Search Results

Search found 20799 results on 832 pages for 'long integer'.

Page 252/832 | < Previous Page | 248 249 250 251 252 253 254 255 256 257 258 259  | Next Page >

  • Custom Java Swing Meter Control

    - by Tyler
    I'm trying to make a custom swing control that is a meter. The arrow will move up and down. Here is my current code, but I feel I've done it wrong. import java.awt.BasicStroke; import java.awt.Color; import java.awt.Graphics; import java.awt.Graphics2D; import java.awt.LinearGradientPaint; import java.awt.Polygon; import java.awt.Stroke; import java.awt.geom.Point2D; import java.awt.geom.Rectangle2D; import javax.swing.JFrame; import javax.swing.JPanel; public class meter extends JFrame { Stroke drawingStroke = new BasicStroke(2); Rectangle2D rect = new Rectangle2D.Double(105, 50, 40, 200); Double meterPercent = new Double(0.57); public meter() { setTitle("Meter"); setLayout(null); setSize(300, 300); setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); setLocationRelativeTo(null); setVisible(true); } public void paint(Graphics g) { // Paint Meter Graphics2D g1 = (Graphics2D) g; g1.setStroke(drawingStroke); g1.draw(rect); // Set Meter Colors Point2D start = new Point2D.Float(0, 0); Point2D end = new Point2D.Float(0, this.getHeight()); float[] dist = { 0.1f, 0.5f, 0.9f }; Color[] colors = { Color.green, Color.yellow, Color.red }; LinearGradientPaint p = new LinearGradientPaint(start, end, dist, colors); g1.setPaint(p); g1.fill(rect); // Make a triangle - Arrow on Meter int[] x = new int[3]; int[] y = new int[3]; int n; // count of points // Set Points for Arrow Integer meterArrowHypotenuse = (int) rect.getX(); Integer meterArrowTip = (int) rect.getY() + (int) (rect.getHeight() * (1 - meterPercent)); x[0] = meterArrowHypotenuse - 25; x[1] = meterArrowHypotenuse - 25; x[2] = meterArrowHypotenuse - 5; y[0] = meterArrowTip - 20; // Top Left y[1] = meterArrowTip + 20; // Bottom Left y[2] = meterArrowTip; // Tip of Arrow n = 3; // Number of points, 3 because its a triangle // Draw Arrow Border Polygon myTriShadow = new Polygon(x, y, n); // a triangle g1.setPaint(Color.black); g1.fill(myTriShadow); // Set Points for Arrow Board x[0] = x[0] + 1; x[1] = x[1] + 1; x[2] = x[2] - 2; y[0] = y[0] + 3; y[1] = y[1] - 3; y[2] = y[2]; Robot robot = new Robot(); Color colorMeter = robot.getPixelColor(x[2]+10, y[2]); // Draw Arrow Polygon myTri = new Polygon(x, y, n); // a triangle Color colr = new Color(colorMeter.getRed(), colorMeter.getGreen(), colorMeter.getBlue()); g1.setPaint(colr); g1.fill(myTri); } public static void main(String[] args) { new meter(); } } Thanks for looking.

    Read the article

  • Visual Studio Linked Files Directory Structure

    - by jeffn825
    I have two versions of a project. One for Silverlight and one for .NET. The SL project has the vast majority of the code base in it. I want to globally add all files from the SL project into the .NET version as linked files. I've managed to do so successfully like this in the csproj file for the .NET version: <Compile Include="..\MyProj.Common.SL\**\*.cs" Exclude="..\MyProj.Common\Properties\**"> Unfortunately, this adds all the files right to the root of my project... so I end up with a long unreadable list of linked files in the .NET project. I really really really don't want to have to maintain an entire duplicate directory structure by hand and deal with directory name changes and file name changes and whatnot. So, is there any way to have Visual Studio preserve the directory structure when adding linked files in the wildcard manner above? Or is there at least a way of making it group all the linked files together under a directory in the .NET project like MyProj.Common.SL.Links? The very closest I've come is to set the <Visible>false</Visible> under the <Compile> tag, which effectively removes the long unreadable list of 300+ files....but unfortunately this screws up Resharper, which no longer sees those files as valid and it goes crazy on all the projects that reference the .NET project. If I could figure out a way of making Resharper not get all messed up, that would be an acceptable solution too... Any suggestions? Thanks.

