Search Results

Search found 7529 results on 302 pages for 'replace'.

Page 246/302 | < Previous Page | 242 243 244 245 246 247 248 249 250 251 252 253  | Next Page >

• Which frameworks (and associated languages) support class replacement?

  - by Alix

  Hi, I'm writing my master thesis, which deals with AOP in .NET, among other things, and I mention the lack of support for replacing classes at load time as an important factor in the fact that there are currently no .NET AOP frameworks that perform true dynamic weaving -- not without imposing the requirement that woven classes must extend ContextBoundObject or MarshalByRefObject or expose all their semantics on an interface. You can however do this with the JVM thanks to ClassFileTransformer: You extend ClassFileTransformer. You subscribe to the class load event. On class load, you rewrite the class and replace it. All this is very well, but my project director has asked me, quite in the last minute, to give him a list of frameworks (and associated languages) that do / do not support class replacement. I really have no time to look for this now: I wouldn't feel comfortable just doing a superficial research and potentially putting erroneous information in my thesis. So I ask you, oh almighty programming community, can you help out? Of course, I'm not asking you to research this yourselves. Simply, if you know for sure that a particular framework supports / doesn't support this, leave it as an answer. If you're not sure please don't forget to point it out. Thanks so much!

  Read the article

• Asp.Net MVC - Binding of parameter to model value!

  - by Pino

  This seems like the model binding is causing me issues. Essentially I have a model called ProductOption and for the purpose of this question it has 2 fields ID (Int) PK ProductID (Int) FK I have a standard route set-up context.MapRoute( "Product_default", "Product/{controller}/{action}/{id}", new { controller = "Product", action = "Index", id = UrlParameter.Optional } ); and if the user wants to add an option the URL is, /Product/Options/Add/1 in the above URL 1 is the ProductID, I have the following code to return a blank model the the view, [HttpGet] public ActionResult Add(int id) { return View("Manage", new ProductOptionModel() { ProductID = id }); } Now in my view I keep a hidden field <%= Html.HiddenFor(x=>x.ID) %> This is used to determine (on submit) if we are editing or adding a new option. However the Model binder in .net seems to replace .ID (Which was 0 when leaving the above get actionresult) with 1 (or the value of the id parameter in the URL) How can I stop or work around this? ViewModel public class ProductExtraModel { //Database public int ID { get; set; } public string Name { get; set; } public int ProductID { get; set; } public ProductModel Product { get; set; } }

  Read the article

• Trying to use jquery ui in google chrome extension in the content level

  - by user135697

  The problem is that the scope of the content script is on the web page that your plugin is suppose to be used at. So the css background:url(images/ui-bg_inset-hard_100_fcfdfd_1x100.png) becomes url('http://webpageforplugin/images/ui-bg_inset-hard_100_fcfdfd_1x100.png') in order for this to work as far as i understood i need to have it to point to: url('chrome-extension://extensionId/images/ui-bg_inset-hard_100_fcfdfd_1x100.png') So i tried to haxorz the document.styleSheets var ss = document.styleSheets; for (var i=0; i<ss.length; i++) { var found=-1, x,i; var rules = ss[i].cssRules || ss[i].rules; for (var j=0; j<rules.length; j++) { if ('.ui-helper-hidden'==rules[j].selectorText){ found=i; break; } } if (found>-1){ for (var j=0; j<rules.length; j++) { if (x=rules[j].style.background){ if ((i=x.indexOf('url'))!=-1) rules[j].style.background = x.replace('http://page/images/','chrome-extension://extensionId/images/'); } } break; } }; I feel that i'm missing the obvious. That there must be an easier way. Even if i manage to change this how will i get the extension id to build the string. Btw this doesn't work, the icons are not properly fetched. (I hardcoded the extension id) Any ideas?

  Read the article

• What shall be the code in xaml which makes a particular image to act as a button?

