Search Results

Search found 7529 results on 302 pages for 'replace'.

Page 245/302 | < Previous Page | 241 242 243 244 245 246 247 248 249 250 251 252  | Next Page >

  • Wrapper Classes for Backward compatibility in Java

    - by Casebash
    There is an interesting article here on maintaing backwards compatibility for Java. In the wrapper class section, I can't actually understand what the wrapper class accomplishes. In the following code from MyApp, WrapNewClass.checkAvailable() could be replaced by Class.forName("NewClass"). static { try { WrapNewClass.checkAvailable(); mNewClassAvailable = true; } catch (Throwable ex) { mNewClassAvailable = false; } } Consider when NewClass is unavailable. In the code where we use the wrapper (see below), all we have done is replace a class that doesn't exist, with one that exists, but which can't be compiled as it uses a class that doesn't exist. public void diddle() { if (mNewClassAvailable) { WrapNewClass.setGlobalDiv(4); WrapNewClass wnc = new WrapNewClass(40); System.out.println("newer API is available - " + wnc.doStuff(10)); }else { System.out.println("newer API not available"); } } Can anyone explain why this makes a difference? I assume it has something to do with how Java compiles code - which I don't know much about.

    Read the article

  • Regular expression to match HTML table row ( <tr> ) NOT containing a specific value

    - by user1821136
    I'm using Notepad++ to clean up a long and messy HTML table. I'm trying to use regular expressions even if I'm a total noob. :) I need to remove all the table rows that doesn't contain a specific value (may I call that substring?). After having all the file contents unwrapped, I've been able to use the following regular expression to select, one by one, every table row with all its contents: <tr>.+?</tr> How can I improve the regular expression in order to select and replace only table rows containing, somewhere inside a part of them, that defined substring? I don't know if this does matter but the structure of every table row is the following (I've put there every HTML tag, the dots stand for standard content/values) <tr> <td> ... </td> <td> ... </td> <td> <a sfref="..." href="...">!! SUBSTRING I HAVE TO MATCH HERE !!</a> </td> <td> <img /> </td> <td> ... </td> <td> ... </td> <td> ... </td> <td> ... </td> </tr> Thanks in advance for your help!

    Read the article

  • Word wrap in multiline textbox after 35 characters

    - by Kanavi
    <asp:TextBox CssClass="txt" ID="TextBox1" runat="server" onkeyup="CountChars(this);" Rows="20" Columns="35" TextMode="MultiLine" Wrap="true"> </asp:TextBox> I need to implement word-wrapping in a multi-line textbox. I cannot allow users to write more then 35 chars a line. I am using the following code, which breaks at precisely the specified character on every line, cutting words in half. Can we fix this so that if there's not enough space left for a word on the current line, we move the whole word to the next line? function CountChars(ID) { var IntermediateText = ''; var FinalText = ''; var SubText = ''; var text = document.getElementById(ID.id).value; var lines = text.split("\n"); for (var i = 0; i < lines.length; i++) { IntermediateText = lines[i]; if (IntermediateText.length <= 50) { if (lines.length - 1 == i) FinalText += IntermediateText; else FinalText += IntermediateText + "\n"; } else { while (IntermediateText.length > 50) { SubText = IntermediateText.substring(0, 50); FinalText += SubText + "\n"; IntermediateText = IntermediateText.replace(SubText, ''); } if (IntermediateText != '') { if (lines.length - 1 == i) FinalText += IntermediateText; else FinalText += IntermediateText + "\n"; } } } document.getElementById(ID.id).value = FinalText; $('#' + ID.id).scrollTop($('#' + ID.id)[0].scrollHeight); } Edit - 1 I have to show total max 35 characters in line without specific word break and need to keep margin of two characters from the right. Again, the restriction should be for 35 characters but need space for total 37 (Just for the Visibility issue.)

    Read the article

  • Replacement for Hamachi for SVN access

    - by Piers
    My company has been using Hamachi to access our SVN repository for a number of years. We are a small yet widely distributed development team with each programmer in a different country working from home. The server is hosted by a non-techie in our central office. Hamachi is useful here since it has a GUI and supports remote management. This system worked well for a while, but recently I have moved to a country with poor internet speeds. Hamachi will no longer connect 99% of the time - instead I get a "Probing..." message that doesn't resolve. It's certain to be a latency issue, as the same laptop will connect without problems when I cross the border and connect using a different ISP with better speeds. So I really need to replace Hamachi with some other VPN/protocol that handles latency better. The techie managing the repository is not comfortable installing and configuring Apache or IIS, so it looks like HTTP is out. I tried to convince my boss to go for a web hosting company, but he doesn't trust a 3rd party with our source. Any other recommended options / experiences out there for accessing our SVN repos that would be as simple as Hamachi for setup; but be more tolerant of network latency issues?