    Read the article

  • SQL Server - stored procedure suddenly become slow

    - by Barguast
    I have written a stored procedure that, yesterday, typically completed in under a second. Today, it takes about 18 seconds. I ran into the problem yesterday as well, and it seemed to be solved by DROPing and re-CREATEing the stored procedure. Today, that trick doesn't appear to be working. :( Interestingly, if I copy the body of the stored procedure and execute it as a straightforward query it completes quickly. It seems to be the fact that it's a stored procedure that's slowing it down...! Does anyone know what the problem might be? I've searched for answers, but often they recommend running it through Query Analyser, but I don't have have it - I'm using SQL Server 2008 Express for now. The stored procedure is as follows; ALTER PROCEDURE [dbo].[spGetPOIs] @lat1 float, @lon1 float, @lat2 float, @lon2 float, @minLOD tinyint, @maxLOD tinyint, @exact bit AS BEGIN -- Create the query rectangle as a polygon DECLARE @bounds geography; SET @bounds = dbo.fnGetRectangleGeographyFromLatLons(@lat1, @lon1, @lat2, @lon2); -- Perform the selection if (@exact = 0) BEGIN SELECT [ID], [Name], [Type], [Data], [MinLOD], [MaxLOD], [Location].[Lat] AS [Latitude], [Location].[Long] AS [Longitude], [SourceID] FROM [POIs] WHERE NOT ((@maxLOD < [MinLOD]) OR (@minLOD > [MaxLOD])) AND (@bounds.Filter([Location]) = 1) END ELSE BEGIN SELECT [ID], [Name], [Type], [Data], [MinLOD], [MaxLOD], [Location].[Lat] AS [Latitude], [Location].[Long] AS [Longitude], [SourceID] FROM [POIs] WHERE NOT ((@maxLOD < [MinLOD]) OR (@minLOD > [MaxLOD])) AND (@bounds.STIntersects([Location]) = 1) END END The 'POI' table has an index on MinLOD, MaxLOD, and a spatial index on Location.

    Read the article

  • Php index page utitlizing an idea for a superswitch...

    - by Matt
    I dont know if this is a great idea...or a crap one. But I was thinking I may use one page to display all my pages using includes. Here is what my index.php would look like...on the functions include there is a function called "superSwitch" which will determine what requested page will be included....for instance if I do a get ?a=a it will goto the function superSwitch(a) superSwitch will take it and associate it with (login.php) then respond with such... here is the code for the index.php...please let me know if this makes sense and might work, or should I just stick to long blocks of code (which is why I am trying this because I hate long pages full of code...) of course as you can tell it is not actually including anything yet...the print is for debugging purposes. :) Thanks, Matt <?php //includes Functions include_once('inc/func.inc.php'); //set superget variable $superget = @$_GET['a']; //check if superget is set or null if (!$superget) { echo "Nothing Requested :)"; } else { //sanitizes the superget request $supergetr = supergetSanitize($superget) //uses the result "good" or "nogood" to determine what happens if ( $supergetr == "good" ) { //pulls superSwitch value of the request $ssresult = superSwitch($superget); print_r ($ssresult); } //if the sanitize is nogood else { //the superSwitch is instructed to respond with a 404 page $superget = "404" $ssresult = superSwitch($superget); print_r ($ssresult); } } ?>

    Read the article

  • Configurable Values in Enum

    - by Omer Akhter
    I often use this design in my code to maintain configurable values. Consider this code: public enum Options { REGEX_STRING("Some Regex"), REGEX_PATTERN(Pattern.compile(REGEX_STRING.getString()), false), THREAD_COUNT(2), OPTIONS_PATH("options.config", false), DEBUG(true), ALWAYS_SAVE_OPTIONS(true), THREAD_WAIT_MILLIS(1000); Object value; boolean saveValue = true; private Options(Object value) { this.value = value; } private Options(Object value, boolean saveValue) { this.value = value; this.saveValue = saveValue; } public void setValue(Object value) { this.value = value; } public Object getValue() { return value; } public String getString() { return value.toString(); } public boolean getBoolean() { Boolean booleanValue = (value instanceof Boolean) ? (Boolean) value : null; if (value == null) { try { booleanValue = Boolean.valueOf(value.toString()); } catch (Throwable t) { } } // We want a NullPointerException here return booleanValue.booleanValue(); } public int getInteger() { Integer integerValue = (value instanceof Number) ? ((Number) value).intValue() : null; if (integerValue == null) { try { integerValue = Integer.valueOf(value.toString()); } catch (Throwable t) { } } return integerValue.intValue(); } public float getFloat() { Float floatValue = (value instanceof Number) ? ((Number) value).floatValue() : null; if (floatValue == null) { try { floatValue = Float.valueOf(value.toString()); } catch (Throwable t) { } } return floatValue.floatValue(); } public static void saveToFile(String path) throws IOException { FileWriter fw = new FileWriter(path); Properties properties = new Properties(); for (Options option : Options.values()) { if (option.saveValue) { properties.setProperty(option.name(), option.getString()); } } if (DEBUG.getBoolean()) { properties.list(System.out); } properties.store(fw, null); } public static void loadFromFile(String path) throws IOException { FileReader fr = new FileReader(path); Properties properties = new Properties(); properties.load(fr); if (DEBUG.getBoolean()) { properties.list(System.out); } Object value = null; for (Options option : Options.values()) { if (option.saveValue) { Class<?> clazz = option.value.getClass(); try { if (String.class.equals(clazz)) { value = properties.getProperty(option.name()); } else { value = clazz.getConstructor(String.class).newInstance(properties.getProperty(option.name())); } } catch (NoSuchMethodException ex) { Debug.log(ex); } catch (InstantiationException ex) { Debug.log(ex); } catch (IllegalAccessException ex) { Debug.log(ex); } catch (IllegalArgumentException ex) { Debug.log(ex); } catch (InvocationTargetException ex) { Debug.log(ex); } if (value != null) { option.setValue(value); } } } } } This way, I can save and retrieve values from files easily. The problem is that I don't want to repeat this code everywhere. Like as we know, enums can't be extended; so wherever I use this, I have to put all these methods there. I want only to declare the values and that if they should be persisted. No method definitions each time; any ideas?

