Search Results

Search found 8343 results on 334 pages for 'split dns'.

Page 253/334 | < Previous Page | 249 250 251 252 253 254 255 256 257 258 259 260  | Next Page >

  • Normalizing Strings using Regexes

    - by RasputinJones
    How do I match this string "1 & 2" from this string "Foo Bar 1 & 2"? How do I match this string "1, 2 & 3" from this string "Foo Baz 1, 2 & 3"? Trying to split out "Foo Bar" from the string using regexes while using the presence of "1 & 2" or "1, 2 & 3" as conditionals to normalize these strings into "Foo Bar 1" and "Foo Bar 2" or "Foo Baz 1", "Foo Baz 2" and "Foo Baz 3" respectively.

    Read the article

  • Have anyone ever create/manipulate a table application from the ground up/scratch?

    - by Darwin
    Have anyone ever create/manipulate a table application from the ground up/scratch? I want to create a table using flash AS 3. I like to have the features like to the MS Studio Web Developer option. The options are create a table, merge cells, split cell, resize columns, delete cell, delete row, delete column etc... I think this is going to be very complicated thing to do. I think the only way to do it is to build it from the ground up because I don’t think Flash has the library/component for it. I was able to create rows and columns by creating the # of rectangles listed it from the left to the right and move the next coordinate for the next row. Now the most challenging this is to manipulate it. This is the must have feature on my website and we don’t want use Javascript to create table on the server side to create the table.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Show elipses where text will be truncated as per iTunes

    - by Burt
    I a building an application with a similar layout to iTunes i.e. it has a sidebar that doubles as a menu. Some of the text will exceed the boundary and rather that having it be truncated I would like to show ellipses (see line image below "Purchased on My iPh..."). How would I go about this in WPF? Suppose I made the boundary movable i.e. user can change the size of the panel (split panel in Windows Forms), how would I go about dynamically showing the ellipses/text? Thanks in advance, B

    Read the article

  • How to Best Setup a Website Project in VS.NET

    - by Jason
    I have very little experience with setting up a website from scratch in a .NET environment. As I am doing this now, I am wondering - what's the best way to go? Is it better to create a new Website Project, and include the various backend services and database code as part of that project, or is it better to split out the various aspects of the project? If the second, how would I go about doing that? I want to ensure that this project is easy to manage in the future (in terms of source control, deployment, etc), so I want to make sure I'm starting off on the right foot. I was unable to find any tutorials online, but if you have any, I would appreciate those as well. Thanks!

    Read the article

  • how to query sqlite for certain rows, i.e. dividing it into pages (perl DBI)

    - by user1380641
    sorry for my noob question, I'm currently writing a perl web application with sqlite database behind it. I would like to be able to show in my app query results which might get thousands of rows - these should be split in pages - routing should be like /webapp/N - where N is the page number. what is the correct way to query the sqlite db using DBI, in order to fetch only the relavent rows. for instance, if I show 25 rows per page so I want to query the db for 1-25 rows in the first page, 26-50 in the second page etc.... Thanks in advanced!

    Read the article

  • best practice for Jquery plugin implementation and resource locations

    - by ptutt
    This is probably a very basic question, but I seem to have issues plugging in jquery plug-ins. The issue seems to be around the location of the script, css and images and ensuring the css has the correct url to the images. The standard plug-in has the following folder structure (eg : JPicker) js css images My project is asp.net mvc so I have the default: scripts images content So, I try to split the jquery plugin to the appropriate folders (not sure if this is the best way?). Then I try to correct the references to images (background urls) in the css. I believe the url is relative to the page that is implementing the css file, not the location of the css file itself. Anyway, when I try the above, the plugins don't seem to work. I believe the issue lies with the images not being found. The jquery code runs without errors, so I assume that's not the problem. Any help/advice much appreciated

    Read the article

  • Parse items from text file

    - by chris
    I have a text file that includes data inside {[]} tags. What would be the suggested way to parse that data so I can just use the data inside the tags? Example text file would look like this: 'this is a bunch of text that is not {[really]} useful in any {[way]}. I need to {[get]} some items {[from]} it.' I would like to end up with 'really', 'way', 'get', 'from' in a list. I guess I could use split to do it.. but seems like there might be a better way out there. I have seen a ton parsing libraries, is there one that would be perfect for what I want to do?

    Read the article

  • How to distribute the chance to display each SWF evenly among banner collection?

    - by Michael Mao
    Hi all: I am working on The ausdcf.org to try adding several banner ads in swf format to the top. Everything starts to work, but I've got several questions that need your help: The client chose not to go with Google AdManager, but prefer a "minimal approach" to do this task. What I am trying to do is sort of "mimicking" the way Google AdManager does for banners, that is, to split the chance of each particular swf to be shown to the visitor evenly among the banner collection. Definitely I can add some jQuery code to do this from client-side, a random number generator and if-else statement would work - just $.load() it! However, what if I'd like to make sure those disabled Javascript (is there any now btw?) still be able to see different swfs in each visit. Any suggestion on how to approach this? Many thanks in advance.