  - by Abhi

  Dear all I am new to Silverlight. And i have to make a demo application where in designing is done by using Microsoft Expression Blend 2 and developing should be done using Visual Studio(c++). Now i am first trying to become familiar with xaml files. So i was trying to make a simple demo where in i have to create a button and that button should be replace with an png image. In order to do so i tried with the mentioned below example. But i was not able to see anything in the screen. <UserControl xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" x:Class="SilverlightApplication1.Page" Width="640" Height="480"> <Grid x:Name="LayoutRoot" Background="White"> <Button x:Name="LogoutButton" > <Button.Template> <ControlTemplate> <Image Source="SilverlightApplication1\bounce_photo.png" /> </ControlTemplate> </Button.Template> </Button> </Grid> Please let me know where i am wrong and what shall i do to obtain the result. With regards Abhineet Agarwal

  Read the article

• PostgreSQL: return select count(*) from old_ids;

  - by Alexander Farber

  Hello, please help me with 1 more PL/pgSQL question. I have a PHP-script run as daily cronjob and deleting old records from 1 main table and few further tables referencing its "id" column: create or replace function quincytrack_clean() returns integer as $BODY$ begin create temp table old_ids (id varchar(20)) on commit drop; insert into old_ids select id from quincytrack where age(QDATETIME) > interval '30 days'; delete from hide_id where id in (select id from old_ids); delete from related_mks where id in (select id from old_ids); delete from related_cl where id in (select id from old_ids); delete from related_comment where id in (select id from old_ids); delete from quincytrack where id in (select id from old_ids); return select count(*) from old_ids; end; $BODY$ language plpgsql; And here is how I call it from the PHP script: $sth = $pg->prepare('select quincytrack_clean()'); $sth->execute(); if ($row = $sth->fetch(PDO::FETCH_ASSOC)) printf("removed %u old rows\n", $row['count']); Why do I get the following error? SQLSTATE[42601]: Syntax error: 7 ERROR: syntax error at or near "select" at character 9 QUERY: SELECT select count(*) from old_ids CONTEXT: SQL statement in PL/PgSQL function "quincytrack_clean" near line 23 Thank you! Alex

  Read the article

• sql server mdf file database attachment

  - by jnsohnumr

  hello all i'm having a bear of a time getting visual studio 2010 (ultimate i think) to properly attach to my database. it was moved from original spot to #MYAPP#/#MYAPP#.Web/App_Data/#MDF_FILE#.mdf. I have three instances of sql server running on this machine. i have tried to replace the old mdf file with my new one and cannot get the connectionstring right for it. what i'm really wanting to do is to just open some DB instance, run a DB create script. Then I can have a DB that was generated via my edmx (generate database from model) in silverlight business application (c#) right now, when i go to server explorer in VS, choose add new connection, choose MS SQL Server Database FIle (SqlClient), choose my file location (app_data directory), use windows authentication, and hit the Test Connection button I get the following error: Unable to open the physical file "". Operating system error 5: "5(Access Denied.)". An attempt to attach to an auto-named database for file"" failed. A database with the same name exists, or specified file cannot be opened, or it is located on UNC share. The mdf file was created on the same machine by connecting to (local) on the sql server management studio, getting a new query, pasting in the SQL from the generated ddl file, adding a CREATE DATABASE [NcrCarDatabase]; GO before the pasted SQL, and executing the query. I then disconnected from the DB in management studio, closed management studio, navigated to the DATA directory for that instance, and copying the mdf and ldf files to my application's app_data folder. I am then trying to connect to the same file inside visual studio. I hope that gives more clarity to my problems :). Connection string is: Data Source=.\SQLEXPRESS;AttachDbFilename=C:\SourceCode\NcrCarDatabase\NcrCarDatabase.Web\App_Data\NcrCarDatabase.mdf;Integrated Security=True;Connect Timeout=30;User Instance=True

  Read the article

• Creating a three level ASP.NET menu with SiteMap, how do i do it?

  - by user270399

  I want to create a three level menu, I have got a recursive function today that works with three levels. But the thing is how do i output the third lever? Using two repeaters i have managed to get a hold of the first two levels through the ChildNodes property. But that only gives me the second level. What if a want the third level? Example code below. How do i get the third level? :) <asp:Repeater ID="FirstLevel" DataSourceID="SiteMapDataSource" runat="server" EnableViewState="false"> <ItemTemplate> <li class="top"> <a href='/About/<%#Eval("Title")%>.aspx' class="top_link"><span class="down"><%#Eval("Title")%></span><!--[if gte IE 7]><!--></a><!--<![endif]--> <asp:Repeater runat="server" ID="SecondLevel" DataSource='<%#((SiteMapNode)Container.DataItem).ChildNodes%>'> <HeaderTemplate><!--[if lte IE 6]><table><tr><td><![endif]--><ul class="sub"></HeaderTemplate> <ItemTemplate> <li> <a href='<%#((string)Eval("Url")).Replace("~", "")%>' style="text-align: left;"><%#Eval("Title")%></a> Third repeater here? </li> </ItemTemplate> <FooterTemplate></ul><!--[if lte IE 6]></td></tr></table></a><![endif]--></FooterTemplate> </asp:Repeater> </li> </ItemTemplate> </asp:Repeater>

