Search Results

Search found 8343 results on 334 pages for 'split dns'.

Page 252/334 | < Previous Page | 248 249 250 251 252 253 254 255 256 257 258 259  | Next Page >

• Read a file to multiple array byte[]

  - by hankol

  I have an encryption algorithm (AES) that accepts file converted to array byte and encrypt it. Since I am going to process a very big size files, the JVM may go out of memory. I am planing to read the files in multiple array byte. each containing some part of the file. Then I teratively feed the algorithm. Finally merge them to produce encrypted file. So my question is: there any way to read a file part by part to multiple array byte? I thought I can use the following to read the file to array byte: IOUtils.toByteArray(InputStream input). And then split the array into multiple bytes using: Arrays.copyOfRange(). But I am afraid that the first code that reads file to byte will make the JVM to go out of memory. any suggestion please ? thanks

  Read the article

• Dynamic "WHERE IN" on IQueryable (linq to SQL)

  - by user320235

  I have a LINQ to SQL query returning rows from a table into an IQueryable object. IQueryable<MyClass> items = from table in DBContext.MyTable select new MyClass { ID = table.ID, Col1 = table.Col1, Col2 = table.Col2 } I then want to perform a SQL "WHERE ... IN ...." query on the results. This works fine using the following. (return results with id's ID1 ID2 or ID3) sQuery = "ID1,ID2,ID3"; string[] aSearch = sQuery.Split(','); items = items.Where(i => aSearch.Contains(i.ID)); What I would like to be able to do, is perform the same operation, but not have to specify the i.ID part. So if I have the string of the field name I want to apply the "WHERE IN" clause to, how can I use this in the .Contains() method?

  Read the article

• Forcing a mixed ISO-8859-1 and UTF-8 multi-line string into UTF-8 in Perl

  - by knorv

  Consider the following problem: A multi-line string $junk contains some lines which are encoded in UTF-8 and some in ISO-8859-1. I don't know a priori which lines are in which encoding, so heuristics will be needed. I want to turn $junk into pure UTF-8 with proper re-encoding of the ISO-8859-1 lines. Also, in the event of errors in the processing I want to provide a "best effort result" rather than throwing an error. My current attempt looks like this: $junk = &force_utf8($junk); sub force_utf8 { my $input = shift; my $output = ''; foreach my $line (split(/\n/, $input)) { if (utf8::valid($line)) { utf8::decode($line); } $output .= "$line\n"; } return $output; } While this appears to work I'm certain this is not the optimal solution. How would you improve the force_utf8(...) sub?

  Read the article

• How to break a list into chunks based on some property?

  - by CurlyFro

  public class InvestorMailing { public string To { get; set; } public IEnumerable<string> Attachments { get; set; } public int AttachmentCount { get; set; } public long AttachmentSize { get; set; } } i have an IList<InvestorMailing> mailingList. if the attachment size is greater than x, then i need to split my list and break it into chunks. is there an easy linq-y way to do this?

  Read the article

• Preserve trailing whitespace Sybase

  - by AngryWhenHungry

  I have a big chunk of textual data which I split and write multiple rows of a varchar(255) column of a table. Sometimes, the last character happens to be a space. When I read back this row, the trailing space is chopped and I get only 254 characters. This messes up my data when I append the next row to the end of this one. My code sends the full 255 char (incl space) to the DB API. How can I check that the trailing space is actually written to the table? I am not in a position to rewrite/redesign legacy code. Is there any setting - either in the DB, DB interface, read/write calls etc - that I can use to preserve the trailing space?

  Read the article

• Reduce text length to fit cell width in a smart manner

  - by Andrei Ciobanu

  Hello, I am in project where we are building a simple web calendar using Java EE technologies. We define a table where every row is an employee, and every column represents an hour interval. The table width and column widths are adjustable. In every cell we have a text retrieved from a database, indicating what the employee is doing / should do in that time interval. The problem is that sometimes the text in cells is getting bigger than the actual cell. My task is to make the text more "readable" by reducing it's length in a "smart way" so that it can fit in the cell more "gracefully". For example if initially in a cell I have: "Writing documents", after the resize I should retrieve: "Wrtng. dcmnts" or "Writ. docum." so that the text can fit well. Is there a smart way to do it ? Or removing vocals / split the string in two is enough ?

