Search Results

Search found 7529 results on 302 pages for 'replace'.

Page 246/302 | < Previous Page | 242 243 244 245 246 247 248 249 250 251 252 253  | Next Page >

  • Streaming content to JSF UI

    - by Mark Lewis
    Hello, I was quite happy with my JSF app which read the contents of MQ messages received and supplied them to the UI like this: <rich:panel> <snip> <rich:panelMenuItem label="mylabel" action="#{MyBacking.updateCurrent}"> <f:param name="current" value="mylog.log" /> </rich:panelMenuItem> </snip> </rich:panel> <rich:panel> <a4j:outputPanel ajaxRendered="true"> <rich:insert content="#{MyBacking.log}" highlight="groovy" /> </a4j:outputPanel> </rich:panel> and in MyBacking.java private String logFile = null; ... public String updateCurrent() { FacesContext context=FacesContext.getCurrentInstance(); setCurrent((String)context.getExternalContext().getRequestParameterMap().get("current")); setLog(getCurrent()); return null; } public void setLog(String log) { sendMsg(log); msgBody = receiveMsg(moreargs); logFile = msgBody; } public String getLog() { return logFile; } until the contents of one of the messages was too big and tomcat fell over. Obviously, I thought, I need to change the way it works so that I return some form of stream so that no one object grows so big that the container dies and the content returned by successive messages is streamed to the UI as it comes in. Am I right in thinking that I can replace the work I'm doing now on a String object with a BufferedOutputStream object ie no change to the JSF code and something like this changing at the back end: private BufferedOutputStream logFile = null; public void setLog(String log) { sendMsg(args); logFile = (BufferedOutputStream) receiveMsg(moreargs); } public String getLog() { return logFile; }

    Read the article

  • Is it possible to refer to metadata of the target from within the target implementation in MSBuild?

    - by mark
    Dear ladies and sirs. My msbuild targets file contains the following section: <ItemGroup> <Targets Include="T1"> <Project>A\B.sln"</Project> <DependsOnTargets>The targets T1 depends on</DependsOnTargets> </Targets> <Targets Include="T2"> <Project>C\D.csproj"</Project> <DependsOnTargets>The targets T2 depends on</DependsOnTargets> </Targets> ... </ItemGroup> <Target Name="T1" DependsOnTargets="The targets T1 depends on"> <MSBuild Projects="A\B.sln" Properties="Configuration=$(Configuration)" /> </Target> <Target Name="T2" DependsOnTargets="The targets T2 depends on"> <MSBuild Projects="C\D.csproj" Properties="Configuration=$(Configuration)" /> </Target> As you can see, A\B.sln appears twice: As Project metadata of T1 in the ItemGroup section. In the Target statement itself passed to the MSBuild task. I am wondering whether I can remove the second instance and replace it with the reference to the Project metadata of the target, which name is given to the Target task? Exactly the same question is asked for the (Targets.DependsOnTargets) metadata. It is mentioned twice much like the %(Targets.Project) metadata. Thanks. EDIT: I should probably describe the constraints, which must be satisfied by the solution: I want to be able to build individual projects with ease. Today I can simply execute msbuild file.proj /t:T1 to build the T1 target and I wish to keep this ability. I wish to emphasize, that some projects depend on others, so the DependsOnTargets attribute is really necessary for them.

    Read the article

  • Updating Android Tab Icons

    - by lnediger
    I have an activity which has a TabHost containing a set of TabSpecs each with a listview containing the items to be displayed by the tab. When each TabSpec is created, I set an icon to be displayed in the tab header. The TabSpecs are created in this way within a setupTabs() method which loops to create the appropriate number of tabs: TabSpec ts = mTabs.newTabSpec("tab"); ts.setIndicator("TabTitle", iconResource); ts.setContent(new TabHost.TabContentFactory( { public View createTabContent(String tag) { ... } }); mTabs.addTab(ts); There are a couple instances where I want to be able to change the icon which is displayed in each tab during the execution of my program. Currently I am deleting all the tabs, and calling the above code again to re-create them. mTabs.getTabWidget().removeAllViews(); mTabs.clearAllTabs(true); setupTabs(); Is there a way to replace the icon that is being displayed without deleting and re-creating all of the tabs?