  Read the article

• Powershell finding services using a cmdlet dll

  - by bartonm

  I need to upgrade a dll assemblies, written in C#, in our installation. Before I replace the DLL file, I want to check if the file has a lock and if so display a message. How do I implement this in powershell? I was thinking iterate through Get-Process checking dependencies. Solved. I iterated through list looking a file path match. function IsCaradigmPowershellDLLFree() { # The list of DLLs to check for locks by running processes. $DllsToCheckForLocks = "$env:ProgramFiles\Caradigm Platform\System 3.0\Platform\PowerShell\Caradigm.Platform.Powershell.dll", "$env:ProgramFiles\Caradigm Platform\System 3.0\Platform\PowerShell\Caradigm.Platform.Powershell.InternalPlatformSetup.dll"; # Assume true, then check all process dependencies $result = $true; # Iterate through each process and check module dependencies foreach ($p in Get-Process) { # Iterate through each dll used in a given process foreach ($m in Get-Process -Name $p.ProcessName -Module -ErrorAction SilentlyContinue) { # Check if dll dependency match any DLLs in list foreach ($dll in $DllsToCheckForLocks) { # Compare the fully-qualified file paths, # if there's a match then a lock exists. if ( ($m.FileName.CompareTo($dll) -eq 0) ) { $pName = $p.ProcessName.ToString() Write-Error "$dll is locked by $pName. This dll must be have zero locked prior to upgrade. Stop this service to release this lock on $m1." $result = $false; } } } } return $result; }

  Read the article

• [CODE GENERATION] How to generate DELETE statements in PL/SQL, based on the tables FK relations?

  - by The chicken in the kitchen

  Is it possible via script/tool to generate authomatically many delete statements based on the tables fk relations, using Oracle PL/SQL? In example: I have the table: CHICKEN (CHICKEN_CODE NUMBER) and there are 30 tables with fk references to its CHICKEN_CODE that I need to delete; there are also other 150 tables foreign-key-linked to that 30 tables that I need to delete first. Is there some tool/script PL/SQL that I can run in order to generate all the necessary delete statements based on the FK relations for me? (by the way, I know about cascade delete on the relations, but please pay attention: I CAN'T USE IT IN MY PRODUCTION DATABASE, because it's dangerous!) I'm using Oracle DataBase 10G R2. This is the result I've written, but it is not recursive: This is a view I have previously written, but of course it is not recursive! CREATE OR REPLACE FORCE VIEW RUN ( OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME, VINCOLO ) AS SELECT OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME, '(' || LTRIM ( EXTRACT (XMLAGG (XMLELEMENT ("x", ',' || COLUMN_NAME)), '/x/text()'), ',') || ')' VINCOLO FROM ( SELECT CON1.OWNER OWNER_1, CON1.TABLE_NAME TABLE_NAME_1, CON1.CONSTRAINT_NAME CONSTRAINT_NAME_1, CON1.DELETE_RULE, CON1.STATUS, CON.TABLE_NAME, CON.CONSTRAINT_NAME, COL.POSITION, COL.COLUMN_NAME FROM DBA_CONSTRAINTS CON, DBA_CONS_COLUMNS COL, DBA_CONSTRAINTS CON1 WHERE CON.OWNER = 'TABLE_OWNER' AND CON.TABLE_NAME = 'TABLE_OWNED' AND ( (CON.CONSTRAINT_TYPE = 'P') OR (CON.CONSTRAINT_TYPE = 'U')) AND COL.TABLE_NAME = CON1.TABLE_NAME AND COL.CONSTRAINT_NAME = CON1.CONSTRAINT_NAME --AND CON1.OWNER = CON.OWNER AND CON1.R_CONSTRAINT_NAME = CON.CONSTRAINT_NAME AND CON1.CONSTRAINT_TYPE = 'R' GROUP BY CON1.OWNER, CON1.TABLE_NAME, CON1.CONSTRAINT_NAME, CON1.DELETE_RULE, CON1.STATUS, CON.TABLE_NAME, CON.CONSTRAINT_NAME, COL.POSITION, COL.COLUMN_NAME) GROUP BY OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME; ... and it contains the error of using DBA_CONSTRAINTS instead of ALL_CONSTRAINTS...