  Read the article

• Best way to get photoshop to optimise 35 related pictures for fast transmission

  - by thenerd

  I have 35 pictures taken from a stationary camera aimed at a lightbox in which an object is placed, rotated at 10 degrees in each picture. If I cycle through the pictures quickly, the image looks like it is rotating. If I wished to 'rotate' the object in a browser but wanted to transmit as little data as possible for this, I thought it might be a good idea to split the picture into 36 pictures, where 1 picture is any background the images have in common, and 35 pictures minus the background, just showing the things that have changed. Do you think this approach will work? Is there a better route? How would I achieve this in photoshop?

  Read the article

• remove the spaces...

  - by tekknolagi

  !/usr/bin/python import random lower_a = ['a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z'] upper_a = ['A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z'] num = ['0', '1', '2', '3', '4', '5', '6', '7', '8', '9'] all = [] all = " ".join("".join(lower_a) + "".join(upper_a) + "".join(num)) all = all.split() x = 0 while x < 10: for i in range(7): a = random.choice(all) print a, print x += 1 what i want to do is remove the spaces from the output what it gives now is Z 3 a A I K R G B i N 9 c E v g E r A N 8 e B 6 d v H O c a V 8 c x y b g 2 W a T T f 8 H T r 6 E p D K l 5 p u x q 8 P Z 9 T n I W X n B Q

  Read the article

• Distributing requests to Selenium Grid RC's?

  - by intervigil

  I've got a situation here where I have a central selenium grid hub, and several RC's running on my gogrid account. When I access it to run tests, it basically queues all the incoming test requests and executes them serially on only one of the RC's, instead of spreading them out to use available RC's. The tests come from multiple projects, so I'm not looking to parallelize the tests themselves, just to split the requests that come from multiple projects across the multiple RC's. From everything I've read, it seems like selenium grid should be doing this already, yet I only see one RC used to run every single test. Is there something I'm missing?

  Read the article

• How can I format numbers as money in JavaScript?

  - by Daniel Magliola

  I would like to format a price in JavaScript. Basically, I have a float variable, and I'd like to have a function that will receive that variable, and output: "$ 2,500.00" What's the best way to do this? EDIT: OK, since I haven't gotten any answers better than the code I implemented, plus my own answer has been voted down and I can't put my own answer as the right one... Here it is... var DecimalSeparator = Number("1.2").toLocaleString().substr(1,1); var AmountWithCommas = Amount.toLocaleString(); var arParts = String(AmountWithCommas).split(DecimalSeparator); var intPart = arParts[0]; var decPart = (arParts.length > 1 ? arParts[1] : ''); decPart = (decPart + '00').substr(0,2); return '£ ' + intPart + DecimalSeparator + decPart;

  Read the article

• MS Access Crashed an now all Form objects and code modules are missing

  - by owlie

  I was adding a form to our Access 07 db. I copied an existing form to use as a template, renamed it, and saved it. I opened a different form to check something and Access crashed. When I reopened the database it says: "Access has detected that this database is in an inconsistent state, and will attempt to recover the database." etc. When it reopened - all forms and reports were missing. Saved queries remain. The error message states that object recovery failures will be noted in a Recovery Errors table - but this table wasn't created. The links to the be database remained intact. The database is split - I was experimenting with a form on a front-end copy which might have something to do with it. Any ideas what would cause this (I can see loosing recent work - but nixing all form objects?!) And is there any chance of recovery?

