Search Results

Search found 7529 results on 302 pages for 'replace'.

Page 246/302 | < Previous Page | 242 243 244 245 246 247 248 249 250 251 252 253  | Next Page >

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • sql server mdf file database attachment

    - by jnsohnumr
    hello all i'm having a bear of a time getting visual studio 2010 (ultimate i think) to properly attach to my database. it was moved from original spot to #MYAPP#/#MYAPP#.Web/App_Data/#MDF_FILE#.mdf. I have three instances of sql server running on this machine. i have tried to replace the old mdf file with my new one and cannot get the connectionstring right for it. what i'm really wanting to do is to just open some DB instance, run a DB create script. Then I can have a DB that was generated via my edmx (generate database from model) in silverlight business application (c#) right now, when i go to server explorer in VS, choose add new connection, choose MS SQL Server Database FIle (SqlClient), choose my file location (app_data directory), use windows authentication, and hit the Test Connection button I get the following error: Unable to open the physical file "". Operating system error 5: "5(Access Denied.)". An attempt to attach to an auto-named database for file"" failed. A database with the same name exists, or specified file cannot be opened, or it is located on UNC share. The mdf file was created on the same machine by connecting to (local) on the sql server management studio, getting a new query, pasting in the SQL from the generated ddl file, adding a CREATE DATABASE [NcrCarDatabase]; GO before the pasted SQL, and executing the query. I then disconnected from the DB in management studio, closed management studio, navigated to the DATA directory for that instance, and copying the mdf and ldf files to my application's app_data folder. I am then trying to connect to the same file inside visual studio. I hope that gives more clarity to my problems :). Connection string is: Data Source=.\SQLEXPRESS;AttachDbFilename=C:\SourceCode\NcrCarDatabase\NcrCarDatabase.Web\App_Data\NcrCarDatabase.mdf;Integrated Security=True;Connect Timeout=30;User Instance=True

    Read the article

  • Updating Android Tab Icons

    - by lnediger
    I have an activity which has a TabHost containing a set of TabSpecs each with a listview containing the items to be displayed by the tab. When each TabSpec is created, I set an icon to be displayed in the tab header. The TabSpecs are created in this way within a setupTabs() method which loops to create the appropriate number of tabs: TabSpec ts = mTabs.newTabSpec("tab"); ts.setIndicator("TabTitle", iconResource); ts.setContent(new TabHost.TabContentFactory( { public View createTabContent(String tag) { ... } }); mTabs.addTab(ts); There are a couple instances where I want to be able to change the icon which is displayed in each tab during the execution of my program. Currently I am deleting all the tabs, and calling the above code again to re-create them. mTabs.getTabWidget().removeAllViews(); mTabs.clearAllTabs(true); setupTabs(); Is there a way to replace the icon that is being displayed without deleting and re-creating all of the tabs?

    Read the article

  • Syntax Error? When parsing XML value

    - by Ace Munim
    I don't know if I'm having a syntax error but the compiler is giving me TypeError: 'undefined' is not an object (evaluating 'xmlDoc.getElementsByTagName("icon")[i].childNodes') Its me giving me this problem when im parsing the XML from my server, my actual javascript code is like this var xmlDoc = Obj.responseXML; var count = 0; if(xmlDoc){ while(count <= xmlDoc.getElementsByTagName("item").length){ document.getElementById("flow").innerHTML += "<div class='item'><img class='content' src='" + xmlDoc.getElementsByTagName("icon")[i].childNodes[0].nodeValue.replace(/\s+$/g,' ') +"' /></div>"; count++; } }else{ alert("Unable to parse!"); } and my XML goes like this. <feed> <item> <title>Given Title</title> <icon> http://i178.photobucket.com/albums/w255/ace003_album/Logo-ETC-RGB-e1353503652739.jpg </icon> </item> <item>...</item> <item>...</item> <item>...</item> <item>...</item> <item>...</item> <item>...</item> </feed> i just want to parse the image link and to show it.