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • IntelliJ Doesn't Notice Changes in Interface

    - by yar
    [I've decided to give IntelliJ another go (to replace Eclipse), since its Groovy support is supposed to be the best. But back to Java...] I have an Interface that defines a constant public static final int CHANNEL_IN = 1; and about 20 classes in my Module that implement that interface. I've decided that this constant was a bad idea so I did what I do in Eclipse: I deleted the entire line. This should cause the Project tree to light up like a Christmas tree and all classes that implement that interface and use that constant to break. Instead, this is not happening. If I don't actually double-click on the relevant classes -- which I find using grep -- the module even builds correctly (using Build - Make Module). If I double-click on a relevant class, the error is shown both in the Project Tree and in the Editor. I am not able to replicate this behavior in small tests, but in large modules it works (incorrectly) this way. Is there some relevant setting in IntelliJ for this?

    Read the article

  • Given a typical Rails 3 environment, why am I unable to execute any tests?

    - by Tom
    I'm working on writing simple unit tests for a Rails 3 project, but I'm unable to actually execute any tests. Case in point, attempting to run the test auto-generated by Rails fails: require 'test_helper' class UserTest < ActiveSupport::TestCase # Replace this with your real tests. test "the truth" do assert true end end Results in the following error: <internal:lib/rubygems/custom_require>:29:in `require': no such file to load -- test_helper (LoadError) from <internal:lib/rubygems/custom_require>:29:in `require' from user_test.rb:1:in `<main>' Commenting out the require 'test_helper' line and attempting to run the test results in this error: user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) The action pack gems appear to be properly installed and up to date: actionmailer (3.0.3, 2.3.5) actionpack (3.0.3, 2.3.5) activemodel (3.0.3) activerecord (3.0.3, 2.3.5) activeresource (3.0.3, 2.3.5) activesupport (3.0.3, 2.3.5) Ruby is at 1.9.2p0 and Rails is at 3.0.3. The sample dump of my test directory is as follows: /fixtures /functional /integration /performance /unit -- /helpers -- user_helper_test.rb -- user_test.rb test_helper.rb I've never seen this problem before - I've run the typical rake tasks for preparing the test environment. I have nothing out of the ordinary in my application or environment configuration files, nor have I installed any unusual gems that would interfere with the test environment. Edit Xavier Holt's suggestion, explicitly specifying the path to the test_helper worked; however, this revealed an issue with ActiveSupport. Now when I attempt to run the test, I receive the following error message (as also listed above): user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) But as you can see above, Action Pack is all installed and update to date.

    Read the article

  • prototype findElements querySelectorAll error

    - by JD
    i'm call the "down" function but am getting an invalid argument using 1.6.1_rc2 here's the html snippet: <TR id=000000214A class="activeRow searchResultsDisplayOver" conceptID="0000001KIU"> <TD> <DIV class=gridRowWrapper> <SPAN class=SynDesc>Asymmetric breasts</SPAN> <DIV class=buttonWrapper> <SPAN class=btnAddFav title="Add to Favorites">&nbsp;</SPAN> </DIV> </DIV> </TD> </TR> here's the code: var description = row.down('span.SynDesc').innerHTML; row is a dom reference to the element. prototype is appending a # then the id of the element: findElements: function(root) { root = root || document; var e = this.expression, results; switch (this.mode) { case 'selectorsAPI': if (root !== document) { var oldId = root.id, id = $(root).identify(); id = id.replace(/[\.:]/g, "\\$0"); e = "#" + id + " " + e; } results = $A(root.querySelectorAll(e)).map(Element.extend); <-- e = "#000000214A span.SynDesc" root.id = oldId; return results; case 'xpath': return document._getElementsByXPath(this.xpath, root); default: return this.matcher(root); } i get an "invalid argument" error? if i put a breakpoint before the offending line and change e to be equal to "span.SynDesc" it works fine. help. :)

