Search Results

Search found 48586 results on 1944 pages for 'page performance'.

Page 245/1944 | < Previous Page | 241 242 243 244 245 246 247 248 249 250 251 252  | Next Page >

  • Stopping cookies being set from a domain (aka "cookieless domain") to increase site performance

    - by Django Reinhardt
    I was reading in Google's documentation about improving site speed. One of their recommendations is serving static content (images, css, js, etc.) from a "cookieless domain": Static content, such as images, JS and CSS files, don't need to be accompanied by cookies, as there is no user interaction with these resources. You can decrease request latency by serving static resources from a domain that doesn't serve cookies. Google then says that the best way to do this is to buy a new domain and set it to point to your current one: To reserve a cookieless domain for serving static content, register a new domain name and configure your DNS database with a CNAME record that points the new domain to your existing domain A record. Configure your web server to serve static resources from the new domain, and do not allow any cookies to be set anywhere on this domain. In your web pages, reference the domain name in the URLs for the static resources. This is pretty straight forward stuff, except for the bit where it says to "configure your web server to serve static resources from the new domain, and do not allow any cookies to be set anywhere on this domain". From what I've read, there's no setting in IIS that allows you to say "serve static resources", so how do I prevent ASP.NET from setting cookies on this new domain? At present, even if I'm just requesting a .jpg from the new domain, it sets a cookie on my browser, even though our application's cookies are set to our old domain. For example, ASP.NET sets an ".ASPXANONYMOUS" cookie that (as far as I'm aware) we're not telling it to do. Apologies if this is a real newb question, I'm new at this! Thanks.

    Read the article

  • Multiple ASP.Net Controls On One Page

    - by Duracell
    We have created a User Control for ASP.Net. At any one time, a user's profile page could contain between one and infinity of these controls. The Control.ascx file contains quite a bit of javascript. When the control is rendered by .Net to HTML, you notice that it prints the javascript for each control. This was expected. I'd like to reduce the amount of HTML output by the server to increase page load times. Normally, you could just move the javascript to an external file and then you only need one extra HTTP request which will serve for all controls. But what about instances in the javascript where we have something like document.getElementById('<%= txtTextBox.ClientID %'); How would the javascript know which user control work with? Has anyone done something like this, or is the solution staring me in the face?

    Read the article

  • Page doesn't post to the given URL

    - by Sri Kumar
    Hello All, I have the following HTML content. When i click the button, the page doesn't post to URL provided in action tag. The corresponding application is running, but still the page load of the CrossPage.aspx was not invoked. What could be the problem? <body> <form id="UploadForm" method="post" enctype="multipart/form-data" action="http://localhost:2518/Web/CrossPage.aspx"> <div> <input type="file" id="BtnUpload" /> <input type="button" id="BtnSubmit" value="Submit" /> </div> </form> </body>

    Read the article

  • Disable page redirects using Greasemonkey

    - by Tomer Cohen
    A website I wish to tweak is using window.location in order to redirect specific users to a blocking page. That website is doing it in plain <script> tag, so it is impossible to bypass it by overriding the onload event using document.body.setAttribute('onload','');. Is there another way to inject my code to the page without using Firefox extensions such as NoScript? <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <title></title> <script type="text/javascript"> if (1) window.location="http://example.net" </script> </head> <body></body> </html>

    Read the article

  • How to test my GAE site for performance

    - by Sergey Basharov
    I am building a GAE site that uses AJAX/JSON for almost all its tasks including building the UI elements, all interactions and client-server requests. What is a good way to test it for highloads so that I could have some statistics about how much resources 1000 average users per some period of time would take. I think I can create some Python functions for this purpose. What can you advise? Thanks.

    Read the article

  • Pagebreak (or table break?) to obtain a good formated PDF

    - by iker
    Hi! I had develop an intranet on CakePHP witch in one part generates a custom PDF using DOMPDF. The problem is that i have a memo field (mysql text) witch i print after getting the result from PHP nl2br function. The problems is that in some ocasions, this text is too long (even on font-size: 6px) and i need some way to make a page break (get again de header, and footer etc)... or maybe a nice way to get a second column to continue with the text inside. any ideas? thanks so much

    Read the article

  • Performance implications of finalizers on JVM

    - by Alexey Romanov
    According to this post, in .Net, Finalizers are actually even worse than that. Besides that they run late (which is indeed a serious problem for many kinds of resources), they are also less powerful because they can only perform a subset of the operations allowed in a destructor (e.g., a finalizer cannot reliably use other objects, whereas a destructor can), and even when writing in that subset finalizers are extremely difficult to write correctly. And collecting finalizable objects is expensive: Each finalizable object, and the potentially huge graph of objects reachable from it, is promoted to the next GC generation, which makes it more expensive to collect by some large multiple. Does this also apply to JVMs in general and to HotSpot in particular?