    Read the article

  • Google App Engine how to get an object from the servlet ?

    - by Frank
    I have the following class objects in Google App Engine's dadastore, I can see them from the "Datastore Viewer " : import javax.jdo.annotations.IdGeneratorStrategy; import javax.jdo.annotations.IdentityType; import javax.jdo.annotations.PersistenceCapable; import javax.jdo.annotations.Persistent; import javax.jdo.annotations.PrimaryKey; @PersistenceCapable(identityType=IdentityType.APPLICATION) public class Contact_Info_Entry implements Serializable { @PrimaryKey @Persistent(valueStrategy=IdGeneratorStrategy.IDENTITY) Long Id; public static final long serialVersionUID=26362862L; String Contact_Id="",First_Name="",Last_Name="",Company_Name="",Branch_Name="",Address_1="",Address_2="",City="",State="",Zip="",Country=""; double D_1,D_2; boolean B_1,B_2; Vector<String> A_Vector=new Vector<String>(); public Contact_Info_Entry() { } ...... } How can my java applications get the object from a servlet url ? For instance if have an instance of Contact_Info_Entry who's Contact_Id is "ABC-123", and my App Id is : nm-java When my java program accesses the url : "http://nm-java.appspot.com/Check_Contact_Info?Contact_Id=ABC-123 How will the Check_Contact_Info servlet get the object from datastore and return it to my app ? public class Check_Contact_Info_Servlet extends HttpServlet { static boolean Debug=true; public void doGet(HttpServletRequest request,HttpServletResponse response) throws IOException { } ... protected void doPost(HttpServletRequest request,HttpServletResponse response) throws ServletException,IOException { doGet(request,response); } } Frank

    Read the article

  • Good PHP / MYSQL hashing solution for large number of text values

    - by Dave
    Short descriptio: Need hashing algorithm solution in php for large number of text values. Long description. PRODUCT_OWNER_TABLE serial_number (auto_inc), product_name, owner_id OWNER_TABLE owner_id (auto_inc), owener_name I need to maintain a database of 200000 unique products and their owners (AND all subsequent changes to ownership). Each product has one owner, but an owner may have MANY different products. Owner names are "Adam Smith", "John Reeves", etc, just text values (quite likely to be unicode as well). I want to optimize the database design, so what i was thinking was, every week when i run this script, it fetchs the owner of a proudct, then checks against a table i suppose similar to PRODUCT_OWNER_TABLE, fetching the owner_id. It then looks up owner_id in OWNER_TABLE. If it matches, then its the same, so it moves on. The problem is when its different... To optimize the database, i think i should be checking against the other "owner_name" entries in OWNER_TABLE to see if that value exists there. If it does, then i should use that owner_id. If it doesnt, then i should add another entry. Note that there is nothing special about the "name". as long as i maintain the correct linkagaes AND make the OWNER_TABLE "read-only, append-new" type table - I should be able create a historical archive of ownership. I need to do this check for 200000 entries, with i dont know how many unique owner names (~50000?). I think i need a hashing solution - the OWNER_TABLE wont be sorted, so search algos wont be optimal. programming language is PHP. database is MYSQL.