    Read the article

  • Word wrap in multiline textbox after 35 characters

    - by Kanavi
    <asp:TextBox CssClass="txt" ID="TextBox1" runat="server" onkeyup="CountChars(this);" Rows="20" Columns="35" TextMode="MultiLine" Wrap="true"> </asp:TextBox> I need to implement word-wrapping in a multi-line textbox. I cannot allow users to write more then 35 chars a line. I am using the following code, which breaks at precisely the specified character on every line, cutting words in half. Can we fix this so that if there's not enough space left for a word on the current line, we move the whole word to the next line? function CountChars(ID) { var IntermediateText = ''; var FinalText = ''; var SubText = ''; var text = document.getElementById(ID.id).value; var lines = text.split("\n"); for (var i = 0; i < lines.length; i++) { IntermediateText = lines[i]; if (IntermediateText.length <= 50) { if (lines.length - 1 == i) FinalText += IntermediateText; else FinalText += IntermediateText + "\n"; } else { while (IntermediateText.length > 50) { SubText = IntermediateText.substring(0, 50); FinalText += SubText + "\n"; IntermediateText = IntermediateText.replace(SubText, ''); } if (IntermediateText != '') { if (lines.length - 1 == i) FinalText += IntermediateText; else FinalText += IntermediateText + "\n"; } } } document.getElementById(ID.id).value = FinalText; $('#' + ID.id).scrollTop($('#' + ID.id)[0].scrollHeight); } Edit - 1 I have to show total max 35 characters in line without specific word break and need to keep margin of two characters from the right. Again, the restriction should be for 35 characters but need space for total 37 (Just for the Visibility issue.)

    Read the article

  • Alternative to using c:out to prevent XSS

    - by lynxforest
    I'm working on preventing cross site scripting (XSS) in a Java, Spring based, Web application. I have already implemented a servlet filter similar to this example http://greatwebguy.com/programming/java/simple-cross-site-scripting-xss-servlet-filter/ which sanitizes all the input into the application. As an extra security measure I would like to also sanitize all output of the application in all JSPs. I have done some research to see how this could be done and found two complementary options. One of them is the use of Spring's defaultHtmlEscape attribute. This was very easy to implement (a few lines in web.xml), and it works great when your output is going through one of spring's tags (ie: message, or form tags). The other option I have found is to not directly use EL expressions such as ${...} and instead use <c:out value="${...}" /> That second approach works perfectly, however due to the size of the application I am working on (200+ JSP files). It is a very cumbersome task to have to replace all inappropriate uses of EL expressions with the c:out tag. Also it would become a cumbersome task in the future to make sure all developers stick to this convention of using the c:out tag (not to mention, how much more unreadable the code would be). Is there alternative way to escape the output of EL expressions that would require fewer code modifications? Thank you in advance.

    Read the article

  • Calc_Anniversary Function with a Loop

    - by Rachel Ann Arndt
    Name: Calc_Anniversary Input: Pay_Date, Hire_Date, Termination_Date Output: "Y" if is the anniversary of the employee's Hire_Date, "N" if it is not, and "T" if he has been terminated before his anniversary. Description: Create local variables to hold the month and day of the employee's Date_of_Hire, Termination_Date, and of the processing date using the TO_CHAR function. First check to see if he was terminated before his anniversary. The anniversary could be on any day during the pay period, so there will be a loop to check all 14 days in the pay period to see if one was his anniversary. CREATE OR replace FUNCTION Calc_anniversary( incoming_anniversary_date IN VARCHAR2) RETURN BOOLEAN IS hiredate VARCHAR2(20); terminationdate VARCHAR(20); employeeid VARCHAR2(38); paydate NUMBER := 0; BEGIN SELECT Count(arndt_raw_time_sheet_data.pay_date) INTO paydate FROM arndt_raw_time_sheet_data; WHILE paydate <= 14 LOOP SELECT To_char(employee_id, '999'), To_char(hire_date, 'DD-MON'), To_char(termination_date, 'DD-MON') INTO employeeid, hiredate, terminationdate FROM employees, time_sheet WHERE employees.employee_id = time_sheet.employee_id AND paydate = pay_date; IF terminationdate > hiredate THEN RETURN 'T'; ELSE IF To_char(SYSDATE, 'DD-MON') = To_char(hiredate, 'DD-MON')THEN RETURN 'Y'; ELSE RETURN 'N'; END IF; END IF; paydate := paydate + 1; END LOOP; END; I need help with the loop..