    Read the article

  • Problem using the find function in MATLAB

    - by Peter Etchells
    I have two arrays of data that I'm trying to amalgamate. One contains actual latencies from an experiment in the first column (e.g. 0.345, 0.455... never more than 3 decimal places), along with other data from that experiment. The other contains what is effectively a 'look up' list of latencies ranging from 0.001 to 0.500 in 0.001 increments, along with other pieces of data. Both data sets are X-by-Y doubles. What I'm trying to do is something like... for i = 1:length(actual_latency) row = find(predicted_data(:,1) == actual_latency(i)) full_set(i,1:4) = [actual_latency(i) other_info(i) predicted_info(row,2) ... predicted_info(row,3)]; end ...in order to find the relevant row in predicted_data where the look up latency corresponds to the actual latency. I then use this to created an amalgamated data set, full_set. I figured this would be really simple, but the find function keeps failing by throwing up an empty matrix when looking for an actual latency that I know is in predicted_data(:,1) (as I've double-checked during debugging). Moreover, if I replace find with a for loop to do the same job, I get a similar error. It doesn't appear to be systematic - using different participant data sets throws it up in different places. Furthermore, during debugging mode, if I use find to try and find a hard-coded value of actual_latency, it doesn't always work. Sometimes yes, sometimes no. I'm really scratching my head over this, so if anyone has any ideas about what might be going on, I'd be really grateful.

    Read the article

  • Is there a FAST way to export and install an app on my phone, while signing it with my own keystore?

    - by Alexei Andreev
    So, I've downloaded my own application from the market and installed it on my phone. Now, I am trying to install a temporary new version from Eclipse, but here is the message I get: Re-installation failed due to different application signatures. You must perform a full uninstall of the application. WARNING: This will remove the application data! Please execute 'adb uninstall com.applicationName' in a shell. Launch canceled! Now, I really really don't want to uninstall the application, because I will lose all my data. One solution I found is to Export my application, creating new .apk, and then install it via HTC Sync (probably a different program based on what phone you have). The problem is this takes a long time to do, since I need to enter the password for the keystore each time and then wait for HTC Sync. It's a pain in the ass! So the question is: Is there a way to make Eclipse automatically use my keystore to sign the application (quickly and automatically)? Or perhaps to replace debug keystore with my own? Or perhaps just tell it to remember the password, so I don't have to enter it every time...? Or some other way to solve this problem?

    Read the article

  • Trying to use jquery ui in google chrome extension in the content level

    - by user135697
    The problem is that the scope of the content script is on the web page that your plugin is suppose to be used at. So the css background:url(images/ui-bg_inset-hard_100_fcfdfd_1x100.png) becomes url('http://webpageforplugin/images/ui-bg_inset-hard_100_fcfdfd_1x100.png') in order for this to work as far as i understood i need to have it to point to: url('chrome-extension://extensionId/images/ui-bg_inset-hard_100_fcfdfd_1x100.png') So i tried to haxorz the document.styleSheets var ss = document.styleSheets; for (var i=0; i<ss.length; i++) { var found=-1, x,i; var rules = ss[i].cssRules || ss[i].rules; for (var j=0; j<rules.length; j++) { if ('.ui-helper-hidden'==rules[j].selectorText){ found=i; break; } } if (found>-1){ for (var j=0; j<rules.length; j++) { if (x=rules[j].style.background){ if ((i=x.indexOf('url'))!=-1) rules[j].style.background = x.replace('http://page/images/','chrome-extension://extensionId/images/'); } } break; } }; I feel that i'm missing the obvious. That there must be an easier way. Even if i manage to change this how will i get the extension id to build the string. Btw this doesn't work, the icons are not properly fetched. (I hardcoded the extension id) Any ideas?

    Read the article

  • How do I make custom functions chain-able with jQuery's?

    - by sergio
    I need a "callfront" or "precall" (the opposite of "callback" ¿?) to add in MANY places before an animation occurs in an existing plugin, To be used like e.g. $(some_unpredictable_obj).preFunct().animate(… The problem is, as I said they are MANY places, and all of them are different animations, on different objects. I can TELL where all of them occur, but I don't want to add over and over the same code. I actually have to add both a function before and after those animations, but I think I can use the callback for all of them. In a perfect world, I'd like to replace every animate(property, duration) by preFunct().animate(property,duration).postFunct() preFunct and postFunct don't need parameters, since they are always the same action, on the same object. This could be an amazing addition to "jQuery" (an easy way to jQuerize custom functions to be added to the normal chain (without messing with queues) I found this example but it will act on the applied element, and I don't want that because, as I said above, all the original animations to be added to are on different elements. I also found jQuery.timing, but it looks cooler the chain-able function :) Thanks.