    Read the article

  • java gui changing picture causes heapspace error

    - by pie154
    I have a java programme than when a button is clicked it updates the image on screen to the according image. this will work for the first 15 or so clicks then it causes a java heapspace error. I think it is because of the way I am updating the jpanel that contains the bufferedimage but not sure what the reason is. My code to get make the JPanel contain the new image is, public class extraScreenPanel { static JPanel screenPanel = new JPanel(new BorderLayout()); public static JPanel extraScreenPanel(int dispNum) { JLabel label = new JLabel("" + dispNum + ""); label.setPreferredSize(new Dimension(800, 600)); //label.setUI( new VerticalLabelUI(true) ); label.setVerticalAlignment( SwingConstants.TOP ); screenPanel = imgDisp(dispNum); label.setForeground(Color.white); label.setFont(new Font("Serif", Font.BOLD, 200)); screenPanel.add(label, BorderLayout.PAGE_END ); return screenPanel; } public static JPanel imgDisp(int picNum) { /* String url[] = new String[5000]; String part1; url[0] = "C:/PiPhotoPic/pic16.jpg"; for(Integer i=1;i<5000;i++){ if(i<10){part1 = "C:/temp/new0000000";} else if(i<100){part1 = "C:/temp/new000000";} else if(i<1000){part1 = "C:/temp/new00000";} else {part1 = "C:/temp/new00000";} String num = Integer.toString(i); url[i]= part1 + num + ".jpg"; } if(picNum<0){picNum=0;} String ref = url[picNum];*/ //this code is just to get specific ref for image location BufferedImage loadImg = loadImage(ref); JImagePanel panel = new JImagePanel(loadImg, 0, 0); panel.setPreferredSize(new Dimension(800, 600)); return panel; } public static class JImagePanel extends JPanel{ private BufferedImage image; int x, y; public JImagePanel(BufferedImage image, int x, int y) { super(); this.image = image; this.x = x; this.y = y; } @Override protected void paintComponent(Graphics g) { super.paintComponent(g); g.drawImage(image, x, y, null); } } public static BufferedImage loadImage(String ref) { BufferedImage bimg = null; try { bimg = javax.imageio.ImageIO.read(new File(ref)); } catch (Exception e) { e.printStackTrace(); } BufferedImage bimg2 = resize(bimg,800,600); return bimg2; } public static BufferedImage resize(BufferedImage img, int newW, int newH) { int w = img.getWidth(); int h = img.getHeight(); BufferedImage dimg = dimg = new BufferedImage(newW, newH, img.getType()); Graphics2D g = dimg.createGraphics(); g.setRenderingHint(RenderingHints.KEY_INTERPOLATION, RenderingHints.VALUE_INTERPOLATION_BILINEAR); g.drawImage(img, 0, 0, newW, newH, 0, 0, w, h, null); g.dispose(); return dimg; } } And the code that updates my gui is, it works by removing the panel from its containg panel and then readding it to it. picPanel = imgDisp.imgDisp(num); repaintPicPanel(); public static void repaintPicPanel() { picPanel.removeAll(); menuPanel.remove(picPanel);; menuPanel.add(picPanel, BorderLayout.LINE_START); }

    Read the article

  • JPA 2.0 Provider Hibernate

    - by Rooh
    I have very strange problem we are using jpa 2.0 with hibernate annotations based Database generated through JPA DDL is true and MySQL as Database; i will provide some reference classes and then my porblem. @MappedSuperclass public abstract class Common implements serializable{ @Id @GeneratedValue(strategy = GenerationType.AUTO) @Column(name = "id", updatable = false) private Long id; @ManyToOne @JoinColumn private Address address; //with all getter and setters //as well equal and hashCode } @Entity public class Parent extends Common{ private String name; @OneToMany(cascade = {CascadeType.MERGE,CascadeType.PERSIST}, mappedBy = "parent") private List<Child> child; //setters and rest of class } @Entity public class Child extends Common{ //some properties with getter/setters } @Entity public class Address implements Serializable{ @Id @GeneratedValue(strategy = GenerationType.AUTO) @Column(name = "id", updatable = false) private Long id; private String street; //rest of class with get/setter } as in code you can see that parents and child classes extends Common class so both have address property and id , the problem occurs when change the address refference in parent class it reflect same change in all child objects in list and if change address refference in child class then on merge it will change address refference of parent as well i am not able to figure out is it is problem of jpa or hibernate