    Read the article

  • Django + jquery : getting 301

    - by llazzaro
    Hello, I have tabs that calls via javascript urls of django to complete the "container" But i am getting 301, any idea why this is happening? Server misconfiguration? urls.py urlpatterns = patterns('', (r'^admin/', include(admin.site.urls)), (r'^list/', 'carsproj.cars.views.list'), ) view def list(request): if request.is_ajax(): return render_to_response('templates/generic_list.html', { 'items' : Cars.objects.all(), 'name' : 'List - Cars' }, context_instance = RequestContext(request)) javascript the_tabs.click(function(e){ var element = $(this); if(element.find('#overLine').length) return false; var bg = element.attr('class').replace('tab ',''); $('#overLine').remove(); $('<div>',{ id:'overLine', css:{ display:'none', width:element.outerWidth()-2, background:topLineColor[bg] || 'white' }}).appendTo(element).fadeIn('slow'); if(!element.data('cache')) { $('#contentHolder').html('<img src="/media/img/ajax_preloader.gif" width="64" height="64" class="preloader" />'); $.get(element.data('page'),function(msg){ $('#contentHolder').html(msg); element.data('cache',msg); }); } else $('#contentHolder').html(element.data('cache')); e.preventDefault(); }) Please tell me what more information you need, js code? template? url.py? I WILL EDIT THIS POST FOR ADD MORE DATA

    Read the article

  • is it better to test if a function is needed inside or outside of it?

    - by b0x0rz
    what is the best practice? call a function then return if you test for something, or test for something then call? i prefer the test inside of function because it makes an easier viewing of what functions are called. for example: protected void Application_BeginRequest(object sender, EventArgs e) { this.FixURLCosmetics(); } and private void FixURLCosmetics() { HttpContext context = HttpContext.Current; if (!context.Request.HttpMethod.ToString().Equals("GET", StringComparison.OrdinalIgnoreCase)) { // if not a GET method cancel url cosmetics return; }; string url = context.Request.RawUrl.ToString(); bool doRedirect = false; // remove > default.aspx if (url.EndsWith("/default.aspx", StringComparison.OrdinalIgnoreCase)) { url = url.Substring(0, url.Length - 12); doRedirect = true; } // remove > www if (url.Contains("//www")) { url = url.Replace("//www", "//"); doRedirect = true; } // redirect if necessary if (doRedirect) { context.Response.Redirect(url); } } is this good: if (!context.Request.HttpMethod.ToString().Equals("GET", StringComparison.OrdinalIgnoreCase)) { // if not a GET method cancel url cosmetics return; }; or should that test be done in Application_BeginRequest? what is better? thnx

    Read the article

  • Manually Trigger or Prevent Javascript Lazy Loading in Website from Bookmarklet

    - by stwhite
    One of the problems with using a bookmarklet for grabbing images on a page is that if a website uses lazy loading, the bookmarklet won't detect the image because it will have a placeholder, e.g. "grey.gif" and not the actual source of the image. Javascript on page load, is run to replace these urls. I'm looking for a solution to retrieve those images that are not being displayed by either triggering or preventing Lazy Loading from running. This bookmarklet isn't limited to one specific domain. So far some ideas I've had are: Ping the domain and retrieve the page html if no images are found the first time around: Problem: this then requires parsing the actual html. Problem: with lazy loading, a few images will always show, just none below the fold. Scroll page to initiate lazy loading when bookmarklet is clicked, then scroll back to top. Trigger Lazy Loading from inside bookmarklet using script. Lazy Loader adds the "original" attribute, potentially could check if attribute exists w/ value. Problem: ???

