Search Results

Search found 7740 results on 310 pages for 'split sound'.

Page 226/310 | < Previous Page | 222 223 224 225 226 227 228 229 230 231 232 233  | Next Page >

• Modal forms get in the way of processing

  - by Botax

  I’m working on an interface in VB6 to interact with a sound editor to automate certain tasks mainly using the editor’s object handles and activating them through SendMessage/PostMessage. In general it works OK, except that the editor has some dialog boxes that open in modal mode and freeze everything on the interface, including the timers. Is there a practical way to get these dialog boxes to open modeless or to interact with them from the interface after they pop up? I tried an MDI form, but it also freezes along with everything else. The only way to override the modal mode of these boxes is to launch an independent applet beforehand to address the dialog boxes with a timer, but the process is somewhat cumbersome. All I need to do with the dialog boxes is click the OK button or hit the return key.

  Read the article

• Eclipse plugin to measure programmer performance/stats

  - by trenki

  Does anyone know of an Eclipse plugin that can give me some stats about my behavior/usage of the Eclipse IDE? There are quite a few things I would like to know: How often/when do I invoke the "Build All" command (through Ctrl+B) How often does compilation fail/succeed (+ number of errors/warnings) How often do I hit Backspace? (I do that way to often; If pressing that key would give a nasty sound I would in time learn to type correctly in the first place) How many characters/lines of code that I typed do I delete (possibly quite immediately) How (effective/efficient/...) is my Mouse/Keyboard/IDE usage? (Kinda like measuring APM in StarCraft; this could be fun) If there is no such Eclipse plugin around, how complex and time consuming would It be to write a plugin that can accomplish the above?

  Read the article

• How can I format numbers as money in JavaScript?

  - by Daniel Magliola

  I would like to format a price in JavaScript. Basically, I have a float variable, and I'd like to have a function that will receive that variable, and output: "$ 2,500.00" What's the best way to do this? EDIT: OK, since I haven't gotten any answers better than the code I implemented, plus my own answer has been voted down and I can't put my own answer as the right one... Here it is... var DecimalSeparator = Number("1.2").toLocaleString().substr(1,1); var AmountWithCommas = Amount.toLocaleString(); var arParts = String(AmountWithCommas).split(DecimalSeparator); var intPart = arParts[0]; var decPart = (arParts.length > 1 ? arParts[1] : ''); decPart = (decPart + '00').substr(0,2); return '£ ' + intPart + DecimalSeparator + decPart;

  Read the article

• Best way to get photoshop to optimise 35 related pictures for fast transmission

  - by thenerd

  I have 35 pictures taken from a stationary camera aimed at a lightbox in which an object is placed, rotated at 10 degrees in each picture. If I cycle through the pictures quickly, the image looks like it is rotating. If I wished to 'rotate' the object in a browser but wanted to transmit as little data as possible for this, I thought it might be a good idea to split the picture into 36 pictures, where 1 picture is any background the images have in common, and 35 pictures minus the background, just showing the things that have changed. Do you think this approach will work? Is there a better route? How would I achieve this in photoshop?

  Read the article

• textarea into array javascript

  - by user281180

  myList contains the following values: value1 value2 value3 function showArray() { var txt = $("#myList").text(); var textread = txt.split('\n'); var msg = ""; for (var i = 0; i < textread .length; i++) { msg += i + ": " + textread [i] + "\n"; } alert(msg); } my alert gives me the following: 0:value1 value2 value3 It`s not what I wanted and expecting, I was expecting something like: 0: value1 1: value2 2: value3 How can I get the values as expected?

  Read the article

• MS Access Crashed an now all Form objects and code modules are missing

  - by owlie

  I was adding a form to our Access 07 db. I copied an existing form to use as a template, renamed it, and saved it. I opened a different form to check something and Access crashed. When I reopened the database it says: "Access has detected that this database is in an inconsistent state, and will attempt to recover the database." etc. When it reopened - all forms and reports were missing. Saved queries remain. The error message states that object recovery failures will be noted in a Recovery Errors table - but this table wasn't created. The links to the be database remained intact. The database is split - I was experimenting with a form on a front-end copy which might have something to do with it. Any ideas what would cause this (I can see loosing recent work - but nixing all form objects?!) And is there any chance of recovery?

  Read the article

• Distributing requests to Selenium Grid RC's?

  - by intervigil

  I've got a situation here where I have a central selenium grid hub, and several RC's running on my gogrid account. When I access it to run tests, it basically queues all the incoming test requests and executes them serially on only one of the RC's, instead of spreading them out to use available RC's. The tests come from multiple projects, so I'm not looking to parallelize the tests themselves, just to split the requests that come from multiple projects across the multiple RC's. From everything I've read, it seems like selenium grid should be doing this already, yet I only see one RC used to run every single test. Is there something I'm missing?

