310 pages for 'split sound'.

Page 227/310 | < Previous Page | 223 224 225 226 227 228 229 230 231 232 233 234 | Next Page >

Splitting Nucleotide Sequences in JS with Regexp

- by TEmerson

I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

Read the article
Site works perfect in Mozilla but not in IE. Is my js file not compatible with IE

- by Bonkers

I'm working on a site written in PHP/MySQL. We have a form to reserve time on a calendar and it works great in Mozilla and stores the reservation to our database, but in IE you fill out the form and when you click the "Reserve" button to submit it and nothing happens. All I can think of is that my javascript is not working with IE. I have these lines in my .js file: resLenT = document.getElementById(resLenElem); resLenI = resLenT.selectedIndex; resLen = resLenI + 1; where resLenElem is a drop-down box. These are the only lines that I can think of at the moment that might be causing trouble in IE. Does this all sound like I'm on the right track or am I way off base?

Read the article
Change URL of a saved HTML file

- by Paul Camilleri

I am new to HTML so this question might sound a bit lame. Anyways I have a saved webpage on my desktop that when i open it in google chrome i want it to show a specific URL instead of its current location. Any ideas how i might get this to work? I tried using the history.pushState but i have no idea why it is not working. I created a simple page for now to test it: <html> <head> <script> function setURL() { history.pushState("Test","page2", "www.test.com"); } </script> </head> <body> <button type="button" onclick="setURL()">Set Url</button> </body> </html> Any help would be greatly appreciated. Thank you

Read the article
How to Best Setup a Website Project in VS.NET

- by Jason

I have very little experience with setting up a website from scratch in a .NET environment. As I am doing this now, I am wondering - what's the best way to go? Is it better to create a new Website Project, and include the various backend services and database code as part of that project, or is it better to split out the various aspects of the project? If the second, how would I go about doing that? I want to ensure that this project is easy to manage in the future (in terms of source control, deployment, etc), so I want to make sure I'm starting off on the right foot. I was unable to find any tutorials online, but if you have any, I would appreciate those as well. Thanks!

Read the article
Show elipses where text will be truncated as per iTunes

- by Burt

I a building an application with a similar layout to iTunes i.e. it has a sidebar that doubles as a menu. Some of the text will exceed the boundary and rather that having it be truncated I would like to show ellipses (see line image below "Purchased on My iPh..."). How would I go about this in WPF? Suppose I made the boundary movable i.e. user can change the size of the panel (split panel in Windows Forms), how would I go about dynamically showing the ellipses/text? Thanks in advance, B

Read the article
how to query sqlite for certain rows, i.e. dividing it into pages (perl DBI)

- by user1380641

sorry for my noob question, I'm currently writing a perl web application with sqlite database behind it. I would like to be able to show in my app query results which might get thousands of rows - these should be split in pages - routing should be like /webapp/N - where N is the page number. what is the correct way to query the sqlite db using DBI, in order to fetch only the relavent rows. for instance, if I show 25 rows per page so I want to query the db for 1-25 rows in the first page, 26-50 in the second page etc.... Thanks in advanced!

Read the article
best practice for Jquery plugin implementation and resource locations

- by ptutt

This is probably a very basic question, but I seem to have issues plugging in jquery plug-ins. The issue seems to be around the location of the script, css and images and ensuring the css has the correct url to the images. The standard plug-in has the following folder structure (eg : JPicker) js css images My project is asp.net mvc so I have the default: scripts images content So, I try to split the jquery plugin to the appropriate folders (not sure if this is the best way?). Then I try to correct the references to images (background urls) in the css. I believe the url is relative to the page that is implementing the css file, not the location of the css file itself. Anyway, when I try the above, the plugins don't seem to work. I believe the issue lies with the images not being found. The jquery code runs without errors, so I assume that's not the problem. Any help/advice much appreciated

Read the article
Parse items from text file

- by chris

I have a text file that includes data inside {[]} tags. What would be the suggested way to parse that data so I can just use the data inside the tags? Example text file would look like this: 'this is a bunch of text that is not {[really]} useful in any {[way]}. I need to {[get]} some items {[from]} it.' I would like to end up with 'really', 'way', 'get', 'from' in a list. I guess I could use split to do it.. but seems like there might be a better way out there. I have seen a ton parsing libraries, is there one that would be perfect for what I want to do?

Read the article
Are Domain Specific Languages (DSL) bad for the Common Programmer?

- by iestyn

I have lately been delving into F# and the new DSL stuff as in the Microsoft SQL Server Modelling CTP, and have some concerns. Will this new idea that will come about be bad for skilled programmers? Is code going to be dumbed down? I know I sound like a luddite, but this does worry me, after spending years of time practising in my craft, and now might be scuttled by genius from within. I am afraid, very afraid. Will I be now trapped in a job that only programs against a DSL and therefore every job that I work on, I have to learn a whole new DSL based on top of a Framework (.net Java), that I will only be allowed to touch certain parts of. I don't think the world is ready for DSL, but the sales pitch is deafening!