    Read the article

  • PostgreSQL: return select count(*) from old_ids;

    - by Alexander Farber
    Hello, please help me with 1 more PL/pgSQL question. I have a PHP-script run as daily cronjob and deleting old records from 1 main table and few further tables referencing its "id" column: create or replace function quincytrack_clean() returns integer as $BODY$ begin create temp table old_ids (id varchar(20)) on commit drop; insert into old_ids select id from quincytrack where age(QDATETIME) > interval '30 days'; delete from hide_id where id in (select id from old_ids); delete from related_mks where id in (select id from old_ids); delete from related_cl where id in (select id from old_ids); delete from related_comment where id in (select id from old_ids); delete from quincytrack where id in (select id from old_ids); return select count(*) from old_ids; end; $BODY$ language plpgsql; And here is how I call it from the PHP script: $sth = $pg->prepare('select quincytrack_clean()'); $sth->execute(); if ($row = $sth->fetch(PDO::FETCH_ASSOC)) printf("removed %u old rows\n", $row['count']); Why do I get the following error? SQLSTATE[42601]: Syntax error: 7 ERROR: syntax error at or near "select" at character 9 QUERY: SELECT select count(*) from old_ids CONTEXT: SQL statement in PL/PgSQL function "quincytrack_clean" near line 23 Thank you! Alex

    Read the article

  • Streaming content to JSF UI

    - by Mark Lewis
    Hello, I was quite happy with my JSF app which read the contents of MQ messages received and supplied them to the UI like this: <rich:panel> <snip> <rich:panelMenuItem label="mylabel" action="#{MyBacking.updateCurrent}"> <f:param name="current" value="mylog.log" /> </rich:panelMenuItem> </snip> </rich:panel> <rich:panel> <a4j:outputPanel ajaxRendered="true"> <rich:insert content="#{MyBacking.log}" highlight="groovy" /> </a4j:outputPanel> </rich:panel> and in MyBacking.java private String logFile = null; ... public String updateCurrent() { FacesContext context=FacesContext.getCurrentInstance(); setCurrent((String)context.getExternalContext().getRequestParameterMap().get("current")); setLog(getCurrent()); return null; } public void setLog(String log) { sendMsg(log); msgBody = receiveMsg(moreargs); logFile = msgBody; } public String getLog() { return logFile; } until the contents of one of the messages was too big and tomcat fell over. Obviously, I thought, I need to change the way it works so that I return some form of stream so that no one object grows so big that the container dies and the content returned by successive messages is streamed to the UI as it comes in. Am I right in thinking that I can replace the work I'm doing now on a String object with a BufferedOutputStream object ie no change to the JSF code and something like this changing at the back end: private BufferedOutputStream logFile = null; public void setLog(String log) { sendMsg(args); logFile = (BufferedOutputStream) receiveMsg(moreargs); } public String getLog() { return logFile; }

    Read the article

  • Creating a three level ASP.NET menu with SiteMap, how do i do it?

    - by user270399
    I want to create a three level menu, I have got a recursive function today that works with three levels. But the thing is how do i output the third lever? Using two repeaters i have managed to get a hold of the first two levels through the ChildNodes property. But that only gives me the second level. What if a want the third level? Example code below. How do i get the third level? :) <asp:Repeater ID="FirstLevel" DataSourceID="SiteMapDataSource" runat="server" EnableViewState="false"> <ItemTemplate> <li class="top"> <a href='/About/<%#Eval("Title")%>.aspx' class="top_link"><span class="down"><%#Eval("Title")%></span><!--[if gte IE 7]><!--></a><!--<![endif]--> <asp:Repeater runat="server" ID="SecondLevel" DataSource='<%#((SiteMapNode)Container.DataItem).ChildNodes%>'> <HeaderTemplate><!--[if lte IE 6]><table><tr><td><![endif]--><ul class="sub"></HeaderTemplate> <ItemTemplate> <li> <a href='<%#((string)Eval("Url")).Replace("~", "")%>' style="text-align: left;"><%#Eval("Title")%></a> Third repeater here? </li> </ItemTemplate> <FooterTemplate></ul><!--[if lte IE 6]></td></tr></table></a><![endif]--></FooterTemplate> </asp:Repeater> </li> </ItemTemplate> </asp:Repeater>