    Read the article

  • LINQ Joins - Performance

    - by Meiscooldude
    I am curious on how exactly LINQ (not LINQ to SQL) is performing is joins behind the scenes in relation to how Sql Server performs joins. Sql Server before executing a query, generates an Execution Plan. The Execution Plan is basically an Expression Tree on what it believes is the best way to execute the query. Each node provides information on whether to do a Sort, Scan, Select, Join, ect. On a 'Join' node in our execution plan, we can see three possible algorithms; Hash Join, Merge Join, and Nested Loops Join. Sql Server will choose which algorithm to for each Join operation based on expected number of rows in Inner and Outer tables, what type of join we are doing (some algorithms don't support all types of joins), whether we need data ordered, and probably many other factors. Join Algorithms: Nested Loop Join: Best for small inputs, can be optimized with ordered inner table. Merge Join: Best for medium to large inputs sorted inputs, or an output that needs to be ordered. Hash Join: Best for medium to large inputs, can be parallelized to scale linearly. LINQ Query: DataTable firstTable, secondTable; ... var rows = from firstRow in firstTable.AsEnumerable () join secondRow in secondTable.AsEnumerable () on firstRow.Field<object> (randomObject.Property) equals secondRow.Field<object> (randomObject.Property) select new {firstRow, secondRow}; SQL Query: SELECT * FROM firstTable fT INNER JOIN secondTable sT ON fT.Property = sT.Property Sql Server might use a Nested Loop Join if it knows there are a small number of rows from each table, a merge join if it knows one of the tables has an index, and Hash join if it knows there are a lot of rows on either table and neither has an index. Does Linq choose its algorithm for joins? or does it always use one?

    Read the article

  • Dynamically get image URL from Imgur page link

    - by Jleagle
    I am trying to put some images on my website that are hosted on Imgur but i only have the link to the Imgur page, not the actual image URL. For example, on this album the URL I am trying to get is this: http://i.imgur.com/csb9Q.jpg (I only need the first image) I have noticed that when the page only has one image, the image file name is the same as the URL address, for example: http://imgur.com/sYlGa & http://i.imgur.com/sYlGa.jpg So this isnt a problem. But for pages with multiple images, this is not the case so how can i get the image URL?

    Read the article

  • Tabcontainer in Master Page not working as expected

    - by henrico
    Isn't TABCONTAINER supposed to be used in a MASTERPAGE? I started building my application in a single .aspx page with a tabcontainer to separate the different features in the application. My idea was to later break it up into individual pages with less code in each of them. I thought the use of a masterpage would be the perfect solutions... of course, this didn't work as expected. The problem is that all tabs, except the one related to the page loaded, for example tab1.aspx, are empty. If tab2.aspx is loaded, only tab2 is filled and so on. Is this a known bug or by design?

    Read the article

  • How to specify physical path in ASPX page?

    - by salvationishere
    I am developing a C# VS 2008 / SQL Server 2008 ASP.NET Web Applications project. In one of my ASPX files I am trying to reference the Master file, which is actually located in the parent website. In other words, when I open the parent website, I see this project listed. But when I open this project separately, I do not see parent website and this project is the root. So now how do I use the Master file from the parent website? Currently, I have in my ASPX file: <%@ Page Language="C#" MasterPageFile="~/Site.Master" AutoEventWireup="true" CodeFile="EnhancedCreateUserWizard.aspx.cs" Inherits="Membership_EnhancedCreateUserWizard" Title="Untitled Page" %> But this won't work because it is a virtual path and since this project is the root, I can't access the Master file virtually. Instead I want to specify physical path. How accomplish I do this?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Taking web page screen shot in Windows 8 Metro app

    - by Megan
    I'm trying to take screen shot of web page in Windows 8 Metro app. So far the only helpful control is the WebView. Unfortunately it does not contain any method like DrawToBitmap (known from Forms WebBrowser control). Am I missing something? Different approach would focus on injecting some JS (e.g. html2canvas) to page rendered in WebView but I don't think it is possible due to security reasons. I would greatly appreciate any help.

    Read the article

  • Comparing Page.User.Identity.Name to value in sql Table

    - by Peggy Fusselman
    First, I am SO sorry if the answer is out there. I've looked and looked and feel this is such a simple thing that it should be obvious. I'm wanting to make sure only the person who added an event can modify it. Simple! I already have a datasource that has event_added_by as a data point. It is populating a FormView. SelectCommand="SELECT * FROM [tbl_events] WHERE ([event_ID] = @event_ID)" And I have Page.User.Identity.Name. How do I compare the two? I can't pull the value from the label in the FormView so I need to find another way. if (!IsPostBack) { string uname = Page.User.Identity.Name; string owner = ""// this is where I need to grab the value from dsEvents; if (uname != owner) { //Send them somewhere saying they're not allowed to be here } } TIA for any help!