    Read the article

  • Getting zeros between data while reading a binary file in C

    - by indiajoe
    I have a binary data which I am reading into an array of long integers using a C programme. hexdump of the binary data shows, that after first few data points , it starts again at a location 20000 hexa adresses away. hexdump output is as shown below. 0000000 0000 0000 0000 0000 0000 0000 0000 0000 * 0020000 0000 0000 0053 0000 0064 0000 006b 0000 0020010 0066 0000 0068 0000 0066 0000 005d 0000 0020020 0087 0000 0059 0000 0062 0000 0066 0000 ........ and so on... But when I read it into an array 'data' of long integers. by the typical fread command fread(data,sizeof(*data),filelength/sizeof(*data),fd); It is filling up with all zeros in my data array till it reaches the 20000 location. After that it reads in data correctly. Why is it reading regions where my file is not there? Or how will I make it read only my file, not anything inbetween which are not in file? I know it looks like a trivial problem, but I cannot figure it out even after googling one night.. Can anyone suggest me where I am doing it wrong? Other Info : I am working on a gnu/linux machine. (slax-atma distro to be specific) My C compiler is gcc.

    Read the article

  • C++ Problems with #import of .NET out-of-proc server.

    - by jm
    In C++ program, I am trying to #import TLB of .NET out of proc server. I get errors like: z:\server.tlh(111) : error C2146: syntax error : missing ';' before identifier 'GetType' z:\server.tlh(111) : error C2501: 'TypePtr' : missing storage-class or type specifiers z:\server.tli(74) : error C2143: syntax error : missing ';' before 'tag::id' z:\server.tli(74) : error C2433: 'TypePtr' : 'inline' not permitted on data declarations z:\server.tli(74) : error C2501: '_TypePtr' : missing storage-class or type specifiers z:\server.tli(74) : fatal error C1004: unexpected end of file found The TLH looks like: ... _bstr_t GetToString ( ); VARIANT_BOOL Equals ( const _variant_t & obj ); long GetHashCode ( ); _TypePtr GetType ( ); long Open ( ); ... I am not really interested in the having the base object .NET object methods like GetType(), Equals(), etc. But GetType() seems to be causing problems. Some google research indicates I could #import MSCORLIB.TLB (or put it in path), but I can't get that to compile either. Any tips?

    Read the article

  • JFLAP Turing Machine shortcut problem

    - by Robert Lamb
    In JFLAP (http://jflap.org), there are some shortcuts for Turing machine transitions. One of these shortcuts allows you to transition as long as the current tape symbol isn't the indicated symbol. For example, the transition !g,x;R basically says "Take this transition if the current tape symbol is not g". So far, so good. But the transition I want is !?,~;R which basically says "Move right as long as the current symbol is not the end-of-string (empty cell) symbol". The problem is I cannot figure out how to type in "!?". The JFLAP online documentation (http://www.jflap.org/tutorial/turing/one/index.html#syntax) has this to say: The first shortcut is that there exists the option of using the “!” character to convey the meaning of “any character but this character.” For example, concerning the transition (!a; x, R), if the head encounters any character but an “a”, it will replace the character with an “x” and move right. To write the expression “!?”, just type a “1” in when inputting a command. My question is...how do I actually do what that last sentence is trying to explain to me? Thanks for your help! Robert

    Read the article

  • save the transient instance before flushing

    - by eugenn
    Exception: object references an unsaved transient instance - save the transient instance before flushing: Child How to reproduce issue: 1. Hibernate is load the entity "Parent". The property "child" is null 2. The "Parent" is rendered on the screen and after that the "child" property is auto instantiated. So I have the following graph: Parent.child != null Parent.child.childId = null Parent.child.childKey = "" Parent.child.childName = "" Question: How I could to force the Hibernate to ignore updating or inserting Child entity WHEN childId = null? If childId != null I would like just create relation. <hibernate-mapping> <class name="com.test.Parent" entity-name="ParentObject" table="parent" dynamic-insert="false" dynamic-update="true" optimistic-lock="version"> <id name="rowId" type="long"> <column name="RowID" /> <generator class="native" /> </id> <version name="versionSequence" type="integer" unsaved-value="null" generated="never" insert="false"> <column name="VersionSequence" /> </version> <many-to-one name="child" entity-name="Child" fetch="select" optimistic-lock="true" embed-xml="false" update="true" insert="false"> <column name="ChildID" /> </many-to-one> <property name="dateCreated" type="timestamp"> <column name="DateCreated" length="0" /> </property> <property name="dateUpdated" type="timestamp" update="false"> <column name="DateUpdated" length="0" /> </property> </class> </hibernate-mapping> <hibernate-mapping> <class name="com.Child" entity-name="Child" table="Child" dynamic-insert="false" dynamic-update="true" optimistic-lock="version"> <id name="childId" type="long" > <column name="ChildID" /> <generator class="native" /> </id> <version name="versionSequence" type="integer" insert="false" generated="never" > <column name="VersionSequence" /> </version> <property name="childKey" type="string" > <column name="ChildKey" length="20" /> </property> <property name="childName" type="string" > <column name="ChildName" length="30" /> </property> <property name="childNumber" type="string" > <column name="ChildNumber" /> </property> <property name="dateCreated" type="timestamp"> <column name="DateCreated" /> </property> <property name="dateUpdated" type="timestamp" update="false"> <column name="DateUpdated" /> </property> </class> </hibernate-mapping>