    Read the article

  • jquery events on input submit fields

    - by dfilkovi
    I have a problem with jquery submit button onclick and default event. What I want to do is replace an click event on submit button if it has one, and get an dialog box to show up, on clicking yes the dialog should start that default onclick event if submit button has one defined, if it hasn't than the default event should happen (button submits form), .submit() function does not work for me in any case cause I need to send this button also through a form and if button wasn't clicked .submit() sends form data without submit data. Bellow code has a problem, alert('xxx') is always called and it shouldn't, and on clicking yes button alert and dialog creation is called again, also if I remove alert button, I cannot call default submit button event (form submitting with a button). $('input.confirm').each(function() { var input = this; var dialog = document.createElement("div"); $(dialog).html('<p>AREYOUSHURE</p>'); $(input).click(function(event) { event.preventDefault(); var buttons = {}; buttons['NO'] = function() { $(this).dialog("close"); }; buttons['YES'] = function() { $(input).trigger('click'); $(this).dialog("close"); }; $(dialog).dialog( { autoOpen: false, width: 200, modal: true, resizable: false, buttons: buttons }); $(dialog).dialog('open'); return false; }); }); <form method="post" action=""> <input type="hidden" value="1" name="eventId" /> <input type="submit" value="Check" name="checkEvent" class="confirm" onclick="alert('xxx');" /> </form>

    Read the article

  • Java function changing input

    - by Doodle
    I would like to go from one number to another. For example if I started at 6 and my goal was 10 I want a function that on every pass would bring me from 6 towards 10 or if I had the number 14 and my goal was 9 it would count down from 14 towards 9.So far I have (this is written in Processing a Java Api but there is essentially no difference from regualr Java, draw is just a continuous loop) int x=100; void draw(){ x=towards(x,10); println(x); } int towards(int current ,int target){ if(current!=target){ if (current <target){ current=current+1; } else { current=current-1; } } return current; } this gives me the results I would like but I would like to have everything in side of the towards() function. When I replace X with a variable it of course resets it self to the static variable. To sum it up how can I pass a variable to a function and have that variable thats been passed change on every subsequent pass. I have looked into recursion as a solution but that of just brings me to a final solution. I can pass the count to an array but wouldn't like to do that either.

    Read the article

  • Trouble with building up a string in Clojure

    - by Aki Iskandar
    Hi gang - [this may seem like my problem is with Compojure, but it isn't - it's with Clojure] I've been pulling my hair out on this seemingly simple issue - but am getting nowhere. I am playing with Compojure (a light web framework for Clojure) and I would just like to generate a web page showing showing my list of todos that are in a PostgreSQL database. The code snippets are below (left out the database connection, query, etc - but that part isn't needed because specific issue is that the resulting HTML shows nothing between the <body> and </body> tags). As a test, I tried hard-coding the string in the call to main-layout, like this: (html (main-layout "Aki's Todos" "Haircut<br>Study Clojure<br>Answer a question on Stackoverfolw")) - and it works fine. So the real issue is that I do not believe I know how to build up a string in Clojure. Not the idiomatic way, and not by calling out to Java's StringBuilder either - as I have attempted to do in the code below. A virtual beer, and a big upvote to whoever can solve it! Many thanks! ============================================================= ;The master template (a very simple POC for now, but can expand on it later) (defn main-layout "This is one of the html layouts for the pages assets - just like a master page" [title body] (html [:html [:head [:title title] (include-js "todos.js") (include-css "todos.css")] [:body body]])) (defn show-all-todos "This function will generate the todos HTML table and call the layout function" [] (let [rs (select-all-todos) sbHTML (new StringBuilder)] (for [rec rs] (.append sbHTML (str rec "<br><br>"))) (html (main-layout "Aki's Todos" (.toString sbHTML))))) ============================================================= Again, the result is a web page but with nothing between the body tags. If I replace the code in the for loop with println statements, and direct the code to the repl - forgetting about the web page stuff (ie. the call to main-layout), the resultset gets printed - BUT - the issue is with building up the string. Thanks again. ~Aki

    Read the article

  • Starting Beyond Compare from the Command Line

    - by Logan
    I have Beyond Compare 3 installed at; "C:\Program Files\Beyond Compare 3\BCompare.exe" and Cygwin; "C:\Cygwin\bin\bash.exe" What I would like is to be able to use a command such as; diff <file1> <file2> into the Cygwin shell and to have the shell fork a process opening the two files in beyond compare. I looked at the Beyond Compare Support Page but I'm afraid It was too brief for me. I tried copying the text verbatim (apart from path to executable) to no avail; Instead of using a batch file, create a file named "bc.sh" with the following line: "$(cygpath 'C:\Progra~1\Beyond~1\bcomp.exe')" `cygpath -w "$6"` `cygpath -w "$7"` /title1="$3" /title2="$5" /readonly Was I supposed to replace cygpath? I get a 'Command not found' error when I enter the name of the script on the command line. gavina@whwgavina1 /cygdrive $ "C:\Documents and Settings\gavina\Desktop\bc.sh" bash: C:\Documents and Settings\gavina\Desktop\bc.sh: command not found Does anyone have Beyond Compare working as I have described? Is this even possible in a Windows environment? Thanks in advance!