    Read the article

  • Creating a three level ASP.NET menu with SiteMap, how do i do it?

    - by user270399
    I want to create a three level menu, I have got a recursive function today that works with three levels. But the thing is how do i output the third lever? Using two repeaters i have managed to get a hold of the first two levels through the ChildNodes property. But that only gives me the second level. What if a want the third level? Example code below. How do i get the third level? :) <asp:Repeater ID="FirstLevel" DataSourceID="SiteMapDataSource" runat="server" EnableViewState="false"> <ItemTemplate> <li class="top"> <a href='/About/<%#Eval("Title")%>.aspx' class="top_link"><span class="down"><%#Eval("Title")%></span><!--[if gte IE 7]><!--></a><!--<![endif]--> <asp:Repeater runat="server" ID="SecondLevel" DataSource='<%#((SiteMapNode)Container.DataItem).ChildNodes%>'> <HeaderTemplate><!--[if lte IE 6]><table><tr><td><![endif]--><ul class="sub"></HeaderTemplate> <ItemTemplate> <li> <a href='<%#((string)Eval("Url")).Replace("~", "")%>' style="text-align: left;"><%#Eval("Title")%></a> Third repeater here? </li> </ItemTemplate> <FooterTemplate></ul><!--[if lte IE 6]></td></tr></table></a><![endif]--></FooterTemplate> </asp:Repeater> </li> </ItemTemplate> </asp:Repeater>

    Read the article

  • How to paginate Django with other get variables?

    - by vagabond
    I am having problems using pagination in Django. Take the URL below as an example: http://127.0.0.1:8000/users/?sort=first_name On this page I sort a list of users by their first_name. Without a sort GET variable it defaults to sort by id. Now if I click the next link I expect the following URL: http://127.0.0.1:8000/users/?sort=first_name&page=2 Instead I lose all get variables and end up with http://127.0.0.1:8000/users/?page=2 This is a problem because the second page is sorted by id instead of first_name. If I use request.get_full_path I will eventually end up with an ugly URL: http://127.0.0.1:8000/users/?sort=first_name&page=2&page=3&page=4 What is the solution? Is there a way to access the GET variables on the template and replace the value for the page? I am using pagination as described in Django's documentation and my preference is to keep using it. The template code I am using is similar to this: {% if contacts.has_next %} <a href="?page={{ contacts.next_page_number }}">next</a> {% endif %}

    Read the article

  • How to get the most out of a 3 month intern?

    - by firoso
    We've got a software engineering intern coming in who's fairly competent and shows promise. There's one catch: we have him for 3 months full time and can't count on anything past that. He still has a year of school left, which is why we can't say for sure that we have him past 3 months. We have a specific project we're putting him on. How can we maximize his productivity while still giving him a positive learning experience? He wants to learn about development cycles and real-world software engineering. Anything that you think would be critical that you wish you had learned earlier? Nearly six months later: He's preformed admirably and even I have learned a lot from him. Thank you all for the input. Now I want to provide feedback to YOU! He has benefited most from sitting down and writing code. However, he has had a nasty history of bad software engineering practices which I'm trying to replace with good habits (properly finishing a method before moving on, not hacking code together, proper error channeling, etc). He has also really gained a lot by feeling involved in design decisions, even if most of the time they're related to my own design plans.