    Read the article

  • How can you get the call tree with python profilers?

    - by Oliver
    I used to use a nice Apple profiler that is built into the System Monitor application. As long as your C++ code was compiled with debug information, you could sample your running application and it would print out an indented tree telling you what percent of the parent function's time was spent in this function (and the body vs. other function calls). For instance, if main called function_1 and function_2, function_2 calls function_3, and then main calls function_3: main (100%, 1% in function body): function_1 (9%, 9% in function body): function_2 (90%, 85% in function body): function_3 (100%, 100% in function body) function_3 (1%, 1% in function body) I would see this and think, "Something is taking a long time in the code in the body of function_2. If I want my program to be faster, that's where I should start." Does anyone know how I can most easily get this exact profiling output for a python program? I've seen people say to do this: import cProfile, pstats prof = cProfile.Profile() prof = prof.runctx("real_main(argv)", globals(), locals()) stats = pstats.Stats(prof) stats.sort_stats("time") # Or cumulative stats.print_stats(80) # 80 = how many to print but it's quite messy compared to that elegant call tree. Please let me know if you can easily do this, it would help quite a bit. Cheers!

    Read the article

  • Excel VBA Function runtime error 1004: Application-defined or object-defined error

    - by music2myear
    I'm trying to learn functions for the purpose of simplifying and reusing code whenever necessary. I began by turning something I use pretty often into a function: Returning the integer value of the last non-blank row in a spreadsheet. Function FindLastDataLine(strColName As String) As Long FindLastDataLine = Range(strColName).Offset(Rows.Count - 1, 0).End(xlUp).Row End Function Sub PracticeMacro() intItemCount = FindLastDataLine("A:A") MsgBox ("There are " & intItemCount & " rows of data in column A.") End Sub When I run this I recieve the runtime error '1004' "Application-defined or object-defined error" which Help helpfully defines as "someone else's fault" to quote not quite verbatim. Where might I be going wrong?

    Read the article

  • Android: onListItemClick not opening up the .xml file

    - by Capsud
    Hi, public void onListItemClick(ListView l, View v, int position, long id) { if(position == 0){ setContentView(R.layout.cuisine); } } I have an array of Strings and i'm using the above method to try and open up a new xml file called 'cuisine' when it is clicked. but it keeps failing! Have I done this right, or what am I doing wrong? Thanks. Ok from looking at similar problems on the web, people have said to get the onListItemClick() to start a new activity and using that new activity to then open up the new view? So what i've done is this... protected void onListItemClick(ListView l, View v, int position, long id) { Intent dundrumIntent = new Intent(v.getContext(), DundrumSelector.class); dundrumIntent.putExtra("position", position); startActivityForResult(dundrumIntent, 0); } and then import android.app.Activity; import android.os.Bundle; public class DundrumSelector extends Activity { @Override public void onCreate(Bundle savedInstanceState){ super.onCreate(savedInstanceState); int position = getIntent().getExtras().getInt("position"); if(position == 0){ setContentView(R.layout.cuisine); } } } Yet i'm still getting the same problem. The program crashes when I click on an item in the listView. And yes i've added the activity to the manifest. Does anyone have a resolution to this as alot of people seem to be having the same problem. Thanks alot.

    Read the article

  • Presentation Issue in an Unordered List

    - by phreeskier
    I'm having an issue with correctly presenting items in an unordered list. The labels are floating left and the related spans that are long in length are wrapping and showing below the label. I need a solution that keeps the related spans in their respective columns. In other words, I don't want long spans to show under the labels. What property can I take advantage of so that I get the desired layout in all of the popular browsers, including IE6? Thanks in advance for the help. My code is as follows: <ul> <li> <label>Name</label> <span><%= Html.Encode(Model.Name) %></span> </li> <li> <label>Entity</label> <span><%= Html.Encode(Model.Entity) %></span> </li> <li> <label>Phone</label> <span><%= Html.Encode(Model.Phone) %></span> </li> </ul> My CSS styling is as follows: ul { display:block; list-style-type:none; margin:0; padding:0; } ul li label { float:left; width:100px; }