    Read the article

  • Which frameworks (and associated languages) support class replacement?

    - by Alix
    Hi, I'm writing my master thesis, which deals with AOP in .NET, among other things, and I mention the lack of support for replacing classes at load time as an important factor in the fact that there are currently no .NET AOP frameworks that perform true dynamic weaving -- not without imposing the requirement that woven classes must extend ContextBoundObject or MarshalByRefObject or expose all their semantics on an interface. You can however do this with the JVM thanks to ClassFileTransformer: You extend ClassFileTransformer. You subscribe to the class load event. On class load, you rewrite the class and replace it. All this is very well, but my project director has asked me, quite in the last minute, to give him a list of frameworks (and associated languages) that do / do not support class replacement. I really have no time to look for this now: I wouldn't feel comfortable just doing a superficial research and potentially putting erroneous information in my thesis. So I ask you, oh almighty programming community, can you help out? Of course, I'm not asking you to research this yourselves. Simply, if you know for sure that a particular framework supports / doesn't support this, leave it as an answer. If you're not sure please don't forget to point it out. Thanks so much!

    Read the article

  • How to traverse table in Jquery and add a class?

    - by SWL
    I have a simple table of two rows. The first column is required, but the others are not; however, I would like them to be required in pairs. So if the user enters a value for Quantity3, then Size3 should also now be required. As a fiddle: http://jsfiddle.net/NaRts/7/ <tr> <td><input name="qty1[492]" class="qty required" type="text"></td> <td><input name="qty2[492]" class="qty" type="text"></td> <td><input name="qty3[492]" class="qty" type="text"></td> </tr><tr> <td><input name="size1[492]" type="text" class="size required" ></td> <td><input name="size2[492]" type="text" class="size" ></td> <td><input name="size3[492]" type="text" class="size" ></td> </tr> And the simple jQuery I have is: $('.qty').keyup(function() { var s = $(this).attr('name'); // = qty3[418] var qtyID = s.replace(/[^1-9\[\]]/g, ""); // = 3[418] var SizeID = "size" + qtyID; var $sizeInput = $(this).closest('tr').next().find(SizeID); $sizeInput.css('background-color', 'green'); $sizeInput.addClass('required'); //I tried this too but it didn't work //$(this).parent().find(SizeID).addClass('required'); });? ? Any help is much appreciated.

    Read the article

  • Python: Copying files with special characters in path

    - by erikderwikinger
    Hi is there any possibility in Python 2.5 to copy files having special chars (Japanese chars, cyrillic letters) in their path? shutil.copy cannot handle this. here is some example code: import copy, os,shutil,sys fname=os.getenv("USERPROFILE")+"\\Desktop\\testfile.txt" print fname print "type of fname: "+str(type(fname)) fname0 = unicode(fname,'mbcs') print fname0 print "type of fname0: "+str(type(fname0)) fname1 = unicodedata.normalize('NFKD', fname0).encode('cp1251','replace') print fname1 print "type of fname1: "+str(type(fname1)) fname2 = unicode(fname,'mbcs').encode(sys.stdout.encoding) print fname2 print "type of fname2: "+str(type(fname2)) shutil.copy(fname2,'C:\\') the output on a Russian Windows XP C:\Documents and Settings\+????????????\Desktop\testfile.txt type of fname: <type 'str'> C:\Documents and Settings\?????????????\Desktop\testfile.txt type of fname0: <type 'unicode'> C:\Documents and Settings\+????????????\Desktop\testfile.txt type of fname1: <type 'str'> C:\Documents and Settings\?????????????\Desktop\testfile.txt type of fname2: <type 'str'> Traceback (most recent call last): File "C:\Test\getuserdir.py", line 23, in <module> shutil.copy(fname2,'C:\\') File "C:\Python25\lib\shutil.py", line 80, in copy copyfile(src, dst) File "C:\Python25\lib\shutil.py", line 46, in copyfile fsrc = open(src, 'rb') IOError: [Errno 2] No such file or directory: 'C:\\Documents and Settings\\\x80\ xa4\xac\xa8\xad\xa8\xe1\xe2\xe0\xa0\xe2\xae\xe0\\Desktop\\testfile.txt'