    Read the article

  • -[UITableViewRowData isEqualToString:]: unrecognized selector sent to instance 0x391dce0

    - by tak
    I have a datatable which shows the list of contacts. when I start the application all the data is loaded correctly.But after selecting a contact, I am sometimes getting this exception :- Program received signal: “EXC_BAD_ACCESS”. and sometimes -[UITableViewRowData isEqualToString:]: unrecognized selector sent to instance 0x391dce0 most probably for this code:- - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *CellIdentifier = @"Cell"; UITableViewCell *cell = [tableView dequeueReusableCellWithIdentifier:CellIdentifier]; if (cell == nil) { cell = [[[UITableViewCell alloc] initWithStyle:UITableViewCellStyleDefault reuseIdentifier:CellIdentifier] autorelease]; } ExpenseTrackerAppDelegate *appDelegate = (ExpenseTrackerAppDelegate *)[[UIApplication sharedApplication] delegate]; Person *person = (Person *)[appDelegate.expensivePersonsList objectAtIndex:indexPath.row]; NSString *name = (NSString *)[NSMutableString stringWithFormat:@"%@ %@" ,person.lastName , person.firstName]; cell.textLabel.text = name; //cell.detailTextLabel.text = person.lastName; // Configure the cell. return cell; } If I replace these lines of code NSString *name = (NSString *)[NSMutableString stringWithFormat:@"%@ %@" ,person.lastName , person.firstName]; cell.textLabel.text = name; with this code cell.textLabel.text = person.lastName; then everything works fine? I dont know what exactly happens?

    Read the article

  • Trouble with building up a string in Clojure

    - by Aki Iskandar
    Hi gang - [this may seem like my problem is with Compojure, but it isn't - it's with Clojure] I've been pulling my hair out on this seemingly simple issue - but am getting nowhere. I am playing with Compojure (a light web framework for Clojure) and I would just like to generate a web page showing showing my list of todos that are in a PostgreSQL database. The code snippets are below (left out the database connection, query, etc - but that part isn't needed because specific issue is that the resulting HTML shows nothing between the <body> and </body> tags). As a test, I tried hard-coding the string in the call to main-layout, like this: (html (main-layout "Aki's Todos" "Haircut<br>Study Clojure<br>Answer a question on Stackoverfolw")) - and it works fine. So the real issue is that I do not believe I know how to build up a string in Clojure. Not the idiomatic way, and not by calling out to Java's StringBuilder either - as I have attempted to do in the code below. A virtual beer, and a big upvote to whoever can solve it! Many thanks! ============================================================= ;The master template (a very simple POC for now, but can expand on it later) (defn main-layout "This is one of the html layouts for the pages assets - just like a master page" [title body] (html [:html [:head [:title title] (include-js "todos.js") (include-css "todos.css")] [:body body]])) (defn show-all-todos "This function will generate the todos HTML table and call the layout function" [] (let [rs (select-all-todos) sbHTML (new StringBuilder)] (for [rec rs] (.append sbHTML (str rec "<br><br>"))) (html (main-layout "Aki's Todos" (.toString sbHTML))))) ============================================================= Again, the result is a web page but with nothing between the body tags. If I replace the code in the for loop with println statements, and direct the code to the repl - forgetting about the web page stuff (ie. the call to main-layout), the resultset gets printed - BUT - the issue is with building up the string. Thanks again. ~Aki

    Read the article

  • Is it possible to guarantee a unique id for multiple items using the same id variable at a point in

    - by Scarface
    First of all, do not be overwhelmed by the long code, I just put it for reference...I have a function that preg_replaces content and puts it in a jquery dialog box with a matching open-link. For example, if there is a paragraph with two matches, they will be put inside two divs, and a jquery dialog function will be echoed twice; one for each div. While this works for one match, if there are multiple matches, it does not. I am not sure how to distribute unique ids at a point in time for each of the divs and matching dialog open-scripts. Keep in mind, I removed the preg replace function since it kind of complicates the problem. If anyone has any ideas, they will be greatly appreciated. <?php $id=uniqid(); $id2=uniqid(); echo "<div id=\"$id2\"> </div>"; ?> $.ui.dialog.defaults.bgiframe = true; $(function() { $("<?php echo"#$id2"; ?>").dialog({hide: 'clip', modal: true ,width: 600,height: 350,position: 'center', show: 'clip',stack: true,title: 'title', minHeight: 25, minWidth: 100, autoOpen: false}); $('<?php echo"#$id"; ?>').click(function() { $('<?php echo"#$id2"; ?>').dialog('open'); }) .hover( function(){ $(this).addClass("ui-state-hover"); }, function(){ $(this).removeClass("ui-state-hover"); } ).mousedown(function(){ $(this).addClass("ui-state-active"); }) .mouseup(function(){ $(this).removeClass("ui-state-active"); }); });