  Read the article

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

• Exporting emails from outlook programtically with vba

  - by David

  I'm using this script to export email from outlook. My question is how do I export the body of the email without the html formatting ? Sub SaveItemsToExcel() On Error GoTo ErrorHandlerExit Dim oNameSpace As Outlook.NameSpace Dim oFolder As Outlook.MAPIFolder Dim objFS As Scripting.FileSystemObject Dim objOutputFile As Scripting.TextStream Set objFS = New Scripting.FileSystemObject Set objOutputFile = objFS.OpenTextFile("C:\Temp\Export.csv", ForWriting, True) Set oNameSpace = Application.GetNamespace("MAPI") Set oFolder = oNameSpace.PickFolder If oFolder Is Nothing Then GoTo ErrorHandlerExit End If If oFolder.DefaultItemType <> olMailItem Then MsgBox "Folder does not contain mail messages" GoTo ErrorHandlerExit End If objOutputFile.WriteLine "From,Subject,Recived, Body" ProcessFolderItems oFolder, objOutputFile objOutputFile.Close Set oFolder = Nothing Set oNameSpace = Nothing Set objOutputFile = Nothing Set objFS = Nothing ErrorHandlerExit: Exit Sub End Sub Sub ProcessFolderItems(oParentFolder As Outlook.MAPIFolder, ByRef objOutputFile As Scripting.TextStream) Dim oCount As Integer Dim oMail As Outlook.MailItem Dim oFolder As Outlook.MAPIFolder oCount = oParentFolder.Items.Count For Each oMail In oParentFolder.Items If oMail.Class = olMail Then objOutputFile.WriteLine oMail.SenderEmailAddress & "," & Replace(oMail.Subject, ",", "") & "," & oMail.ReceivedTime End If Next oMail Set oMail = Nothing If (oParentFolder.Folders.Count > 0) Then For Each oFolder In oParentFolder.Folders ProcessFolderItems oFolder, objOutputFile Next End If End Sub

  Read the article

• Trouble with building up a string in Clojure

  - by Aki Iskandar

  Hi gang - [this may seem like my problem is with Compojure, but it isn't - it's with Clojure] I've been pulling my hair out on this seemingly simple issue - but am getting nowhere. I am playing with Compojure (a light web framework for Clojure) and I would just like to generate a web page showing showing my list of todos that are in a PostgreSQL database. The code snippets are below (left out the database connection, query, etc - but that part isn't needed because specific issue is that the resulting HTML shows nothing between the <body> and </body> tags). As a test, I tried hard-coding the string in the call to main-layout, like this: (html (main-layout "Aki's Todos" "Haircut<br>Study Clojure<br>Answer a question on Stackoverfolw")) - and it works fine. So the real issue is that I do not believe I know how to build up a string in Clojure. Not the idiomatic way, and not by calling out to Java's StringBuilder either - as I have attempted to do in the code below. A virtual beer, and a big upvote to whoever can solve it! Many thanks! ============================================================= ;The master template (a very simple POC for now, but can expand on it later) (defn main-layout "This is one of the html layouts for the pages assets - just like a master page" [title body] (html [:html [:head [:title title] (include-js "todos.js") (include-css "todos.css")] [:body body]])) (defn show-all-todos "This function will generate the todos HTML table and call the layout function" [] (let [rs (select-all-todos) sbHTML (new StringBuilder)] (for [rec rs] (.append sbHTML (str rec "<br><br>"))) (html (main-layout "Aki's Todos" (.toString sbHTML))))) ============================================================= Again, the result is a web page but with nothing between the body tags. If I replace the code in the for loop with println statements, and direct the code to the repl - forgetting about the web page stuff (ie. the call to main-layout), the resultset gets printed - BUT - the issue is with building up the string. Thanks again. ~Aki

  Read the article

• Django + jquery : getting 301

  - by llazzaro

  Hello, I have tabs that calls via javascript urls of django to complete the "container" But i am getting 301, any idea why this is happening? Server misconfiguration? urls.py urlpatterns = patterns('', (r'^admin/', include(admin.site.urls)), (r'^list/', 'carsproj.cars.views.list'), ) view def list(request): if request.is_ajax(): return render_to_response('templates/generic_list.html', { 'items' : Cars.objects.all(), 'name' : 'List - Cars' }, context_instance = RequestContext(request)) javascript the_tabs.click(function(e){ var element = $(this); if(element.find('#overLine').length) return false; var bg = element.attr('class').replace('tab ',''); $('#overLine').remove(); $('<div>',{ id:'overLine', css:{ display:'none', width:element.outerWidth()-2, background:topLineColor[bg] || 'white' }}).appendTo(element).fadeIn('slow'); if(!element.data('cache')) { $('#contentHolder').html('<img src="/media/img/ajax_preloader.gif" width="64" height="64" class="preloader" />'); $.get(element.data('page'),function(msg){ $('#contentHolder').html(msg); element.data('cache',msg); }); } else $('#contentHolder').html(element.data('cache')); e.preventDefault(); }) Please tell me what more information you need, js code? template? url.py? I WILL EDIT THIS POST FOR ADD MORE DATA