Read the article
How to distribute the chance to display each SWF evenly among banner collection?

- by Michael Mao

Hi all: I am working on The ausdcf.org to try adding several banner ads in swf format to the top. Everything starts to work, but I've got several questions that need your help: The client chose not to go with Google AdManager, but prefer a "minimal approach" to do this task. What I am trying to do is sort of "mimicking" the way Google AdManager does for banners, that is, to split the chance of each particular swf to be shown to the visitor evenly among the banner collection. Definitely I can add some jQuery code to do this from client-side, a random number generator and if-else statement would work - just $.load() it! However, what if I'd like to make sure those disabled Javascript (is there any now btw?) still be able to see different swfs in each visit. Any suggestion on how to approach this? Many thanks in advance.

Read the article
Splitting a UL into three even lists

- by Andy

I am printing a menu using UL, the trouble is the order that is generated by my script is ignored because im printing the LI one after the other and they're spanning three across. So the order is 1 , 2 , 3 as opposed to 1 2 3 To counteract this i wanted to split my single UL into three that way the order would be maintained. Here is my code currently which works perfectly to print a single UL. //Category Drop Down Menu $this->CategoryDropDownMenu = '<ul id="subcatmenu">'; foreach($sitemap->CategoryMenu as $val) $this->CategoryDropDownMenu .= '<li><a href="'.$val[host].$val[link].'"><span>'.htmlspecialchars($val[title]).'</span></a></li>'; $this->CategoryDropDownMenu .= '</ul>';

Read the article
Length of text that can just fit into one screen without scrolling

- by KailZhang

I find some iphone book apps have such feature: One screen one page of text without scrolling. The text can just fit into the whole screen with linebreaks and indentations. I'm curious of how to implement this. How could I decide the length of text that just fit into the screen. And also, given the whole text, I can calculate out the number of pages. If this is not possible to be done on iPhone(runtime?), then is it possible to process the text before storing it in app? I mean I calculate how many pages I need(how to split the raw text), probably how many lines per page.

Read the article
eliminating noise/spikes

- by tgv

I have a measurement data with similar positive and negative values which should be like: ReqData=[0 0 -2 -2 -2 -2 -2 -2 0 0 0 -2 -2 -2 -2 0 0 2 2 2 2 2 2 0 0 2 2 2 2 2 0 0 2 2 2 2 2 0 0 2 2 2 0 0]' However, there are some measurement noises in the data - so the real data is like this: RealData=[0 0 -2 -2 -2 -2 -2 -2 0 0 0 -2 -2 -2 -2 0 0 2 2 2 2 -4 -1 0 0 2 2 2 2 -7 0 0 2 2 2 2 -1 0 0 2 2 2 0 0]' How do I remove the end noise from the RealData and convert it into ReqData using Matlab? How do I find the start and stop indexes of each set of positive or negative data and split them using Matlab? For instance, ansPositive = [3,8, 12, 15]' and ansNegative = [18, 23, 26, 30, 33, 37, 40, 42]'.

Read the article
Please suggest an e-commerce script for my existing website

- by munjal

I have a dating site based on osDate. I want to open a small gift store with items flowers and T-shirts. I have seen so many e-commerce store on google like : oscommerce, Magento, Prestashop, virtuemart. But I think they are quite big. Personally, I have sound knowledge of Magento. But Magento is too vast and heavy. Please suggest an small e-commerce script that I can integrate in my existing system. Thanks,

Read the article
MessageBox not shown when opened processing WM_CLOSE from taskbar thumbnail close button

- by Katana

Trying to put up a "Do you want to save"-dialog when trying to close window with close-button in taskbar thumbnail in windows 7(with aero peek active). Using MessageBox() when processing WM_CLOSE does not work. MessageBox won't show until you move mouse cursor outside thumbnail so aero peek is disabled. Lots of applications have this buggy behaviour so it's probably a design flaw in Windows 7, but for some programs it works (Word, Notepad, Visual Studio, ...), so I'm wondering what trick they are using(or what it takes to "exit" aero peek-mode programmatically). The small "Sound Recorder" application that comes with Windows 7 has the same problem (if you have recorded something without saving and try to close it using thumbnail close-button)...

Read the article
Outputting audio stream into microphone

- by Brap

Hey everyone. Is there a way of outputting audio from my program and redirecting that stream to the system's microphone input 'layer'? I understand this might require some low-level calls being 'Pinvoked', but are there any articles that might help me. For example, if I was to run the output audio stream of my application into Window's Sound Recorder program, it would think that the audio is coming from a microphone and thus record that. I don't want to record a stream, just output it to the device's micrphone input. Thanks for any ideas.