  Read the article

• python: creating a list inside a dictionary

  - by user1871081

  I just started using python and I'm trying to create a program that will read a file that looks like this: AAA x 111 AAB x 111 AAA x 112 AAC x 123 ... the file is 50 lines long and I'm trying to make the letters into keys in a dictionary and the numbers lists that correspond with the keys. I want the output to look like this: {AAA: ['111', '112'], AAB: ['111'], AAC: [123], ...} This is what I've tried file = open("filename.txt", "r") readline = file.readline().rstrip() while readline!= "": list = [] list = readline.split(" ") j = list.index("x") k = list[0:j] v = list[p + 1:] d = {} if k in d == False d[k] = [] d[k].append(v) else d[k].append(v) readline = file.readline().rstrip() I keep getting syntax errors on my if statement and I can't figure out what I've done wrong.

  Read the article

• Voices disappear when using headphones. [closed]

  - by James

  How do I declare a variable in C? P.S. I have a pair of SteelSeries Siberia headphones. I've noticed that when watching some films the voices are completely silent, yet when I unplug the headset and listen through my speakers they are there and sound normal. I have no other software that could be interfering with it and it happens regardless of the software I use for playback (I've tried VLC, WMP and Quicktime). It is so strange, and it almost sounds deliberate - the rest of the audio is untouched but voices disappear. The films only have single audio tracks, and it doesn't happen with every film. Can anyone give me any hints as to what could possibly cause this? I am stumped!

  Read the article

• Problem in appending a string to a already filled string builder(at the beginning by using INSERT) a

  - by Newbie

  I have a string builder like StringBuilder sb = new StringBuilder("Value1"); sb.AppendLine("Value2"); Now I have a string say string str = "value 0"; I did sb.Insert(0,str); and then string[] strArr = sb.ToString().Trim().Replace("\r", string.Empty).Split('\n'); The result I am getting as (Array size of 2 where I should get 3) [0] value 0 Value1 [1] value2 But the desired output being [0] Value 0 [1] Value1 [2] Value2 Where I am going wrong? I am using C#3.0 Please help.. It 's urgent Thanks

  Read the article

• How do I get artifacts from one Maven module included in the resources of another in my build?

  - by Hanno Fietz

  I have Maven modules that produce a Flex application as an SWF file. I want to include that file in a web application that is made with another Maven module from the same build. I'm wondering how and at which lifecycle phase I get Maven to grab the artifact from the other module and put it insode the appropriate folder of the webapp module. Would I use a separate assembly module? The web app is running on a Jetty server in an OSGi environment (using Pax), the server side of the web app uses Struts. The final artifact as I see it would be a WAR file including my Action etc classes, JSP templates, static contents such as CSS or JS, and the SWF movies. I might be better off with these split over some other setup, but right now, I wouldn't know which.

  Read the article

• How to run a module

  - by Jimmy

  I have a module file containing the following functions: def replace(filename): match = re.sub(r'[^\s^\w]risk', 'risk', filename) return match def count_words(newstring): from collections import defaultdict word_dict=defaultdict(int) for line in newstring: words=line.lower().split() for word in words: word_dict[word]+=1 for word in word_dict: if'risk'==word: return word, word_dict[word] when I do this in IDLE: >>> mylist = open('C:\\Users\\ahn_133\\Desktop\\Python Project\\test10.txt').read() >>> newstrings=replace(mylist) ### This works fine. >>> newone=count_words(newstrings) ### This leads to the following error. I get the following error: Traceback (most recent call last): File "<pyshell#134>", line 1, in <module> newPH = replace(newPassage) File "C:\Users\ahn_133\Desktop\Python Project\text_modules.py", line 56, in replace match = re.sub(r'[^\s^\w]risk', 'risk', filename) File "C:\Python27\lib\re.py", line 151, in sub return _compile(pattern, flags).sub(repl, string, count) TypeError: expected string or buffer Is there anyway to run both functions without saving newstrings into a file, opening it using readlines(), and then running count_words function?