  Read the article

• Problem in appending a string to a already filled string builder(at the beginning by using INSERT) a

  - by Newbie

  I have a string builder like StringBuilder sb = new StringBuilder("Value1"); sb.AppendLine("Value2"); Now I have a string say string str = "value 0"; I did sb.Insert(0,str); and then string[] strArr = sb.ToString().Trim().Replace("\r", string.Empty).Split('\n'); The result I am getting as (Array size of 2 where I should get 3) [0] value 0 Value1 [1] value2 But the desired output being [0] Value 0 [1] Value1 [2] Value2 Where I am going wrong? I am using C#3.0 Please help.. It 's urgent Thanks

  Read the article

• handling matrix data in python

  - by Ovisek

  I was trying to progressively subtract values of a 3D matrix. The matrix looks like: ATOM 1223 ZX SOD A 11 2.11 -1.33 12.33 ATOM 1224 ZY SOD A 11 -2.99 -2.92 20.22 ATOM 1225 XH HEL A 12 -3.67 9.55 21.54 ATOM 1226 SS ARG A 13 -6.55 -3.09 42.11 ... here the last three columns are representing values for axes x,y,z respectively. now I what I wanted to do is, take the values of x,y,z for 1st line and subtract with 2nd,3rd,4th line in a iterative way and print the values for each axes. I was using: for line in map(str.split,inp): x = line[-3] y = line[-2] z = line[-1] for separating the values, but how to do in iterative way. should I do it by using Counter.

  Read the article

• How do I get artifacts from one Maven module included in the resources of another in my build?

  - by Hanno Fietz

  I have Maven modules that produce a Flex application as an SWF file. I want to include that file in a web application that is made with another Maven module from the same build. I'm wondering how and at which lifecycle phase I get Maven to grab the artifact from the other module and put it insode the appropriate folder of the webapp module. Would I use a separate assembly module? The web app is running on a Jetty server in an OSGi environment (using Pax), the server side of the web app uses Struts. The final artifact as I see it would be a WAR file including my Action etc classes, JSP templates, static contents such as CSS or JS, and the SWF movies. I might be better off with these split over some other setup, but right now, I wouldn't know which.

  Read the article

• textarea into array javascript

  - by user281180

  myList contains the following values: value1 value2 value3 function showArray() { var txt = $("#myList").text(); var textread = txt.split('\n'); var msg = ""; for (var i = 0; i < textread .length; i++) { msg += i + ": " + textread [i] + "\n"; } alert(msg); } my alert gives me the following: 0:value1 value2 value3 It`s not what I wanted and expecting, I was expecting something like: 0: value1 1: value2 2: value3 How can I get the values as expected?

  Read the article

• C# Client-Server implementation error on client's socket

  - by Ksice

  I'm trying to launch my client. Server already runned on the same computer. So I'm using "localhost" with GetHostEntry: IPHostEntry ipHostInfo = System.Net.Dns.GetHostEntry("localhost"); IPAddress ipAddress = ipHostInfo.AddressList[0]; IPEndPoint remoteEP = new IPEndPoint(ipAddress, Port); But I have this "no connection could be made because the target machine actively refused it" error. What is the reason? Could it be because ipHostInfo.AddressList[0] is an IPv6? How then I can accept Ipv4 address?

  Read the article

• How can I optimize this code?

  - by loop0

  Hi, I'm developing a logger daemon to squid to grab the logs on a mongodb database. But I'm experiencing too much cpu utilization. How can I optimize this code? from sys import stdin from pymongo import Connection connection = Connection() db = connection.squid logs = db.logs buffer = [] a = 'timestamp' b = 'resp_time' c = 'src_ip' d = 'cache_status' e = 'reply_size' f = 'req_method' g = 'req_url' h = 'username' i = 'dst_ip' j = 'mime_type' L = 'L' while True: l = stdin.readline() if l[0] == L: l = l[1:].split() buffer.append({ a: float(l[0]), b: int(l[1]), c: l[2], d: l[3], e: int(l[4]), f: l[5], g: l[6], h: l[7], i: l[8], j: l[9] } ) if len(buffer) == 1000: logs.insert(buffer) buffer = [] if not l: break connection.disconnect()