    Read the article

  • Dice Emulation - ImageView

    - by Michelle Harris
    I am trying to emulate dice using ImageView. When I click the button, nothing seems to happen. I have hard coded this example to replace the image with imageView4 for debugging purposes (I was making sure the random wasn't fail). Can anyone point out what I am doing wrong? I am new to Java, Eclipse and Android so I'm sure I've probably made more than one mistake. Java: import java.util.Random; import android.app.Activity; import android.os.Bundle; import android.view.View; import android.widget.ArrayAdapter; import android.widget.ImageView; import android.widget.Spinner; import android.widget.Toast; public class Yahtzee4Activity extends Activity { /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); Spinner s = (Spinner) findViewById(R.id.spinner); ArrayAdapter adapter = ArrayAdapter.createFromResource( this, R.array.score_types, android.R.layout.simple_spinner_dropdown_item); adapter.setDropDownViewResource(android.R.layout.simple_spinner_dropdown_item); s.setAdapter(adapter); } public void onMyButtonClick(View view) { ImageView imageView1 = new ImageView(this); Random rand = new Random(); int rndInt = 4; //rand.nextInt(6) + 1; // n = the number of images, that start at index 1 String imgName = "die" + rndInt; int id = getResources().getIdentifier(imgName, "drawable", getPackageName()); imageView1.setImageResource(id); } } XML for the button: <Button android:id="@+id/button_roll" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/roll" android:onClick="onMyButtonClick" />

    Read the article

  • [CODE GENERATION] How to generate DELETE statements in PL/SQL, based on the tables FK relations?

    - by The chicken in the kitchen
    Is it possible via script/tool to generate authomatically many delete statements based on the tables fk relations, using Oracle PL/SQL? In example: I have the table: CHICKEN (CHICKEN_CODE NUMBER) and there are 30 tables with fk references to its CHICKEN_CODE that I need to delete; there are also other 150 tables foreign-key-linked to that 30 tables that I need to delete first. Is there some tool/script PL/SQL that I can run in order to generate all the necessary delete statements based on the FK relations for me? (by the way, I know about cascade delete on the relations, but please pay attention: I CAN'T USE IT IN MY PRODUCTION DATABASE, because it's dangerous!) I'm using Oracle DataBase 10G R2. This is the result I've written, but it is not recursive: This is a view I have previously written, but of course it is not recursive! CREATE OR REPLACE FORCE VIEW RUN ( OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME, VINCOLO ) AS SELECT OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME, '(' || LTRIM ( EXTRACT (XMLAGG (XMLELEMENT ("x", ',' || COLUMN_NAME)), '/x/text()'), ',') || ')' VINCOLO FROM ( SELECT CON1.OWNER OWNER_1, CON1.TABLE_NAME TABLE_NAME_1, CON1.CONSTRAINT_NAME CONSTRAINT_NAME_1, CON1.DELETE_RULE, CON1.STATUS, CON.TABLE_NAME, CON.CONSTRAINT_NAME, COL.POSITION, COL.COLUMN_NAME FROM DBA_CONSTRAINTS CON, DBA_CONS_COLUMNS COL, DBA_CONSTRAINTS CON1 WHERE CON.OWNER = 'TABLE_OWNER' AND CON.TABLE_NAME = 'TABLE_OWNED' AND ( (CON.CONSTRAINT_TYPE = 'P') OR (CON.CONSTRAINT_TYPE = 'U')) AND COL.TABLE_NAME = CON1.TABLE_NAME AND COL.CONSTRAINT_NAME = CON1.CONSTRAINT_NAME --AND CON1.OWNER = CON.OWNER AND CON1.R_CONSTRAINT_NAME = CON.CONSTRAINT_NAME AND CON1.CONSTRAINT_TYPE = 'R' GROUP BY CON1.OWNER, CON1.TABLE_NAME, CON1.CONSTRAINT_NAME, CON1.DELETE_RULE, CON1.STATUS, CON.TABLE_NAME, CON.CONSTRAINT_NAME, COL.POSITION, COL.COLUMN_NAME) GROUP BY OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME; ... and it contains the error of using DBA_CONSTRAINTS instead of ALL_CONSTRAINTS...