  Read the article

• can list be converted into string

  - by PARIJAT

  Actually i have extracted some data from the file and want to write it in the file 2 but the program says 'sequence item 1: expected string, list found', I want to know how i can convert buffer[] ie string into sequence, so that it could be saved in file 2...I am new to the python please help* file = open('/ddfs/user/data/k/ktrip_01/hmm.txt','r') file2 = open('/ddfs/user/data/k/ktrip_01/hmm_write.txt','w') buffer = [] rec = file.readlines() for line in rec : field = line.split() print '>',field[0] term = field[0] buffer.append(term) print field[1], field[2], field[6], field[12] term1 = field [1] buffer.append(term1) term2 = field[2] buffer.append[term2] term3 = field[6] buffer.append[term3] term4 = field[12] buffer.append[term4] file2.write(buffer) file.close() file2.close()

  Read the article

• couchdb: one database per account vs all in one database w. a namespace / property

  - by thruflo

  I'm modelling a document generation system in couchdb. It semi-automates the production of proposal and presentation documents from managable document fragments. Much like, say, Basecamp, it breaks down very simply into self-contained data per 'account'. Each account has multiple users, projects, documents, etc. However, nothing should be shared between accounts. I can see two ways of doing this: one couchdb database per account use a namespace / property to identify the account It seems to me that the first approach is conceptually sound and potentially has security and partitioning advantages. However, it seems to me to restrict some cross-database data querying (that I don't have a use case for now but you never know...) and to make updating views potentially require an awful lot of writes. Does anyone experienced with this kind of decision have any advice?

  Read the article

• Is it acceptable to design my GLSurfaceView as a main control class?

  - by Omega

  I'm trying to structure a game I'm making in Android so that I have a sound, flexible design. Right now I'm looking at where I can tie my games rules engine and graphics engine together and what should be in between them. At a glance, I've been eying my implementation of GLSurfaceView, where various screen events are captured. My rationale would be to create an instance of my game engine and graphics engine here and receive events and state changes to trigger updates of either where applicable. Further to this, in the future, the GLSurfaceView implementation could also store stubs for players during a network game and implementations of computer opponents and dispatch them appropriately. Does this seem like a sensible design? Are there any kinds of improvements I can make? Thanks for any input!

  Read the article

• Strange python error

  - by Werner

  Hi, I am trying to write a python program that calculates a histogram, given a list of numbers like: 1 3 2 3 4 5 3.2 4 2 2 so the input parameters are the filename and the number of intervals. The program code is: #!/usr/bin/env python import os, sys, re, string, array, math import numpy Lista = [] db = sys.argv[1] db_file = open(db,"r") ic=0 nintervals= int(sys.argv[2]) while 1: line = db_file.readline() if not line: break ll=string.split(line) #print ll[6] Lista.insert(ic,float(ll[0])) ic=ic+1 lmin=min(Lista) print "min= ",lmin lmax=max(Lista) print "max= ",lmax width=666.666 width=(lmax-lmin)/nintervals print "width= ",width nelements=len(Lista) print "nelements= ",nelements print " " Histogram = numpy.zeros(shape=(nintervals)) for item in Lista: #print item int_number = 1 + int((item-lmin)/width) print " " print "item,lmin= ",item,lmin print "(item-lmin)/width= ",(item-lmin)," / ",width," ====== ",(float(item)-float(lmin))/float(width) print "int((item-lmin)/width)= ",int((item-lmin)/width) print item , " belongs to interval ", int_number, " which is from ", lmin+width*(int_number-1), " to ",lmin+width*int_number Histogram[int_number] = Histogram[int_number] + 1 4 but somehow I am completely lost, I get strange errors, can anybody help¿ Thanks

  Read the article

• What is the best way to partition large tables in SQL Server?

  - by RyanFetz

  In a recent project the "lead" developer designed a database schema where "larger" tables would be split across two seperate databases with a view on the main database which unioned the two seperate database-tables together. The main database is what the application was driven off of so these tables looked and felt like ordinary tables (except some quirkly things around updating). This seemed like a HUGE performance problem. We do see problems with performance around these tables but nothing to make him change his mind about his design. Just wondering what is the best way to do this, or if it is even worth doing?

  Read the article

• How can I optimize this code?

  - by loop0

  Hi, I'm developing a logger daemon to squid to grab the logs on a mongodb database. But I'm experiencing too much cpu utilization. How can I optimize this code? from sys import stdin from pymongo import Connection connection = Connection() db = connection.squid logs = db.logs buffer = [] a = 'timestamp' b = 'resp_time' c = 'src_ip' d = 'cache_status' e = 'reply_size' f = 'req_method' g = 'req_url' h = 'username' i = 'dst_ip' j = 'mime_type' L = 'L' while True: l = stdin.readline() if l[0] == L: l = l[1:].split() buffer.append({ a: float(l[0]), b: int(l[1]), c: l[2], d: l[3], e: int(l[4]), f: l[5], g: l[6], h: l[7], i: l[8], j: l[9] } ) if len(buffer) == 1000: logs.insert(buffer) buffer = [] if not l: break connection.disconnect()

  Read the article

• Normalizing Strings using Regexes

  - by RasputinJones

  How do I match this string "1 & 2" from this string "Foo Bar 1 & 2"? How do I match this string "1, 2 & 3" from this string "Foo Baz 1, 2 & 3"? Trying to split out "Foo Bar" from the string using regexes while using the presence of "1 & 2" or "1, 2 & 3" as conditionals to normalize these strings into "Foo Bar 1" and "Foo Bar 2" or "Foo Baz 1", "Foo Baz 2" and "Foo Baz 3" respectively.