    Read the article

  • What shall be the code in xaml which makes a particular image to act as a button?

    - by Abhi
    Dear all I am new to Silverlight. And i have to make a demo application where in designing is done by using Microsoft Expression Blend 2 and developing should be done using Visual Studio(c++). Now i am first trying to become familiar with xaml files. So i was trying to make a simple demo where in i have to create a button and that button should be replace with an png image. In order to do so i tried with the mentioned below example. But i was not able to see anything in the screen. <UserControl xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" x:Class="SilverlightApplication1.Page" Width="640" Height="480"> <Grid x:Name="LayoutRoot" Background="White"> <Button x:Name="LogoutButton" > <Button.Template> <ControlTemplate> <Image Source="SilverlightApplication1\bounce_photo.png" /> </ControlTemplate> </Button.Template> </Button> </Grid> Please let me know where i am wrong and what shall i do to obtain the result. With regards Abhineet Agarwal

    Read the article

  • Different standard streams per POSIX thread

    - by Roman Nikitchenko
    Is there any possibility to achieve different redirections for standard output like printf(3) for different POSIX thread? What about standard input? I have lot of code based on standard input/output and I only can separate this code into different POSIX thread, not process. Linux operation system, C standard library. I know I can refactor code to replace printf() to fprintf() and further in this style. But in this case I need to provide some kind of context which old code doesn't have. So doesn't anybody have better idea (look into code below)? #include <pthread.h> #include <stdio.h> void* different_thread(void*) { // Something to redirect standard output which doesn't affect main thread. // ... // printf() shall go to different stream. printf("subthread test\n"); return NULL; } int main() { pthread_t id; pthread_create(&id, NULL, different_thread, NULL); // In main thread things should be printed normally... printf("main thread test\n"); pthread_join(id, NULL); return 0; }

    Read the article

  • Changing where a resource is pulled during runtime?

    - by Brandon
    I have a website that goes out to multiple clients. Sometimes a client will insist on minor changes. For reasons beyond my control, I have to comply no matter how minor the request. Usually this isn't a problem, I would just create a client specific version of the user control or page and overwrite the default one during build time or make a configuration setting to handle it. Now that I am localizing the site, I'm curious about the best way to go about making minor wording changes. Lets say I have a resource file called Resources.resx that has 300 resources in it. It has a resource called Continue. English value is "Continue", the French value is "Continuez". Now one client, for whatever reason, wants it to say "Next" and "Après" and the others want to keep it the same. What is the best way to accomodate a request like this? (This is just a simple example). The only two ways I can think of is to Create another Resources.resx specific to the client, and replace the .dll during build time. Since I'd be completely replacing the dll, the new resource file would have to contain all 300 strings. The obvious problem being that I now have 2 resource files, each with 300 strings to maintain. Create a custom user control/page and change it to use a custom resource file. e.g. SignIn.ascx would be replaced during the build and it would pull its resources from ClientName.resx instead of Resources.resx. Are there any other things I could try? Is there any way to change it so that the application will always look in a ClientResources.resx file for the overridden values before actually look at the specified resource file?

    Read the article

  • Is it possible to refer to metadata of the target from within the target implementation in MSBuild?