    Read the article

  • Have parameters in Dao methods to get entities the most efficient way for read-only access

    - by Blankman
    Allot of my use of hibernate, at least for that data that is presented on many parts of the web application, is for read-only purposes. I want to add some parameters to my Dao methods so I can modify the way hibernate pulls the data and how it handles transactions etc. Example usage: Data on the front page of my website is displayed to the users, it is read-only, so I want to avoid any session/entity tracking that hibernate usually does. This is data that is read-only, will not be changed in this transaction, etc. What would be the most performant way to pull the data? (the code below is c#/nhibernate, I'm implementing this in java as I learn it) public IList<Article> GetArticles() { return Session.CreateCriteria(typeof(Article)) // some where cluase }

    Read the article

  • Performance improvement of client server system

    - by Tanuj
    I have a legacy client server system where the server maintains a record of some data stored in a sqlite database. The data is related to monitoring access patterns of files stored on the server. The client application is basically a remote viewer of the data. When the client is launched, it connects to the server and gets the data from the server to display in a grid view. The data gets updated in real time on the server and the view in the client automatically gets refreshed. There are two problems with the current implementation: When the database gets too big, it takes a lot of time to load the client. What are the best ways to deal with this. One option is to maintain a cache at the client side. How to best implement a cache ? How can the server maintain a diff so that it only sends the diff during the refresh cycle. There can be multiple clients and each client needs to display the latest data available on the server. The server is a windows service daemon. Both the client and the server are implemented in C#

    Read the article

  • Parent Page becomes ‘frozen’ in Safari after commandLink with target=“_blank” is pressed in JSF 1.2

    - by Pushkar
    On my webpage when i press command link its opening a new page perfectly on IE7/Firefox 3/Chrome/Safari 4.0.4 but after this none of the parent page's command buttons are not working ,this happens only in safari.I am using JSF 1.2 mojara. Following is the my command link code: <h:commandLink onclick="submitPrint('selectedAttributes',criteriaGrid,clauseGrid)" action="#{reportBacking.print}" target="_blank"></h:commandLink> I have seen several fourms regarding this problem but they are suggesting the use of new mojara version which solves the some famous javascript problem document.forms Vs document.getElementByID().but my final javascript is fine (its using document.getElementById thing).

    Read the article

  • application that copies all links in a web page

    - by user23950
    I have to download something and those 100+ links to megaupload are all in the same webpage. Do you know of a better way of copying those links instead of copy and pasting them one by one? So that it will accumulate all the links, or portion of the links that I want to get and copy it all in the clipboard then just paste it on the download manager. For windows xp or 7

    Read the article

  • Improve performance writing 10 million records to text file using windows service

    - by user1039583
    I'm fetching more than 10 millions of records from database and writing to a text file. It takes hours of time to complete this operation. Is there any option to use TPL features here? It would be great if someone could get me started implementing this with the TPL. using (FileStream fStream = new FileStream("d:\\file.txt", FileMode.OpenOrCreate, FileAccess.ReadWrite)) { BufferedStream bStream = new BufferedStream(fStream); TextWriter writer = new StreamWriter(bStream); for (int i = 0; i < 100000000; i++) { writer.WriteLine(i); } bStream.Flush(); writer.Flush(); // empty buffer; fStream.Flush(); }

    Read the article

  • asp.net report generation - page cannot be diplayed

    - by user438640
    I have a asp.net application which generates reports.When the user clicks on generate report, the report is generated in the background and link to that report is written on the UI. There is no problem with the application as many of them are able to generate the reports successfully. However few users are facing issue is generating reports.The issue is, "When they click on generate report button, the report is being generated but before getting the link to the report,users are getting "page cannot be displayed" page" "And for few of them it occurs only in IE and not in mozila" Please help me in resolving this issue. Thanks in advance

    Read the article

  • Architecture of a single-page JavaScript web application?

    - by fig-gnuton
    How should a complex single-page JS web application be structured on the client-side? Specifically I'm curious about how to cleanly structure the application in terms of its model objects, UI components, any controllers, and objects handling server persistence. MVC seemed like a fit at first. But with UI components nested at various depths (each with their own way of acting on/reacting to model data, and each generating events which they themselves may or may not handle directly), it doesn't seem like MVC can be cleanly applied. (But please correct me if that's not the case.) -- (This question resulted in two suggestions of using ajax, which is obviously needed for anything other than the most trivial one-page app.)

    Read the article

  • How is the Trac Project List page customised?

    - by Completenutter2
    We've been using Trac for a while now for our developers only. However we are now opening it up for our (internal) clients. We have a project listing page (based on the default one that comes with Trac). What we'd like to do, is display more information about the project than what is currently available. I have searched google and here, to see if I can find how to get more information. There seems to be a variable called $project which has .name, .description and .href as attributes. Is there somewhere, a list of the attributes available? Or perhaps a different solution altogether that will allow us to display more information on the project list page. Such as the number of open tickets etc.

    Read the article

< Previous Page | 241 242 243 244 245 246 247 248 249 250 251 252  | Next Page >