  Read the article

• Site works perfect in Mozilla but not in IE. Is my js file not compatible with IE

  - by Bonkers

  I'm working on a site written in PHP/MySQL. We have a form to reserve time on a calendar and it works great in Mozilla and stores the reservation to our database, but in IE you fill out the form and when you click the "Reserve" button to submit it and nothing happens. All I can think of is that my javascript is not working with IE. I have these lines in my .js file: resLenT = document.getElementById(resLenElem); resLenI = resLenT.selectedIndex; resLen = resLenI + 1; where resLenElem is a drop-down box. These are the only lines that I can think of at the moment that might be causing trouble in IE. Does this all sound like I'm on the right track or am I way off base?

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• problem in extracting the data from text file

  - by parijat24

  hello , i am new to python , and I want to extract the data from this format FBpp0143497 5 151 5 157 PF00339.22 Arrestin_N Domain 1 135 149 83.4 1.1e-23 1 CL0135 FBpp0143497 183 323 183 324 PF02752.15 Arrestin_C Domain 1 137 138 58.5 6e-16 1 CL0135 FBpp0131987 60 280 51 280 PF00089.19 Trypsin Domain 14 219 219 127.7 3.7e-37 1 CL0124 to this format FBpp0143497 5 151 Arrestin_N 1.1e-23 FBpp0143497 183 323 Arrestin_C 6e-16 I have written code in hope that it works but it does not work , please help! file = open('/ddfs/user/data/k/ktrip_01/hmm.txt','r') rec = file.read() for line in rec : field = line.split("\t") print field print field[:] print '>',field[0] print field[1], field[2], field[6], field[12] the hmmtext file is FBpp0143497 5 151 5 157 PF00339.22 Arrestin_N Domain 1 135 149 83.4 1.1e-23 1 CL0135 FBpp0143497 183 323 183 324 PF02752.15 Arrestin_C Domain 1 137 138 58.5 6e-16 1 CL0135 FBpp0131987 60 280 51 280 PF00089.19 Trypsin Domain 14 219 219 127.7 3.7e-37 1 CL0124

  Read the article

• How to Best Setup a Website Project in VS.NET

  - by Jason

  I have very little experience with setting up a website from scratch in a .NET environment. As I am doing this now, I am wondering - what's the best way to go? Is it better to create a new Website Project, and include the various backend services and database code as part of that project, or is it better to split out the various aspects of the project? If the second, how would I go about doing that? I want to ensure that this project is easy to manage in the future (in terms of source control, deployment, etc), so I want to make sure I'm starting off on the right foot. I was unable to find any tutorials online, but if you have any, I would appreciate those as well. Thanks!

  Read the article

• best practice for Jquery plugin implementation and resource locations

  - by ptutt

  This is probably a very basic question, but I seem to have issues plugging in jquery plug-ins. The issue seems to be around the location of the script, css and images and ensuring the css has the correct url to the images. The standard plug-in has the following folder structure (eg : JPicker) js css images My project is asp.net mvc so I have the default: scripts images content So, I try to split the jquery plugin to the appropriate folders (not sure if this is the best way?). Then I try to correct the references to images (background urls) in the css. I believe the url is relative to the page that is implementing the css file, not the location of the css file itself. Anyway, when I try the above, the plugins don't seem to work. I believe the issue lies with the images not being found. The jquery code runs without errors, so I assume that's not the problem. Any help/advice much appreciated

  Read the article

• GWT: how to have different styles for splitters in different SplitLayoutPanels?

  - by user26270

  I know you can change the styles of the splitters with the defaults styles listed in the docs: .gwt-SplitLayoutPanel .gwt-SplitLayoutPanel-HDragger { horizontal dragger } .gwt-SplitLayoutPanel .gwt-SplitLayoutPanel-VDragger { vertical dragger } and we've done that in earlier development. However, now I'm developing new stuff and would like to use a different style for the splitters in a new SplitLayoutPanel. Unfortunately, we haven't or can't split the app into different modules, which might make this easier. I tried creating a new style and applying it to my new SplitLayoutPanel, but it didn't appear to have any effect on the splitters. I thought there might be a method to get a handle on the splitters in order to apply the new style to only them, but I didn't find any such method.

  Read the article

< Previous Page | 222 223 224 225 226 227 228 229 230 231 232 233  | Next Page >