    - by mark
    Dear ladies and sirs. My msbuild targets file contains the following section: <ItemGroup> <Targets Include="T1"> <Project>A\B.sln"</Project> <DependsOnTargets>The targets T1 depends on</DependsOnTargets> </Targets> <Targets Include="T2"> <Project>C\D.csproj"</Project> <DependsOnTargets>The targets T2 depends on</DependsOnTargets> </Targets> ... </ItemGroup> <Target Name="T1" DependsOnTargets="The targets T1 depends on"> <MSBuild Projects="A\B.sln" Properties="Configuration=$(Configuration)" /> </Target> <Target Name="T2" DependsOnTargets="The targets T2 depends on"> <MSBuild Projects="C\D.csproj" Properties="Configuration=$(Configuration)" /> </Target> As you can see, A\B.sln appears twice: As Project metadata of T1 in the ItemGroup section. In the Target statement itself passed to the MSBuild task. I am wondering whether I can remove the second instance and replace it with the reference to the Project metadata of the target, which name is given to the Target task? Exactly the same question is asked for the (Targets.DependsOnTargets) metadata. It is mentioned twice much like the %(Targets.Project) metadata. Thanks. EDIT: I should probably describe the constraints, which must be satisfied by the solution: I want to be able to build individual projects with ease. Today I can simply execute msbuild file.proj /t:T1 to build the T1 target and I wish to keep this ability. I wish to emphasize, that some projects depend on others, so the DependsOnTargets attribute is really necessary for them.

    Read the article

  • Which languages support class replacement?

    - by Alix
    Hi, I'm writing my master thesis, which deals with AOP in .NET, among other things, and I mention the lack of support for replacing classes at load time as an important factor in the fact that there are currently no .NET AOP frameworks that perform true dynamic weaving -- not without imposing the requirement that woven classes must extend ContextBoundObject or MarshalByRefObject or expose all their semantics on an interface. You can however do this in Java thanks to ClassFileTransformer: You extend ClassFileTransformer. You subscribe to the class load event. On class load, you rewrite the class and replace it. All this is very well, but my project director has asked me, quite in the last minute, to give him a list of languages that do / do not support class replacement. I really have no time to look for this now: I wouldn't feel comfortable just doing a superficial research and potentially putting erroneous information in my thesis. So I ask you, oh almighty programming community, can you help out? Of course, I'm not asking you to research this yourselves. Simply, if you know for sure that a particular language supports / doesn't support this, leave it as an answer. If you're not sure please don't forget to point it out. Thanks so much!

    Read the article

  • Calc_Anniversary Function with a Loop

    - by Rachel Ann Arndt
    Name: Calc_Anniversary Input: Pay_Date, Hire_Date, Termination_Date Output: "Y" if is the anniversary of the employee's Hire_Date, "N" if it is not, and "T" if he has been terminated before his anniversary. Description: Create local variables to hold the month and day of the employee's Date_of_Hire, Termination_Date, and of the processing date using the TO_CHAR function. First check to see if he was terminated before his anniversary. The anniversary could be on any day during the pay period, so there will be a loop to check all 14 days in the pay period to see if one was his anniversary. CREATE OR replace FUNCTION Calc_anniversary( incoming_anniversary_date IN VARCHAR2) RETURN BOOLEAN IS hiredate VARCHAR2(20); terminationdate VARCHAR(20); employeeid VARCHAR2(38); paydate NUMBER := 0; BEGIN SELECT Count(arndt_raw_time_sheet_data.pay_date) INTO paydate FROM arndt_raw_time_sheet_data; WHILE paydate <= 14 LOOP SELECT To_char(employee_id, '999'), To_char(hire_date, 'DD-MON'), To_char(termination_date, 'DD-MON') INTO employeeid, hiredate, terminationdate FROM employees, time_sheet WHERE employees.employee_id = time_sheet.employee_id AND paydate = pay_date; IF terminationdate > hiredate THEN RETURN 'T'; ELSE IF To_char(SYSDATE, 'DD-MON') = To_char(hiredate, 'DD-MON')THEN RETURN 'Y'; ELSE RETURN 'N'; END IF; END IF; paydate := paydate + 1; END LOOP; END; I need help with the loop..