    Read the article

  • Splitting a UL into three even lists

    - by Andy
    I am printing a menu using UL, the trouble is the order that is generated by my script is ignored because im printing the LI one after the other and they're spanning three across. So the order is 1 , 2 , 3 as opposed to 1 2 3 To counteract this i wanted to split my single UL into three that way the order would be maintained. Here is my code currently which works perfectly to print a single UL. //Category Drop Down Menu $this->CategoryDropDownMenu = '<ul id="subcatmenu">'; foreach($sitemap->CategoryMenu as $val) $this->CategoryDropDownMenu .= '<li><a href="'.$val[host].$val[link].'"><span>'.htmlspecialchars($val[title]).'</span></a></li>'; $this->CategoryDropDownMenu .= '</ul>';

    Read the article

  • Length of text that can just fit into one screen without scrolling

    - by KailZhang
    I find some iphone book apps have such feature: One screen one page of text without scrolling. The text can just fit into the whole screen with linebreaks and indentations. I'm curious of how to implement this. How could I decide the length of text that just fit into the screen. And also, given the whole text, I can calculate out the number of pages. If this is not possible to be done on iPhone(runtime?), then is it possible to process the text before storing it in app? I mean I calculate how many pages I need(how to split the raw text), probably how many lines per page.

    Read the article

  • eliminating noise/spikes

    - by tgv
    I have a measurement data with similar positive and negative values which should be like: ReqData=[0 0 -2 -2 -2 -2 -2 -2 0 0 0 -2 -2 -2 -2 0 0 2 2 2 2 2 2 0 0 2 2 2 2 2 0 0 2 2 2 2 2 0 0 2 2 2 0 0]' However, there are some measurement noises in the data - so the real data is like this: RealData=[0 0 -2 -2 -2 -2 -2 -2 0 0 0 -2 -2 -2 -2 0 0 2 2 2 2 -4 -1 0 0 2 2 2 2 -7 0 0 2 2 2 2 -1 0 0 2 2 2 0 0]' How do I remove the end noise from the RealData and convert it into ReqData using Matlab? How do I find the start and stop indexes of each set of positive or negative data and split them using Matlab? For instance, ansPositive = [3,8, 12, 15]' and ansNegative = [18, 23, 26, 30, 33, 37, 40, 42]'.

    Read the article

  • regular expression match does not work

    - by Carlos_Liu
    I have a string ABCD:10,20,,40;1/1;1/2,1/3,1/4 I want to split the string into the following parts: ABCD -- splited by : 10,20,,40 -- splited by ; 1/1 1/2,1/3,1/4 Why the following regular expression does not work for me ? string txt = @"ABCD:10,20,,40;1/1;1/2,1/3,1/4"; Regex reg = new Regex(@"\b(?<test>\w+):(?<com>\w+);(?<p1>\w+);(?<p2>\w+)"); Match match = reg.Match(txt);

    Read the article

  • In B-trees which element gets promoted when the node splits

    - by Phenom
    Let's say there is a B-tree of order 8. This means it can have 8 pointers and 7 elements. Say the letters A through G are stored in this B-tree. So this B-tree is just a single node containing 7 elements. Then you try to insert J into the tree. There's no room, so you have to split the node and create a new root node. Which element gets promoted up into the root node?

    Read the article

  • Rename Files in Python

    - by Jeff
    Hi all, Im trying to rename some files in a directory using python. I've looked around the forums here, and because i'm a noob, I cant adapt what I need from what is out there. Say I have a file called CHEESE_CHEESE_TYPE.*** and want to remove "Cheese_" so my resulting filename would be "CHEESE_TYPE" Im trying to use the os.path.split but it's not working properly. I have also considered using string manipulations, but have not been successful with that either. Any help would be greatly appreciated. Thanks.

    Read the article

  • c# FormatException was unhandled

    - by poco
    I'm parsing chat from a game and i get this string "?68 00 00 37 00 45 00 00" recipe = recipe.Replace("?", ""); string[] rElements = new string[8]; rElements = recipe.Split(' '); int num = int.Parse(rElements[0]); I get a Format exception on that last line that i don't understand. It says that input string is not in the right format. I have checked the debugger and the first element says it is "68". Anyone have any clue what is happening?

    Read the article

  • foreach statement (get string values)

    - by nhoyti
    Can someone please help me out? My code for splitting the strings is working however, i still need to use the splitted string my page. How can i achieve this? Here's my current code private void SplitStrings() { List<string> listvalues = new List<string>(); listvalues = (List<string>)Session["mylist"]; string[] strvalues = listvalues.ToArray(); if (listvalues != null) { foreach (string strElement in listvalues) { string[] prods = strElement.ToString().Split("|".ToCharArray()); string prodName = prods[0].ToString(); Response.Write(prodName); } } } link text how can i replace the response.write with any label or literal? when i tried to use a literal on the code it displays one single string not all of the strings that's been splitted. any ideas?

    Read the article

  • [Python] Best strategy for dealing with incomplete lines of data from a file.