  Read the article

• Starting Beyond Compare from the Command Line

  - by Logan

  I have Beyond Compare 3 installed at; "C:\Program Files\Beyond Compare 3\BCompare.exe" and Cygwin; "C:\Cygwin\bin\bash.exe" What I would like is to be able to use a command such as; diff <file1> <file2> into the Cygwin shell and to have the shell fork a process opening the two files in beyond compare. I looked at the Beyond Compare Support Page but I'm afraid It was too brief for me. I tried copying the text verbatim (apart from path to executable) to no avail; Instead of using a batch file, create a file named "bc.sh" with the following line: "$(cygpath 'C:\Progra~1\Beyond~1\bcomp.exe')" `cygpath -w "$6"` `cygpath -w "$7"` /title1="$3" /title2="$5" /readonly Was I supposed to replace cygpath? I get a 'Command not found' error when I enter the name of the script on the command line. gavina@whwgavina1 /cygdrive $ "C:\Documents and Settings\gavina\Desktop\bc.sh" bash: C:\Documents and Settings\gavina\Desktop\bc.sh: command not found Does anyone have Beyond Compare working as I have described? Is this even possible in a Windows environment? Thanks in advance!

  Read the article

• How do I make custom functions chain-able with jQuery's?

  - by sergio

  I need a "callfront" or "precall" (the opposite of "callback" ¿?) to add in MANY places before an animation occurs in an existing plugin, To be used like e.g. $(some_unpredictable_obj).preFunct().animate(… The problem is, as I said they are MANY places, and all of them are different animations, on different objects. I can TELL where all of them occur, but I don't want to add over and over the same code. I actually have to add both a function before and after those animations, but I think I can use the callback for all of them. In a perfect world, I'd like to replace every animate(property, duration) by preFunct().animate(property,duration).postFunct() preFunct and postFunct don't need parameters, since they are always the same action, on the same object. This could be an amazing addition to "jQuery" (an easy way to jQuerize custom functions to be added to the normal chain (without messing with queues) I found this example but it will act on the applied element, and I don't want that because, as I said above, all the original animations to be added to are on different elements. I also found jQuery.timing, but it looks cooler the chain-able function :) Thanks.

  Read the article

• Merge computed data from two tables back into one of them

  - by Tyler McHenry

  I have the following situation (as a reduced example). Two tables, Measures1 and Measures2, each of which store an ID, a Weight in grams, and optionally a Volume in fluid onces. (In reality, Measures1 has a good deal of other data that is irrelevant here) Contents of Measures1: +----+----------+--------+ | ID | Weight | Volume | +----+----------+--------+ | 1 | 100.0000 | NULL | | 2 | 200.0000 | NULL | | 3 | 150.0000 | NULL | | 4 | 325.0000 | NULL | +----+----------+--------+ Contents of Measures2: +----+----------+----------+ | ID | Weight | Volume | +----+----------+----------+ | 1 | 75.0000 | 10.0000 | | 2 | 400.0000 | 64.0000 | | 3 | 100.0000 | 22.0000 | | 4 | 500.0000 | 100.0000 | +----+----------+----------+ These tables describe equivalent weights and volumes of a substance. E.g. 10 fluid ounces of substance 1 weighs 75 grams. The IDs are related: ID 1 in Measures1 is the same substance as ID 1 in Measures2. What I want to do is fill in the NULL volumes in Measures1 using the information in Measures2, but keeping the weights from Measures1 (then, ultimately, I can drop the Measures2 table, as it will be redundant). For the sake of simplicity, assume that all volumes in Measures1 are NULL and all volumes in Measures2 are not. I can compute the volumes I want to fill in with the following query: SELECT Measures1.ID, Measures1.Weight, (Measures2.Volume * (Measures1.Weight / Measures2.Weight)) AS DesiredVolume FROM Measures1 JOIN Measures2 ON Measures1.ID = Measures2.ID; Producing: +----+----------+-----------------+ | ID | Weight | DesiredVolume | +----+----------+-----------------+ | 4 | 325.0000 | 65.000000000000 | | 3 | 150.0000 | 33.000000000000 | | 2 | 200.0000 | 32.000000000000 | | 1 | 100.0000 | 13.333333333333 | +----+----------+-----------------+ But I am at a loss for how to actually insert these computed values into the Measures1 table. Preferably, I would like to be able to do it with a single query, rather than writing a script or stored procedure that iterates through every ID in Measures1. But even then I am worried that this might not be possible because the MySQL documentation says that you can't use a table in an UPDATE query and a SELECT subquery at the same time, and I think any solution would need to do that. I know that one workaround might be to create a new table with the results of the above query (also selecting all of the other non-Volume fields in Measures1) and then drop both tables and replace Measures1 with the newly-created table, but I was wondering if there was any better way to do it that I am missing.