    Read the article

  • XML Decryption Bug (referencing issue)

    - by OrangePekoe
    Hi, Needing some explanation of what exactly the decryption is doing, in addition to some help on solving the problem. Currently, when a portion of XML is encrypted, and then decrypted, the DOM appears to work correctly. We can see the element is encrypted and then see it return back once it is decrypted. Our problem lies when a user tries to change data in that same element after decryption has occurred. When a user changes some settings, data in the XML should change. However, if the user attempts to change an XML element that has been decrypted the changes are not reflected in the DOM. We have a reference pointer to the XML element that is used to bind the element to an object. If you encrypt the node and then decrypt it, the reference pointer now points to a valid orphaned XML element that is no longer part of the DOM. After decryption, there will be 2 copies of the XML element. One in the DOM as expected (though will not reflect new changes), and one orphaned element in memory that is still referenced by our pointer. The orphaned element is valid (reflects new changes). We can see that this orphaned element is owned by the DOM, but when we try to return its parent, it returns null. The question is: Where did this orphaned xml element come from? And how can we get it to correctly append (replace old data) to the DOM? The code resembles: public static void Decrypt(XmlDocument Doc, SymmetricAlgorithm Alg) { if (Doc == null) throw new ArgumentNullException("Doc"); if (Alg == null) throw new ArgumentNullException("Alg"); XmlElement encryptedElement = Doc.GetElementsByTagName("EncryptedData")[0] as XmlElement; if (encryptedElement == null) { throw new XmlException("The EncryptedData element was not found."); } EncryptedData edElement = new EncryptedData(); edElement.LoadXml(encryptedElement); EncryptedXml exml = new EncryptedXml(); byte[] rgbOutput = exml.DecryptData(edElement, Alg); exml.ReplaceData(encryptedElement, rgbOutput); }

    Read the article

  • Modify onclick function with jQuery

    - by Chris Barr
    I've got a button that has an onclick event in it, which was set on the back end from .NET. Beside it is a checkbox <button class="img_button" onclick="if(buttonLoader(this)){WebForm_DoPostBackWithOptions(new WebForm_PostBackOptions('uxBtnRelease', '', true, '', 'somepage.aspx?oupid=5&fp=true', false, true))} return false;" type="button">Release</button> <input type="checkbox" checked="checked" id="myCheckbox"> When the checkbox is clicked, needs to change the value of the query string in the URL inside the onclick function of the button. So far I have this, and the idea is right, but I keep getting errors when it's run: "Uncaught SyntaxError: Unexpected token ILLEGAL" var defaultReleaseOnClick=null; $("#myCheckbox").click(function(){ var $releaseBtn = $(".img_button"); if(defaultReleaseOnClick==null) defaultReleaseOnClick=$releaseBtn.attr("onclick"); var newOnClickString = defaultReleaseOnClick.toString().replace(/&fp=[a-z]+'/i,"&fp="+this.checked); $releaseBtn.removeAttr("onclick").click(eval(newOnClickString)); }); I know it seems kinda hacky to convert the function to a string, do a replacement, and then try to convert it back to a function, but I don't know any other way to do it. Any ideas? I've set up a demo here: http://jsbin.com/asiwu4/edit