    Read the article

  • Boost multi_index_container crash in release mode

    - by Zan Lynx
    I have a program that I just changed to using a boost::multi_index_container collection. After I did that and tested my code in debug mode, I was feeling pretty good about myself. However, then I compiled a release build with NDEBUG set, and the code crashed. Not immediately, but sometimes in single-threaded tests and often in multi-threaded tests. The segmentation faults happen deep inside boost insert and rotate functions related to the index updates and they are happening because a node has NULL left and right pointers. My code looks a bit like this: struct Implementation { typedef std::pair<uint32_t, uint32_t> update_pair_type; struct watch {}; struct update {}; typedef boost::multi_index_container< update_pair_type, boost::multi_index::indexed_by< boost::multi_index::ordered_unique< boost::multi_index::tag<watch>, boost::multi_index::member<update_pair_type, uint32_t, &update_pair_type::first> >, boost::multi_index::ordered_non_unique< boost::multi_index::tag<update>, boost::multi_index::member<update_pair_type, uint32_t, &update_pair_type::second> > > > update_map_type; typedef std::vector< update_pair_type > update_list_type; update_map_type update_map; update_map_type::iterator update_hint; void register_update(uint32_t watch, uint32_t update); void do_updates(uint32_t start, uint32_t end); }; void Implementation::register_update(uint32_t watch, uint32_t update) { update_pair_type new_pair( watch_offset, update_offset ); update_hint = update_map.insert(update_hint, new_pair); if( update_hint->second != update_offset ) { bool replaced _unused_ = update_map.replace(update_hint, new_pair); assert(replaced); } }

    Read the article

  • Sharing same vector control between different places

    - by Alexander K
    Hi everyone, I'm trying to implement the following: I have an Items Manager, that has an Item class inside. Item class can store two possible visual representations of it - BitmapImage(bitmap) and UserControl(vector). Then later, in the game, I need to share the same image or vector control between all possible places it takes place. For example, consider 10 trees on the map, and all point to the same vector control. Or in some cases this can be bitmap image source. So, the problem is that BitmapImage source can be easily shared in the application by multiple UIElements. However, when I try to share vector control, it fails, and says Child Element is already a Child element of another control. I want to know how to organize this in the best way. For example replace UserControl with other type of control, or storage, however I need to be sure it supports Storyboard animations inside. The code looks like this: if (bi.item.BitmapSource != null) { Image previewImage = new Image(); previewImage.Source = bi.item.BitmapSource; itemPane.ItemPreviewCanvas.Children.Add(previewImage); } else if (bi.item.VectorSource != null) { UserControl previewControl = bi.item.VectorSource; itemPane.ItemPreviewCanvas.Children.Add(previewControl); } Thanks in advance

    Read the article

  • Ajax request gets to server but page doesn't update - Rails, jQuery

    - by Jesse
    So I have a scenario where my jQuery ajax request is hitting the server, but the page won't update. I'm stumped... Here's the ajax request: $.ajax({ type: 'GET', url: '/jsrender', data: "id=" + $.fragment().nav.replace("_link", "") }); Watching the rails logs, I get the following: Processing ProductsController#jsrender (for 127.0.0.1 at 2010-03-17 23:07:35) [GET] Parameters: {"action"=>"jsrender", "id"=>"products", "controller"=>"products"} ... Rendering products/jsrender.rjs Completed in 651ms (View: 608, DB: 17) | 200 OK [http://localhost/jsrender?id=products] So, it seems apparent to me that the ajax request is getting to the server. The code in the jsrender method is being executed, but the code in the jsrender.rjs doesn't fire. Here's the method, jsrender: def jsrender @currentview = "shared/#{params[:id]}" respond_to do |format| format.js {render :template => 'products/jsrender.rjs'} end end For the sake of argument, the code in jsrender.rjs is: page<<"alert('this works!');" Why is this? I see in the params that there is no authenticity_token, but I have tried passing an authenticity_token as well with the same result. Thanks in advance.