  Read the article

• Sharing same vector control between different places

  - by Alexander K

  Hi everyone, I'm trying to implement the following: I have an Items Manager, that has an Item class inside. Item class can store two possible visual representations of it - BitmapImage(bitmap) and UserControl(vector). Then later, in the game, I need to share the same image or vector control between all possible places it takes place. For example, consider 10 trees on the map, and all point to the same vector control. Or in some cases this can be bitmap image source. So, the problem is that BitmapImage source can be easily shared in the application by multiple UIElements. However, when I try to share vector control, it fails, and says Child Element is already a Child element of another control. I want to know how to organize this in the best way. For example replace UserControl with other type of control, or storage, however I need to be sure it supports Storyboard animations inside. The code looks like this: if (bi.item.BitmapSource != null) { Image previewImage = new Image(); previewImage.Source = bi.item.BitmapSource; itemPane.ItemPreviewCanvas.Children.Add(previewImage); } else if (bi.item.VectorSource != null) { UserControl previewControl = bi.item.VectorSource; itemPane.ItemPreviewCanvas.Children.Add(previewControl); } Thanks in advance

  Read the article

• Python: Copying files with special characters in path

  - by erikderwikinger

  Hi is there any possibility in Python 2.5 to copy files having special chars (Japanese chars, cyrillic letters) in their path? shutil.copy cannot handle this. here is some example code: import copy, os,shutil,sys fname=os.getenv("USERPROFILE")+"\\Desktop\\testfile.txt" print fname print "type of fname: "+str(type(fname)) fname0 = unicode(fname,'mbcs') print fname0 print "type of fname0: "+str(type(fname0)) fname1 = unicodedata.normalize('NFKD', fname0).encode('cp1251','replace') print fname1 print "type of fname1: "+str(type(fname1)) fname2 = unicode(fname,'mbcs').encode(sys.stdout.encoding) print fname2 print "type of fname2: "+str(type(fname2)) shutil.copy(fname2,'C:\\') the output on a Russian Windows XP C:\Documents and Settings\+????????????\Desktop\testfile.txt type of fname: <type 'str'> C:\Documents and Settings\?????????????\Desktop\testfile.txt type of fname0: <type 'unicode'> C:\Documents and Settings\+????????????\Desktop\testfile.txt type of fname1: <type 'str'> C:\Documents and Settings\?????????????\Desktop\testfile.txt type of fname2: <type 'str'> Traceback (most recent call last): File "C:\Test\getuserdir.py", line 23, in <module> shutil.copy(fname2,'C:\\') File "C:\Python25\lib\shutil.py", line 80, in copy copyfile(src, dst) File "C:\Python25\lib\shutil.py", line 46, in copyfile fsrc = open(src, 'rb') IOError: [Errno 2] No such file or directory: 'C:\\Documents and Settings\\\x80\ xa4\xac\xa8\xad\xa8\xe1\xe2\xe0\xa0\xe2\xae\xe0\\Desktop\\testfile.txt'