Read the article
iOS Display Different Image on Click

- by user1506841

Using XCode, I am trying to figure out how to display a different image when someone clicks or presses down on one of my buttons before being taken to a second screen. For example, I have a contact icon on my home screen. When a user clicks the icon, it should change to a darker version on tap before going to the contact screen. Any help is appreciated. -(IBAction) ButtonPressed :(id)sender { UIButton *tempButton = (UIButton *) sender; int tag = tempButton.tag; NSString *viewName; switch (tag) { case 1: [FlurryAnalytics logEvent:@"Contact-Screen"]; viewName = @"ContactScreen"; if( self.appDelegate.sound) [Click play]; [self.appDelegate moveToView:viewName]; break; } }

Read the article
regular expression match does not work

- by Carlos_Liu

I have a string ABCD:10,20,,40;1/1;1/2,1/3,1/4 I want to split the string into the following parts: ABCD -- splited by : 10,20,,40 -- splited by ; 1/1 1/2,1/3,1/4 Why the following regular expression does not work for me ? string txt = @"ABCD:10,20,,40;1/1;1/2,1/3,1/4"; Regex reg = new Regex(@"\b(?<test>\w+):(?<com>\w+);(?<p1>\w+);(?<p2>\w+)"); Match match = reg.Match(txt);

Read the article
In B-trees which element gets promoted when the node splits

- by Phenom

Let's say there is a B-tree of order 8. This means it can have 8 pointers and 7 elements. Say the letters A through G are stored in this B-tree. So this B-tree is just a single node containing 7 elements. Then you try to insert J into the tree. There's no room, so you have to split the node and create a new root node. Which element gets promoted up into the root node?

Read the article
Rename Files in Python

- by Jeff

Hi all, Im trying to rename some files in a directory using python. I've looked around the forums here, and because i'm a noob, I cant adapt what I need from what is out there. Say I have a file called CHEESE_CHEESE_TYPE.*** and want to remove "Cheese_" so my resulting filename would be "CHEESE_TYPE" Im trying to use the os.path.split but it's not working properly. I have also considered using string manipulations, but have not been successful with that either. Any help would be greatly appreciated. Thanks.

Read the article
c# FormatException was unhandled

- by poco

I'm parsing chat from a game and i get this string "?68 00 00 37 00 45 00 00" recipe = recipe.Replace("?", ""); string[] rElements = new string[8]; rElements = recipe.Split(' '); int num = int.Parse(rElements[0]); I get a Format exception on that last line that i don't understand. It says that input string is not in the right format. I have checked the debugger and the first element says it is "68". Anyone have any clue what is happening?

Read the article
foreach statement (get string values)

- by nhoyti

Can someone please help me out? My code for splitting the strings is working however, i still need to use the splitted string my page. How can i achieve this? Here's my current code private void SplitStrings() { List<string> listvalues = new List<string>(); listvalues = (List<string>)Session["mylist"]; string[] strvalues = listvalues.ToArray(); if (listvalues != null) { foreach (string strElement in listvalues) { string[] prods = strElement.ToString().Split("|".ToCharArray()); string prodName = prods[0].ToString(); Response.Write(prodName); } } } link text how can i replace the response.write with any label or literal? when i tried to use a literal on the code it displays one single string not all of the strings that's been splitted. any ideas?

Read the article
[Python] Best strategy for dealing with incomplete lines of data from a file.

- by adoran

I use the following block of code to read lines out of a file 'f' into a nested list: for data in f: clean_data = data.rstrip() data = clean_data.split('\t') t += [data[0]] strmat += [data[1:]] Sometimes, however, the data is incomplete and a row may look like this: ['955.159', '62.8168', '', '', '', '', '', '', '', '', '', '', '', '', '', '29', '30', '0', '0'] It puts a spanner in the works because I would like Python to implicitly cast my list as floats but the empty fields '' cause it to be cast as an array of strings (dtype: s12). I could start a second 'if' statement and convert all empty fields into NULL (since 0 is wrong in this instance) but I was unsure whether this was best. Is this the best strategy of dealing with incomplete data? Should I edit the stream or do it post-hoc?

Read the article
What statistics app should I use for my website?

- by Camran

I have my own server (with root access). I need statistics of users who visit my website etc etc... I have looked at an app called Webalyzer... Is this a good choice? I run apache2 on a Ubuntu 9 system... If you know of any good statistics apps for servers please let me know. And a follow-up question: All statistics are saved in log-files right? So how large would these log-files become then? Possibility to split them would be good, dont know if this is possible with Webalyzer though...

Read the article
How to get top/left x/y of image map with javascript / jquery?

- by jpea

Using jQuery's position() or offset(), I can't seeme to get the top/left coordinates of an image map area. It works in FF, but nothing else - no webkit, IE, Opera. $('area').bind("click",function(){ alert($(this).position().left); }); <area shape="rect" coords="14,25,205,150" href="#"> Anyone know of a different way to access these? Normally I would just take the coords and split(",") but there are a bunch of multi-faceted area's on these pages.

Read the article

< Previous Page | 223 224 225 226 227 228 229 230 231 232 233 234 | Next Page >