    Read the article

  • Hibernate 3.5.0 causes extreme performance problems

    - by user303396
    I've recently updated from hibernate 3.3.1.GA to hibernate 3.5.0 and I'm having a lot of performance issues. As a test, I added around 8000 entities to my DB (which in turn cause other entities to be saved). These entities are saved in batches of 20 so that the transactions aren't too large for performance reasons. When using hibernate 3.3.1.GA all 8000 entities get saved in about 3 minutes. When using hibernate 3.5.0 it starts out slower than with hibernate 3.3.1. But it gets slower and slower. At around 4,000 entities, it sometimes takes 5 minutes just to save a batch of 20. If I then go to a mysql console and manually type in an insert statement from the mysql general query log, half of them run perfect in 0.00 seconds. And half of them take a long time (maybe 40 seconds) or timeout with "ERROR 1205 (HY000): Lock wait timeout exceeded; try restarting transaction" from MySQL. Has something changed in hibernate's transaction management in version 3.5.0 that I should be aware of? The ONLY thing I changed to experience these unusable performance issues is replace the following hibernate 3.3.1.GA jar files: com.springsource.org.hibernate-3.3.1.GA.jar, com.springsource.org.hibernate.annotations-3.4.0.GA.jar, com.springsource.org.hibernate.annotations.common-3.3.0.ga.jar, com.springsource.javassist-3.3.0.ga.jar with the new hibernate 3.5.0 release hibernate3.jar and javassist-3.9.0.GA.jar. Thanks.

    Read the article

  • Add an item to the Finder/Save dialog sidebar

    - by Clinton Blackmore
    I'm working on a script where a user logs into a guest account on OS and is prompted for their network credentials in order to mount their network home folder (while they benefit from working on a local user folder). As the guest folder is deleted when users log out, I want to discourage them from saving anything there. I would like to replace the items on the Finder and Open/Save sidebar lists (such as "Desktop", username, "Documents", etc) with ones that would save into their network home folder. It is possible to do this using AppleScript or Cocoa APIs, or do I need to modify a plist and restart the Finder? [Ack. Looking into ~/Library/Preferences/com.apple.sidebars.plist, it isn't at all clear how I'd populate it.] Similar Questions: AppleScript: adding mounted folder to Finder Sidebar? suggests using fstab; this code will most likely run as a user and really, automounting at that point would be too late. How do you programmatically put folder icons on the Finder sidebar, given that you have to use a custom icon for the folder? Says there is no Cocoa API, but that you can use a carbon-style LSSharedFileList API that is only documented in a single header file. Does anyone know of some example code to add an item to the Finder sidebar?

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • array of structures, or structure of arrays?

    - by Jason S
    Hmmm. I have a table which is an array of structures I need to store in Java. The naive don't-worry-about-memory approach says do this: public class Record { final private int field1; final private int field2; final private long field3; /* constructor & accessors here */ } List<Record> records = new ArrayList<Record>(); If I end up using a large number ( 106 ) of records, where individual records are accessed occasionally, one at a time, how would I figure out how the preceding approach (an ArrayList) would compare with an optimized approach for storage costs: public class OptimizedRecordStore { final private int[] field1; final private int[] field2; final private long[] field3; Record getRecord(int i) { return new Record(field1[i],field2[i],field3[i]); } /* constructor and other accessors & methods */ } edit: assume the # of records is something that is changed infrequently or never I'm probably not going to use the OptimizedRecordStore approach, but I want to understand the storage cost issue so I can make that decision with confidence. obviously if I add/change the # of records in the OptimizedRecordStore approach above, I either have to replace the whole object with a new one, or remove the "final" keyword. kd304 brings up a good point that was in the back of my mind. In other situations similar to this, I need column access on the records, e.g. if field1 and field2 are "time" and "position", and it's important for me to get those values as an array for use with MATLAB, so I can graph/analyze them efficiently.

    Read the article

  • Changing default compiler in Linux, using SCons

    - by ereOn
    On my Linux platform, I have several versions of gcc. Under usr/bin I have: gcc34 gcc44 gcc Here are some outputs: $ gcc --version gcc (GCC) 4.1.2 20080704 (Red Hat 4.1.2-48) $ gcc44 --version gcc44 (GCC) 4.4.0 20090514 (Red Hat 4.4.0-6) I need to use the 4.4 version of gcc however the default seems to the 4.1 one. I there a way to replace /usr/bin/gcc and make gcc44 the default compiler not using a symlink to /usr/bin/gcc44 ? The reason why I can't use a symlink is because my code will have to be shipped in a RPM package using mock. mock creates a minimal linux installation from scratch and just install the specified dependencies before compiling my code in it. I cannot customize this "minimal installation". Ideally, the perfect solution would be to install an official RPM package that replaces gcc with gcc44 as the default compiler. Is there such a package ? Is this even possible/good ? Additional information I have to use SCons (a make alternative) and it doesn't let me specify the binary to use for gcc. I will also accept any answer that will tell me how to specify the gcc binary in my SConstruct file.