    Read the article

  • Merge computed data from two tables back into one of them

    - by Tyler McHenry
    I have the following situation (as a reduced example). Two tables, Measures1 and Measures2, each of which store an ID, a Weight in grams, and optionally a Volume in fluid onces. (In reality, Measures1 has a good deal of other data that is irrelevant here) Contents of Measures1: +----+----------+--------+ | ID | Weight | Volume | +----+----------+--------+ | 1 | 100.0000 | NULL | | 2 | 200.0000 | NULL | | 3 | 150.0000 | NULL | | 4 | 325.0000 | NULL | +----+----------+--------+ Contents of Measures2: +----+----------+----------+ | ID | Weight | Volume | +----+----------+----------+ | 1 | 75.0000 | 10.0000 | | 2 | 400.0000 | 64.0000 | | 3 | 100.0000 | 22.0000 | | 4 | 500.0000 | 100.0000 | +----+----------+----------+ These tables describe equivalent weights and volumes of a substance. E.g. 10 fluid ounces of substance 1 weighs 75 grams. The IDs are related: ID 1 in Measures1 is the same substance as ID 1 in Measures2. What I want to do is fill in the NULL volumes in Measures1 using the information in Measures2, but keeping the weights from Measures1 (then, ultimately, I can drop the Measures2 table, as it will be redundant). For the sake of simplicity, assume that all volumes in Measures1 are NULL and all volumes in Measures2 are not. I can compute the volumes I want to fill in with the following query: SELECT Measures1.ID, Measures1.Weight, (Measures2.Volume * (Measures1.Weight / Measures2.Weight)) AS DesiredVolume FROM Measures1 JOIN Measures2 ON Measures1.ID = Measures2.ID; Producing: +----+----------+-----------------+ | ID | Weight | DesiredVolume | +----+----------+-----------------+ | 4 | 325.0000 | 65.000000000000 | | 3 | 150.0000 | 33.000000000000 | | 2 | 200.0000 | 32.000000000000 | | 1 | 100.0000 | 13.333333333333 | +----+----------+-----------------+ But I am at a loss for how to actually insert these computed values into the Measures1 table. Preferably, I would like to be able to do it with a single query, rather than writing a script or stored procedure that iterates through every ID in Measures1. But even then I am worried that this might not be possible because the MySQL documentation says that you can't use a table in an UPDATE query and a SELECT subquery at the same time, and I think any solution would need to do that. I know that one workaround might be to create a new table with the results of the above query (also selecting all of the other non-Volume fields in Measures1) and then drop both tables and replace Measures1 with the newly-created table, but I was wondering if there was any better way to do it that I am missing.

    Read the article

  • How do I override a python import?

    - by Evan Plaice
    So I'm working on pypreprocessor which is a preprocessor that takes c-style directives and I've been able to make it work like a traditional preprocessor (it's self-consuming and executes postprocessed code on-the-fly) except that it breaks library imports. The problem is. The preprocessor runs through the file, processes' it, outputs to a temp file, and exec() the temp file. Libraries that are imported need to be handled a little different because they aren't executed but rather loaded and made accessible to the caller module. What I need to be able to do is. Interrupt the import (since the preprocessor is being run in the middle of the import), load the postprocessed code as a tempModule, and replace the original import with the tempModule to trick the calling script with the import into believing that the tempModule is the original module. I have searched everywhere and so far, have no solution. This question is the closest I've seen so far to providing an answer: http://stackoverflow.com/questions/1096216/override-namespace-in-python Here's what I have. # remove the bytecode file created by the first import os.remove(moduleName + '.pyc') # remove the first import del sys.modules[moduleName] # import the postprocessed module tmpModule = __import__(tmpModuleName) # set first module's reference to point to the preprocessed module sys.modules[moduleName] = tmpModule moduleName is the name of the original module, tmpModuleName is the name of the postprocessed code file. The strange part is, this solution still runs completely normal as if the first module completed loaded normally; unless you remove the last line, then you get a module not found error. Hopefully someone on SO know a lot more about imports than I do because this one has me stumped.

    Read the article

  • ODP.NET Procedure Compilation

    - by Bobcat1506
    When I try to execute a create procedure using ODP.NET I get back ORA-24344: success with compilation error. However, when I run the same statement in SQL Developer it compiles successfully. Does anyone know what I need to change to get my procedure to compile? Is it a character set issue? I am using Oracle 10g Express, .NET 3.5 SP 1, and ODP.NET 2.111.7.20 (version from Oracle.DataAccess.dll) [TestMethod] public void OdpNet_CreateProcedure() { ConnectionStringSettings settings = ConfigurationManager.ConnectionStrings["ODP.NET"]; using (var con = new OracleConnection(settings.ConnectionString)) { con.InfoMessage += new OracleInfoMessageEventHandler(con_InfoMessage); con.Open(); var cmd = new OracleCommand(); cmd.Connection = con; cmd.CommandText = @" CREATE OR REPLACE PROCEDURE TABLE1_GET ( P_CURSOR OUT SYS_REFCURSOR ) IS BEGIN OPEN P_CURSOR FOR SELECT * FROM TABLE1; END;"; cmd.ExecuteNonQuery(); // ORA-24344: success with compilation error cmd.CommandText = @"ALTER PROCEDURE TABLE1_GET COMPILE"; cmd.ExecuteNonQuery(); // ORA-24344: success with compilation error } } void con_InfoMessage(object sender, OracleInfoMessageEventArgs eventArgs) { System.Diagnostics.Debug.WriteLine(eventArgs.Message); }

    Read the article

< Previous Page | 242 243 244 245 246 247 248 249 250 251 252 253  | Next Page >