  Read the article

• Streaming content to JSF UI

  - by Mark Lewis

  Hello, I was quite happy with my JSF app which read the contents of MQ messages received and supplied them to the UI like this: <rich:panel> <snip> <rich:panelMenuItem label="mylabel" action="#{MyBacking.updateCurrent}"> <f:param name="current" value="mylog.log" /> </rich:panelMenuItem> </snip> </rich:panel> <rich:panel> <a4j:outputPanel ajaxRendered="true"> <rich:insert content="#{MyBacking.log}" highlight="groovy" /> </a4j:outputPanel> </rich:panel> and in MyBacking.java private String logFile = null; ... public String updateCurrent() { FacesContext context=FacesContext.getCurrentInstance(); setCurrent((String)context.getExternalContext().getRequestParameterMap().get("current")); setLog(getCurrent()); return null; } public void setLog(String log) { sendMsg(log); msgBody = receiveMsg(moreargs); logFile = msgBody; } public String getLog() { return logFile; } until the contents of one of the messages was too big and tomcat fell over. Obviously, I thought, I need to change the way it works so that I return some form of stream so that no one object grows so big that the container dies and the content returned by successive messages is streamed to the UI as it comes in. Am I right in thinking that I can replace the work I'm doing now on a String object with a BufferedOutputStream object ie no change to the JSF code and something like this changing at the back end: private BufferedOutputStream logFile = null; public void setLog(String log) { sendMsg(args); logFile = (BufferedOutputStream) receiveMsg(moreargs); } public String getLog() { return logFile; }

  Read the article

• Syntax Error? When parsing XML value

  - by Ace Munim

  I don't know if I'm having a syntax error but the compiler is giving me TypeError: 'undefined' is not an object (evaluating 'xmlDoc.getElementsByTagName("icon")[i].childNodes') Its me giving me this problem when im parsing the XML from my server, my actual javascript code is like this var xmlDoc = Obj.responseXML; var count = 0; if(xmlDoc){ while(count <= xmlDoc.getElementsByTagName("item").length){ document.getElementById("flow").innerHTML += "<div class='item'><img class='content' src='" + xmlDoc.getElementsByTagName("icon")[i].childNodes[0].nodeValue.replace(/\s+$/g,' ') +"' /></div>"; count++; } }else{ alert("Unable to parse!"); } and my XML goes like this. <feed> <item> <title>Given Title</title> <icon> http://i178.photobucket.com/albums/w255/ace003_album/Logo-ETC-RGB-e1353503652739.jpg </icon> </item> <item>...</item> <item>...</item> <item>...</item> <item>...</item> <item>...</item> <item>...</item> </feed> i just want to parse the image link and to show it.

  Read the article

• How to traverse table in Jquery and add a class?

  - by SWL

  I have a simple table of two rows. The first column is required, but the others are not; however, I would like them to be required in pairs. So if the user enters a value for Quantity3, then Size3 should also now be required. As a fiddle: http://jsfiddle.net/NaRts/7/ <tr> <td><input name="qty1[492]" class="qty required" type="text"></td> <td><input name="qty2[492]" class="qty" type="text"></td> <td><input name="qty3[492]" class="qty" type="text"></td> </tr><tr> <td><input name="size1[492]" type="text" class="size required" ></td> <td><input name="size2[492]" type="text" class="size" ></td> <td><input name="size3[492]" type="text" class="size" ></td> </tr> And the simple jQuery I have is: $('.qty').keyup(function() { var s = $(this).attr('name'); // = qty3[418] var qtyID = s.replace(/[^1-9\[\]]/g, ""); // = 3[418] var SizeID = "size" + qtyID; var $sizeInput = $(this).closest('tr').next().find(SizeID); $sizeInput.css('background-color', 'green'); $sizeInput.addClass('required'); //I tried this too but it didn't work //$(this).parent().find(SizeID).addClass('required'); });? ? Any help is much appreciated.

  Read the article

• What is the minimal licensable source code?

  - by Hernán Eche

  Let's suppose I want to "protect" this code about being used without attribution, patenting it, or through any open source licence... #include<stdio.h> int main (void) { int version=2; printf("\r\n.Hello world, ver:(%d).", version); return 0; } It's a little obvious or just a language definition example.. When a source stop being "trivial, banal, commonplace, obvious", and start to be something that you may claim "rights"? Perhaps it depends on who read it, something that could be great geniality for someone that have never programmed, could be just obvious for an expert. It's easy when watching two sources there are 10000 same lines of code, that's a theft.. but that's not always so obvious. How to measure amount of "ownness", it's about creativity? line numbers? complexity? I can't imagine objetive answers for that, only some patches. For example perhaps the complexity, It's not fair to replace "years of engeneering" with "copy and paste". But is there any objetive index for objetive determination of this subject? (In a funny way I imagine this criterion: If the licence is longer than the code, then there is no owner, just to punish not caring storage space and world resources =P)