    Read the article

  • using jquery selector to change attribute in variable returned from ajax request

    - by Blake
    I'm trying to pull in a filename.txt (contains html) using ajax and change the src path in the data variable before I load it into the target div. If I first load it into the div the browser first requests the broken image and I don't want this so I would like to do my processing before I load anything onto the page. I can pull the src values fine but I can't change them. In this example the src values aren't changed. Is there a way to do this with selectors or can they only modify DOM elements? Otherwise I may have to do some regex replace but using a selector will be more convenient if possible. $.ajax( { url: getDate+'/'+name+'.txt', success: function(data) { $('img', data).attr('src', 'new_test_src'); $('#'+target).fadeOut('slow', function(){ $('#'+target).html(data); $('#'+target).fadeIn('slow'); }); } }); My reason is I'm building a fully standalone javascript template system for a newsletter and since images and other things are upload via a drupal web file manager I want the content creators to keep their paths very short and simple and I can then modify them before I load in the content. This will also be distributed on a CD so I can need to change the paths for that so they still work.

    Read the article

  • prototype findElements querySelectorAll error

    - by JD
    i'm call the "down" function but am getting an invalid argument using 1.6.1_rc2 here's the html snippet: <TR id=000000214A class="activeRow searchResultsDisplayOver" conceptID="0000001KIU"> <TD> <DIV class=gridRowWrapper> <SPAN class=SynDesc>Asymmetric breasts</SPAN> <DIV class=buttonWrapper> <SPAN class=btnAddFav title="Add to Favorites">&nbsp;</SPAN> </DIV> </DIV> </TD> </TR> here's the code: var description = row.down('span.SynDesc').innerHTML; row is a dom reference to the element. prototype is appending a # then the id of the element: findElements: function(root) { root = root || document; var e = this.expression, results; switch (this.mode) { case 'selectorsAPI': if (root !== document) { var oldId = root.id, id = $(root).identify(); id = id.replace(/[\.:]/g, "\\$0"); e = "#" + id + " " + e; } results = $A(root.querySelectorAll(e)).map(Element.extend); <-- e = "#000000214A span.SynDesc" root.id = oldId; return results; case 'xpath': return document._getElementsByXPath(this.xpath, root); default: return this.matcher(root); } i get an "invalid argument" error? if i put a breakpoint before the offending line and change e to be equal to "span.SynDesc" it works fine. help. :)

    Read the article

  • Asp.Net MVC - Binding of parameter to model value!

    - by Pino
    This seems like the model binding is causing me issues. Essentially I have a model called ProductOption and for the purpose of this question it has 2 fields ID (Int) PK ProductID (Int) FK I have a standard route set-up context.MapRoute( "Product_default", "Product/{controller}/{action}/{id}", new { controller = "Product", action = "Index", id = UrlParameter.Optional } ); and if the user wants to add an option the URL is, /Product/Options/Add/1 in the above URL 1 is the ProductID, I have the following code to return a blank model the the view, [HttpGet] public ActionResult Add(int id) { return View("Manage", new ProductOptionModel() { ProductID = id }); } Now in my view I keep a hidden field <%= Html.HiddenFor(x=>x.ID) %> This is used to determine (on submit) if we are editing or adding a new option. However the Model binder in .net seems to replace .ID (Which was 0 when leaving the above get actionresult) with 1 (or the value of the id parameter in the URL) How can I stop or work around this? ViewModel public class ProductExtraModel { //Database public int ID { get; set; } public string Name { get; set; } public int ProductID { get; set; } public ProductModel Product { get; set; } }

    Read the article

  • Powershell finding services using a cmdlet dll

    - by bartonm
    I need to upgrade a dll assemblies, written in C#, in our installation. Before I replace the DLL file, I want to check if the file has a lock and if so display a message. How do I implement this in powershell? I was thinking iterate through Get-Process checking dependencies. Solved. I iterated through list looking a file path match. function IsCaradigmPowershellDLLFree() { # The list of DLLs to check for locks by running processes. $DllsToCheckForLocks = "$env:ProgramFiles\Caradigm Platform\System 3.0\Platform\PowerShell\Caradigm.Platform.Powershell.dll", "$env:ProgramFiles\Caradigm Platform\System 3.0\Platform\PowerShell\Caradigm.Platform.Powershell.InternalPlatformSetup.dll"; # Assume true, then check all process dependencies $result = $true; # Iterate through each process and check module dependencies foreach ($p in Get-Process) { # Iterate through each dll used in a given process foreach ($m in Get-Process -Name $p.ProcessName -Module -ErrorAction SilentlyContinue) { # Check if dll dependency match any DLLs in list foreach ($dll in $DllsToCheckForLocks) { # Compare the fully-qualified file paths, # if there's a match then a lock exists. if ( ($m.FileName.CompareTo($dll) -eq 0) ) { $pName = $p.ProcessName.ToString() Write-Error "$dll is locked by $pName. This dll must be have zero locked prior to upgrade. Stop this service to release this lock on $m1." $result = $false; } } } } return $result; }