    Read the article

  • Android: Capturing the return of an activity.

    - by Chrispix
    I have a question regarding launching new activities. It boils down to this. I have 3 tabs on a view A) contains gMap activity B) camera activity C) some random text fields. Requirement is that the application runs in Portrait mode. All 3 tabs work as expected w/ the exception of the Camera Preview Surface (B). It is rotated 90 degrees. They only way to make it correct is to set the app to landscape which throws all my tabs around, and is pretty much unworkable. My solution is this : replace my camera activity with a regular activity that is empty w/ the exception of Intent i = new Intent(this,CameraActivity.class); startActivity(i); This launches my CameraActivity. And that works fine. I had to do a linear layout and include 3 images that look like real tabs, so I can try and mimic the operation of the tabs while rotating the screen to landscape and keep the visuals as portrait. The user can click one of the images(buttons) to display the next tab. This is my issue. It should exit my 'camera activity' returning to the 'blank activity' in a tab, where it should be interpreted to click the desiered tab from my image. The main thing is, when it returns, it returns to a blank (black) page under a tab (because it is 'empty'). How can I capture the return event back to the page that called the activity, and then see what action they performed? I can set an onclicklistener where I can respond to the fake tabs (images) being clicked to exit out of the camera activity. On exit, the tab should update so that is where you return. any Suggestions? Thanks,

    Read the article

  • Server Push CGI Perl Problem writing the JPEG image

    - by Jujjuru
    I am a beginner in Perl CGI etc. I was experimenting with server-push concept with a piece of perl code. It is supposed to send a jpeg image to the client every 3 seconds. Unfortunately nothing seems to work. Can somebody help identify the problem? Here is the code.... use strict; # turn off io buffering $|=1; print "Content-type: multipart/x-mixed-replace;"; print "boundary=magicalboundarystring\n\n"; print "--magicalboundarystring\n"; #list the jpg images my(@file_list) = glob "*.jpg"; my($file) = ""; foreach $file(@file_list ) { open FILE,">", $file or die "Cannot open file $file: $!"; print "Content-type: image/jpeg\n\n"; while ( <FILE> ) { print "$_"; } close FILE; print "\n--magicalboundarystring\n"; sleep 3; next; } EDIT: added turn off i/o buffering, added "use strict" and "@file_list", "$file" are made local

    Read the article

  • How can I send multiple images in a server push Perl CGI program?

    - by Jujjuru
    I am a beginner in Perl CGI etc. I was experimenting with server-push concept with a piece of Perl code. It is supposed to send a jpeg image to the client every three seconds. Unfortunately nothing seems to work. Can somebody help identify the problem? Here is the code: use strict; # turn off io buffering $|=1; print "Content-type: multipart/x-mixed-replace;"; print "boundary=magicalboundarystring\n\n"; print "--magicalboundarystring\n"; #list the jpg images my(@file_list) = glob "*.jpg"; my($file) = ""; foreach $file(@file_list ) { open FILE,">", $file or die "Cannot open file $file: $!"; print "Content-type: image/jpeg\n\n"; while ( <FILE> ) { print "$_"; } close FILE; print "\n--magicalboundarystring\n"; sleep 3; next; } EDIT: added turn off i/o buffering, added "use strict" and "@file_list", "$file" are made local

    Read the article

< Previous Page | 242 243 244 245 246 247 248 249 250 251 252 253  | Next Page >