    Read the article

  • .NET consumer of ActiveX throwing TargetParameterCountException

    - by DevSolo
    I have a .NET (3.5 w/ Dev Studio 2008) app that hosts a visual Active X (written in C++ w/ Dev Studio 2003). Have access to all sources, but can't easily move the Active X control up to 2008. This as worked fine in the past. Made some changes to the Active X control and now, when calling one method on the Active X, I'm getting a TargetParameterCountException 100% of the time. The signature of the Active X method is: LONG CMyActive::License(LPCTSTR string1, LPCTSTR string2, LONG long1, LPCTSTR string3, LPCTSTR string4); When viewing the method in object browser of reflector, .NET sees it as: public virtual int License(string string1, string string2, int long1, string string3, string string4) I renamed the parameters for demonstration purpose (boss gets twitchy about any code). I left the method name, as it could be relevant. There are method calls prior that work. I just can't seen to figure out why I'm all of a sudden getting this exception. The HRESULT is 0x8002000e and a quick search seems to indicate that's a general one. Thanks to all for reading.

    Read the article

  • Asp.net mvc retriev images from db and display on Page

    - by Trey Carroll
    //Inherits="System.Web.Mvc.ViewPage<FilmFestWeb.Models.ListVideosViewModel>" <h2>ListVideos</h2> <% foreach(BusinessObjects.Video vid in Model.VideoList){%> <div class="videoBox"> <%= Html.Encode(vid.Name) %> <img src="<% vid.ThumbnailImage; %>" /> </div> <%} %> //ListVideosViewModel public class ListVideosViewModel { public IList<Video> VideoList { get; set; } } //Video public class Video { public long VideoId { get; set; } public long TeamId { get; set; } public string Name { get; set; } public string Tags { get; set; } public string TeamMembers { get; set; } public string TranscriptFileName { get; set; } public string VideoFileName { get; set; } public int TotalNumRatings { get; set; } public int CumulativeTotalScore { get; set; } public string VideoUri { get; set; } public Image ThumbnailImage { get; set; } } I am getting the "red x" that I usually associate with image file not found. I have verified that my database table shows <binary data> after the stored proc that uploads the image executes. Any insight or advice would be greatly appreciated.

    Read the article

  • Crash generated during destruction of hash_map

    - by Alien01
    I am using hash_map in application as typedef hash_map<DWORD,CComPtr<IInterfaceXX>> MapDword2Interface; In main application I am using static instance of this map static MapDword2Interface m_mapDword2Interface; I have got one crash dump from one of the client machines which point to the crash in clearing this map I opened that crash dump and here is assembly during debugging > call std::list<std::pair<unsigned long const ,ATL::CComPtr<IInterfaceXX> >,std::allocator<std::pair<unsigned long const ,ATL::CComPtr<IInterfaceXX> > > >::clear > mov eax,dword ptr [CMainApp::m_mapDword2Interface+8 (49XXXXX)] Here is code where crash dump is pointing. Below code is from stl:list file void clear() { // erase all #if _HAS_ITERATOR_DEBUGGING this->_Orphan_ptr(*this, 0); #endif /* _HAS_ITERATOR_DEBUGGING */ _Nodeptr _Pnext; _Nodeptr _Pnode = _Nextnode(_Myhead); _Nextnode(_Myhead) = _Myhead; _Prevnode(_Myhead) = _Myhead; _Mysize = 0; for (; _Pnode != _Myhead; _Pnode = _Pnext) { // delete an element _Pnext = _Nextnode(_Pnode); this->_Alnod.destroy(_Pnode); this->_Alnod.deallocate(_Pnode, 1); } } Crash is pointing to the this->_Alnod.destroy(_Pnode); statement in above code. I am not able to guess it, what could be reason. Any ideas??? How can I make sure, even is there is something wrong with the map , it should not crash?