    Read the article

  • Problem using the find function in MATLAB

    - by Peter Etchells
    I have two arrays of data that I'm trying to amalgamate. One contains actual latencies from an experiment in the first column (e.g. 0.345, 0.455... never more than 3 decimal places), along with other data from that experiment. The other contains what is effectively a 'look up' list of latencies ranging from 0.001 to 0.500 in 0.001 increments, along with other pieces of data. Both data sets are X-by-Y doubles. What I'm trying to do is something like... for i = 1:length(actual_latency) row = find(predicted_data(:,1) == actual_latency(i)) full_set(i,1:4) = [actual_latency(i) other_info(i) predicted_info(row,2) ... predicted_info(row,3)]; end ...in order to find the relevant row in predicted_data where the look up latency corresponds to the actual latency. I then use this to created an amalgamated data set, full_set. I figured this would be really simple, but the find function keeps failing by throwing up an empty matrix when looking for an actual latency that I know is in predicted_data(:,1) (as I've double-checked during debugging). Moreover, if I replace find with a for loop to do the same job, I get a similar error. It doesn't appear to be systematic - using different participant data sets throws it up in different places. Furthermore, during debugging mode, if I use find to try and find a hard-coded value of actual_latency, it doesn't always work. Sometimes yes, sometimes no. I'm really scratching my head over this, so if anyone has any ideas about what might be going on, I'd be really grateful.

    Read the article

  • PostgreSQL: return select count(*) from old_ids;

    - by Alexander Farber
    Hello, please help me with 1 more PL/pgSQL question. I have a PHP-script run as daily cronjob and deleting old records from 1 main table and few further tables referencing its "id" column: create or replace function quincytrack_clean() returns integer as $BODY$ begin create temp table old_ids (id varchar(20)) on commit drop; insert into old_ids select id from quincytrack where age(QDATETIME) > interval '30 days'; delete from hide_id where id in (select id from old_ids); delete from related_mks where id in (select id from old_ids); delete from related_cl where id in (select id from old_ids); delete from related_comment where id in (select id from old_ids); delete from quincytrack where id in (select id from old_ids); return select count(*) from old_ids; end; $BODY$ language plpgsql; And here is how I call it from the PHP script: $sth = $pg->prepare('select quincytrack_clean()'); $sth->execute(); if ($row = $sth->fetch(PDO::FETCH_ASSOC)) printf("removed %u old rows\n", $row['count']); Why do I get the following error? SQLSTATE[42601]: Syntax error: 7 ERROR: syntax error at or near "select" at character 9 QUERY: SELECT select count(*) from old_ids CONTEXT: SQL statement in PL/PgSQL function "quincytrack_clean" near line 23 Thank you! Alex

    Read the article

  • How to paginate Django with other get variables?

    - by vagabond
    I am having problems using pagination in Django. Take the URL below as an example: http://127.0.0.1:8000/users/?sort=first_name On this page I sort a list of users by their first_name. Without a sort GET variable it defaults to sort by id. Now if I click the next link I expect the following URL: http://127.0.0.1:8000/users/?sort=first_name&page=2 Instead I lose all get variables and end up with http://127.0.0.1:8000/users/?page=2 This is a problem because the second page is sorted by id instead of first_name. If I use request.get_full_path I will eventually end up with an ugly URL: http://127.0.0.1:8000/users/?sort=first_name&page=2&page=3&page=4 What is the solution? Is there a way to access the GET variables on the template and replace the value for the page? I am using pagination as described in Django's documentation and my preference is to keep using it. The template code I am using is similar to this: {% if contacts.has_next %} <a href="?page={{ contacts.next_page_number }}">next</a> {% endif %}