  Read the article

• Problem in Application_Error in Global.asax

  - by mmtemporary

  my problem is User.Identity.Name or Request.Url.AbsoluteUri in exception handling is empty when exception email to me. this is Application_Code: void Application_Error(object sender, EventArgs e) { Server.Transfer("~/errors/default.aspx"); } and this is default.aspx code: protected void Page_Load(object sender, EventArgs e) { if (Server.GetLastError() == null) return; Exception ex = Server.GetLastError().GetBaseException(); if (ex == null) return; string message = string.Format("User: ", User.Identity.Name); message += Environment.NewLine; message += string.Format("AbsoluteUri: ", Request.Url.AbsoluteUri); message += Environment.NewLine; message += string.Format("Form: ", Request.Form.ToString()); message += Environment.NewLine; message += string.Format("QueryString: ", Request.QueryString.ToString()); message += Environment.NewLine; HttpBrowserCapabilities browser = Request.Browser; string s = "Browser Capabilities:\n" + "Type = " + browser.Type + "\n" + "Name = " + browser.Browser + "\n" + "Version = " + browser.Version + "\n" + "Platform = " + browser.Platform + "\n" + "Is Crawler = " + browser.Crawler + "\n" + "Supports Cookies = " + browser.Cookies + "\n" + "Supports JavaScript = " + browser.EcmaScriptVersion.ToString() + "\n" + "\n"; message += s; message += Environment.NewLine; message += ex.ToString(); Exception lastException = (Exception)Application["LastException"]; if (lastException == null || lastException.Message != ex.Message) { Application.Lock(); Application["LastException"] = ex; Application.UnLock(); SiteHelper.SendEmail(SiteHelper.AdministratorEMail, "Error!!!", message, false); } Server.ClearError(); } but i receive email like this (this is header without full exception content): User: AbsoluteUri: Form: QueryString: Browser Capabilities: Type = IE8 Name = IE Version = 8.0 Platform = WinXP Is Crawler = False Supports Cookies = True Supports JavaScript = 1.2 why username and request url is emty? this problem is exist when i replace transfer with redirect or i don't use both. tanx

  Read the article

• Why is Func<T> ambiguous with Func<IEnumerable<T>>?

  - by Matt Hamilton

  This one's got me flummoxed, so I thought I'd ask here in the hope that a C# guru can explain it to me. Why does this code generate an error? class Program { static void Main(string[] args) { Foo(X); // the error is on this line } static String X() { return "Test"; } static void Foo(Func<IEnumerable<String>> x) { } static void Foo(Func<String> x) { } } The error in question: Error 1 The call is ambiguous between the following methods or properties: 'ConsoleApplication1.Program.Foo(System.Func<System.Collections.Generic.IEnumerable<string>>)' and 'ConsoleApplication1.Program.Foo(System.Func<string>)' C:\Users\mabster\AppData\Local\Temporary Projects\ConsoleApplication1\Program.cs 12 13 ConsoleApplication1 It doesn't matter what type I use - if you replace the "String" declarations with "int" in that code you'll get the same sort of error. It's like the compiler can't tell the difference between Func<T> and Func<IEnumerable<T>>. Can someone shed some light on this?

  Read the article

• Is it possible to guarantee a unique id for multiple items using the same id variable at a point in

  - by Scarface

  First of all, do not be overwhelmed by the long code, I just put it for reference...I have a function that preg_replaces content and puts it in a jquery dialog box with a matching open-link. For example, if there is a paragraph with two matches, they will be put inside two divs, and a jquery dialog function will be echoed twice; one for each div. While this works for one match, if there are multiple matches, it does not. I am not sure how to distribute unique ids at a point in time for each of the divs and matching dialog open-scripts. Keep in mind, I removed the preg replace function since it kind of complicates the problem. If anyone has any ideas, they will be greatly appreciated. <?php $id=uniqid(); $id2=uniqid(); echo "<div id=\"$id2\"> </div>"; ?> $.ui.dialog.defaults.bgiframe = true; $(function() { $("<?php echo"#$id2"; ?>").dialog({hide: 'clip', modal: true ,width: 600,height: 350,position: 'center', show: 'clip',stack: true,title: 'title', minHeight: 25, minWidth: 100, autoOpen: false}); $('<?php echo"#$id"; ?>').click(function() { $('<?php echo"#$id2"; ?>').dialog('open'); }) .hover( function(){ $(this).addClass("ui-state-hover"); }, function(){ $(this).removeClass("ui-state-hover"); } ).mousedown(function(){ $(this).addClass("ui-state-active"); }) .mouseup(function(){ $(this).removeClass("ui-state-active"); }); });

  Read the article

< Previous Page | 242 243 244 245 246 247 248 249 250 251 252 253  | Next Page >