    - by adoran
    I use the following block of code to read lines out of a file 'f' into a nested list: for data in f: clean_data = data.rstrip() data = clean_data.split('\t') t += [data[0]] strmat += [data[1:]] Sometimes, however, the data is incomplete and a row may look like this: ['955.159', '62.8168', '', '', '', '', '', '', '', '', '', '', '', '', '', '29', '30', '0', '0'] It puts a spanner in the works because I would like Python to implicitly cast my list as floats but the empty fields '' cause it to be cast as an array of strings (dtype: s12). I could start a second 'if' statement and convert all empty fields into NULL (since 0 is wrong in this instance) but I was unsure whether this was best. Is this the best strategy of dealing with incomplete data? Should I edit the stream or do it post-hoc?

    Read the article

  • What statistics app should I use for my website?

    - by Camran
    I have my own server (with root access). I need statistics of users who visit my website etc etc... I have looked at an app called Webalyzer... Is this a good choice? I run apache2 on a Ubuntu 9 system... If you know of any good statistics apps for servers please let me know. And a follow-up question: All statistics are saved in log-files right? So how large would these log-files become then? Possibility to split them would be good, dont know if this is possible with Webalyzer though...

    Read the article

  • How to get top/left x/y of image map with javascript / jquery?

    - by jpea
    Using jQuery's position() or offset(), I can't seeme to get the top/left coordinates of an image map area. It works in FF, but nothing else - no webkit, IE, Opera. $('area').bind("click",function(){ alert($(this).position().left); }); <area shape="rect" coords="14,25,205,150" href="#"> Anyone know of a different way to access these? Normally I would just take the coords and split(",") but there are a bunch of multi-faceted area's on these pages.

    Read the article

  • How to sort a hash by value in descending order and output a hash in ruby?

    - by tipsywacky
    output.sort_by {|k, v| v}.reverse and for keys h = {"a"=>1, "c"=>3, "b"=>2, "d"=>4} => {"a"=>1, "c"=>3, "b"=>2, "d"=>4} Hash[h.sort] Right now I have these two. But I'm trying to sort hash in descending order by value so that it will return => {"d"=>4, "c"=>3, "b"=>2, "a"=>1 } Thanks in advance. Edit: let me post the whole code. def count_words(str) # YOUR CODE HERE output = Hash.new(0) sentence = str.gsub(/,/, "").gsub(/'/,"").gsub(/-/, "").downcase words = sentence.split() words.each do |item| output[item] += 1 end puts Hash[output.sort_by{ |_, v| -v }] return Hash[output.sort_by{|k, v| v}.reverse] end

    Read the article

  • extract two parts of a string using regex in php

    - by Jubair
    Ok so I have this string: &lt;img src=images/imagename.gif alt='descriptive text here'&gt; and I am trying to split it up into the following two strings (array of two strings, what ever, just broken up). imagename.gif descriptive text here Note yes, its' actually the & lt; and not < same with the closing on the string. I know regex is the answer, but not the best at regext to know to pull it off in php.

    Read the article

  • How to take data from textarea and decrypt using javascript?

    - by user1657555
    I need to take data from a textarea on a website and decrypt it using a simple algorithm. The data is in the form of numbers separated by a comma. It also needs to read a space as a space. It looks like 42,54,57, ,57,40,57,44. Heres what I have so far: var my_textarea = $('textarea[name = "words"]').first(); var my_value = $(my_textarea).val(); var my_array = my_value.split(","); for (i=0; i < my_array.length; i++) { var nv = my_array - 124; var acv = nv + 34; var my_result = String.fromCharCode(acv); } prompt("", my_result);

    Read the article

  • I have a tab delimeted file that I want to convert into a mysql table

    - by user320835
    I have a tab delimeted file that I want to convert into a mysql table. there are 25 tab delimeted fields in the text file. I can get the values in when I construct the SQL statement word by word and get each value individually stated in the VALUES part but when I try to get the list as a whole it does not work. Here is the code. I couldn't figure it out. Any ideas? lines=open(path, "r").readlines() for line in lines[1:]: linex=line.strip().split("\t") linex.insert(0,'sometextindex') try: cursor.execute('INSERT INTO variants VALUES(%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s)',linex) except: print 'line number=',a,linex

    Read the article

  • What does it mean when you try to print an array or hash using Perl and you get, Array(0xd3888)?

    - by Luke
    What does it mean when you try to print an array or hash and you see the following; Array(0xd3888) or HASH(0xd3978)? EXAMPLE CODE my @data = ( ['1_TEST','1_T','1_TESTER'], ['2_TEST','2_T','2_TESTER'], ['3_TEST','3_T','3_TESTER'], ['4_TEST','4_T','4_TESTER'], ['5_TEST','5_T','5_TESTER'], ['6_TEST','6_T','^_TESTER'] ); foreach my $line (@data) { chomp($line); @random = split(/\|/,$line); print "".$random[0]."".$random[1]."".$random[2]."","\n"; } RESULT ARRAY(0xc1864) ARRAY(0xd384c) ARRAY(0xd3894) ARRAY(0xd38d0) ARRAY(0xd390c) ARRAY(0xd3948)

    Read the article

< Previous Page | 249 250 251 252 253 254 255 256 257 258 259 260  | Next Page >