    Read the article

  • using ini file in vb6, problem with path to file

    - by DrPut
    I have read many articles about how to use an INI file within my VB6 project. I don't have a problem with the methods, my problem is how to make the EXE file find the INI file. I don't want to hard code the path in the program. I simply want the EXE to expect the INI file to be present in the same folder the EXE is executed from. When I run the program from inside VB6 IDE, the INI is found and processed. When I compile the program and run the EXE, nothing is found. My code looks like: gServer = sGetINI(sINIFile, "TOOLBOM", "ServerName", "?") where TOOLBOM is the [Section] and "ServerName" is the key for the value. I obtained the following code for the API: Rem API DECLARATIONS Declare Function GetPrivateProfileString Lib "kernel32" Alias _ "GetPrivateProfileStringA" (ByVal lpApplicationName _ As String, ByVal lpKeyName As Any, ByVal lpDefault _ As String, ByVal lpReturnedString As String, ByVal _ nSize As Long, ByVal lpFileName As String) As Long Declare Function WritePrivateProfileString Lib "kernel32" Alias _ "WritePrivateProfileStringA" (ByVal lpApplicationName _ As String, ByVal lpKeyName As Any, ByVal lpString As Any, _ ByVal lpFileName As String) As Long Public Function sGetINI(sINIFile As String, sSection As String, sKey _ As String, sDefault As String) As String Dim sTemp As String * 256 Dim nLength As Integer sTemp = Space$(256) nLength = GetPrivateProfileString(sSection, sKey, sDefault, sTemp, _ 255, sINIFile) sGetINI = Left$(sTemp, nLength) End Function Public Sub writeINI(sINIFile As String, sSection As String, sKey _ As String, sValue As String) Dim n As Integer Dim sTemp As String sTemp = sValue Rem Replace any CR/LF characters with spaces For n = 1 To Len(sValue) If Mid$(sValue, n, 1) = vbCr Or Mid$(sValue, n, 1) = vbLf _ Then Mid$(sValue, n) = " " Next n n = WritePrivateProfileString(sSection, sKey, sTemp, sINIFile) End Sub

    Read the article

  • Updating Android Tab Icons

    - by lnediger
    I have an activity which has a TabHost containing a set of TabSpecs each with a listview containing the items to be displayed by the tab. When each TabSpec is created, I set an icon to be displayed in the tab header. The TabSpecs are created in this way within a setupTabs() method which loops to create the appropriate number of tabs: TabSpec ts = mTabs.newTabSpec("tab"); ts.setIndicator("TabTitle", iconResource); ts.setContent(new TabHost.TabContentFactory( { public View createTabContent(String tag) { ... } }); mTabs.addTab(ts); There are a couple instances where I want to be able to change the icon which is displayed in each tab during the execution of my program. Currently I am deleting all the tabs, and calling the above code again to re-create them. mTabs.getTabWidget().removeAllViews(); mTabs.clearAllTabs(true); setupTabs(); Is there a way to replace the icon that is being displayed without deleting and re-creating all of the tabs?

    Read the article

  • Matlab GUI - How to get the previous value entered from a callback function?

    - by Graham
    Hi, I know that this is probably a simple problem but I am new to Matlab GUI's and basically want to get the old value which used to be stored in the text box to replace the value which has just been entered. E.g. Text box contains a valid string, User enters invalid string, Callback func, validates input and realises new input is an error and reverts to the old previous value. How should this be implemented or done? Atm I am just using the get and set property values. Below is some sample code: function sampledist_Callback(hObject, eventdata, handles) % hObject handle to sampledist (see GCBO) % eventdata reserved - to be defined in a future version of MATLAB % handles structure with handles and user data (see GUIDATA) % Hints: get(hObject,'String') returns contents of sampledist as text % str2double(get(hObject,'String')) returns contents of sampledist as a double input = str2double(get(hObject,'String')); if(input < 0 || input > 500) errordlg('Sampled Dist. must be > 0 and < 500','Sample Dist - Input Error'); set(handles.sampledist,'String',['10']); %<--- I would like this value 10 to be the previous entry! guidata(hObject,handles); else set(handles.sampledist,'String',['',input]); guidata(hObject,handles); end

    Read the article

< Previous Page | 241 242 243 244 245 246 247 248 249 250 251 252  | Next Page >