    Read the article

  • Runnable to be run every second only runs once in Fragment onCreateView()

    - by jul
    I'm trying to update the time in a TextView with a Runnable supposed to be run every second. The Runnable is started from a Fragment's onCreateView(), but it's only executed once. Anybody can help? Thanks public class MyFragment extends Fragment { Calendar mCalendar; private Runnable mTicker; private Handler mHandler; TextView mClock; String mFormat; private boolean mClockStopped = false; @Override public View onCreateView(LayoutInflater inflater, ViewGroup container, Bundle savedInstanceState) { RelativeLayout view = (RelativeLayout) inflater.inflate(R.layout.meteo_widget, container, false); /* * Clock (from DigitalClock widget source) */ mClock = (TextView) view.findViewById(R.id.clock); mCalendar = Calendar.getInstance(); mHandler = new Handler(); mTicker = new Runnable() { public void run() { if(mClockStopped) return; mCalendar.setTimeInMillis(System.currentTimeMillis()); mClock.setText(DateFormat.format("hh:mm:ss", mCalendar)); mClock.invalidate(); long now = SystemClock.uptimeMillis(); long next = now + (1000 - now % 1000); mHandler.postAtTime(mTicker, next); } }; mTicker.run(); return view; } @Override public void onResume() { super.onResume(); mClockStopped = true; } @Override public void onPause() { mClockStopped = false; super.onPause(); } }

    Read the article

  • How to use Java on Google App Engine without exceeding minute quotas?

    - by Geo
    A very simple java code inside a doGet() servlet is getting more than a second of cpu time on GAE. I have read some quota related documentation and apparently I am not doing anything wrong. //Request the user Agent info String userAgent = req.getHeader("User-Agent"); I wanted to know what was using the CPU the most, I use a google help recommendation. //The two lines below will get the CPU before requesting User-Agent Information QuotaService qs = QuotaServiceFactory.getQuotaService(); long start = qs.getCpuTimeInMegaCycles(); //Request the user Agent info String userAgent = req.getHeader("User-Agent"); //The three lines below will get the CPU after requesting User-Agent Information // and informed it to the application log. long end = qs.getCpuTimeInMegaCycles(); double cpuSeconds = qs.convertMegacyclesToCpuSeconds(end - start); log.warning("CPU Seconds on geting User Agent: " + cpuSeconds); The only thing that the code above tells me is that inspecting the header will use more than a second (1000ms) of cpu time, which for Google is a warning on the log panel. That seems to be a very simple request and still is using more than a second of cpu. What I am missing?

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Facing error in apple multitasking code

    - by user366584
    Actually I am working for multitasking and facing error please assist me, as I need to work on background application and also in foreground application - (void)applicationDidEnterBackground:(UIApplication *)application { UIApplication* app = [UIApplication sharedApplication]; // Request permission to run in the background. Provide an // expiration handler in case the task runs long. NSAssert(bgTask == UIBackgroundTaskInvalid, nil); bgTask = [app beginBackgroundTaskWithExpirationHandler:^{ // Synchronize the cleanup call on the main thread in case // the task actually finishes at around the same time. dispatch_async(dispatch_get_main_queue(), ^{ if (bgTask != UIBackgroundTaskInvalid) { [app endBackgroundTask:bgTask]; bgTask = UIBackgroundTaskInvalid; } }); }]; // Start the long-running task and return immediately. dispatch_async(dispatch_get_global_queue(DISPATCH_QUEUE_PRIORITY_DEFAULT, 0), ^{ // Do the work associated with the task. // Synchronize the cleanup call on the main thread in case // the expiration handler is fired at the same time. dispatch_async(dispatch_get_main_queue(), ^{ if (bgTask != UIBackgroundTaskInvalid) { [app endBackgroundTask:bgTask]; bgTask = UIBackgroundTaskInvalid; } }); }); }

    Read the article

  • array of structures, or structure of arrays?

    - by Jason S
    Hmmm. I have a table which is an array of structures I need to store in Java. The naive don't-worry-about-memory approach says do this: public class Record { final private int field1; final private int field2; final private long field3; /* constructor & accessors here */ } List<Record> records = new ArrayList<Record>(); If I end up using a large number ( 106 ) of records, where individual records are accessed occasionally, one at a time, how would I figure out how the preceding approach (an ArrayList) would compare with an optimized approach for storage costs: public class OptimizedRecordStore { final private int[] field1; final private int[] field2; final private long[] field3; Record getRecord(int i) { return new Record(field1[i],field2[i],field3[i]); } /* constructor and other accessors & methods */ } edit: assume the # of records is something that is changed infrequently or never I'm probably not going to use the OptimizedRecordStore approach, but I want to understand the storage cost issue so I can make that decision with confidence. obviously if I add/change the # of records in the OptimizedRecordStore approach above, I either have to replace the whole object with a new one, or remove the "final" keyword. kd304 brings up a good point that was in the back of my mind. In other situations similar to this, I need column access on the records, e.g. if field1 and field2 are "time" and "position", and it's important for me to get those values as an array for use with MATLAB, so I can graph/analyze them efficiently.

    Read the article

< Previous Page | 248 249 250 251 252 253 254 255 256 257 258 259  | Next Page >