  Read the article

• can list be converted into string

  - by PARIJAT

  Actually i have extracted some data from the file and want to write it in the file 2 but the program says 'sequence item 1: expected string, list found', I want to know how i can convert buffer[] ie string into sequence, so that it could be saved in file 2...I am new to the python please help* file = open('/ddfs/user/data/k/ktrip_01/hmm.txt','r') file2 = open('/ddfs/user/data/k/ktrip_01/hmm_write.txt','w') buffer = [] rec = file.readlines() for line in rec : field = line.split() print '>',field[0] term = field[0] buffer.append(term) print field[1], field[2], field[6], field[12] term1 = field [1] buffer.append(term1) term2 = field[2] buffer.append[term2] term3 = field[6] buffer.append[term3] term4 = field[12] buffer.append[term4] file2.write(buffer) file.close() file2.close()

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• python: creating a list inside a dictionary

  - by user1871081

  I just started using python and I'm trying to create a program that will read a file that looks like this: AAA x 111 AAB x 111 AAA x 112 AAC x 123 ... the file is 50 lines long and I'm trying to make the letters into keys in a dictionary and the numbers lists that correspond with the keys. I want the output to look like this: {AAA: ['111', '112'], AAB: ['111'], AAC: [123], ...} This is what I've tried file = open("filename.txt", "r") readline = file.readline().rstrip() while readline!= "": list = [] list = readline.split(" ") j = list.index("x") k = list[0:j] v = list[p + 1:] d = {} if k in d == False d[k] = [] d[k].append(v) else d[k].append(v) readline = file.readline().rstrip() I keep getting syntax errors on my if statement and I can't figure out what I've done wrong.

  Read the article

• How to run a module

  - by Jimmy

  I have a module file containing the following functions: def replace(filename): match = re.sub(r'[^\s^\w]risk', 'risk', filename) return match def count_words(newstring): from collections import defaultdict word_dict=defaultdict(int) for line in newstring: words=line.lower().split() for word in words: word_dict[word]+=1 for word in word_dict: if'risk'==word: return word, word_dict[word] when I do this in IDLE: >>> mylist = open('C:\\Users\\ahn_133\\Desktop\\Python Project\\test10.txt').read() >>> newstrings=replace(mylist) ### This works fine. >>> newone=count_words(newstrings) ### This leads to the following error. I get the following error: Traceback (most recent call last): File "<pyshell#134>", line 1, in <module> newPH = replace(newPassage) File "C:\Users\ahn_133\Desktop\Python Project\text_modules.py", line 56, in replace match = re.sub(r'[^\s^\w]risk', 'risk', filename) File "C:\Python27\lib\re.py", line 151, in sub return _compile(pattern, flags).sub(repl, string, count) TypeError: expected string or buffer Is there anyway to run both functions without saving newstrings into a file, opening it using readlines(), and then running count_words function?

  Read the article

• Strange python error

  - by Werner

  Hi, I am trying to write a python program that calculates a histogram, given a list of numbers like: 1 3 2 3 4 5 3.2 4 2 2 so the input parameters are the filename and the number of intervals. The program code is: #!/usr/bin/env python import os, sys, re, string, array, math import numpy Lista = [] db = sys.argv[1] db_file = open(db,"r") ic=0 nintervals= int(sys.argv[2]) while 1: line = db_file.readline() if not line: break ll=string.split(line) #print ll[6] Lista.insert(ic,float(ll[0])) ic=ic+1 lmin=min(Lista) print "min= ",lmin lmax=max(Lista) print "max= ",lmax width=666.666 width=(lmax-lmin)/nintervals print "width= ",width nelements=len(Lista) print "nelements= ",nelements print " " Histogram = numpy.zeros(shape=(nintervals)) for item in Lista: #print item int_number = 1 + int((item-lmin)/width) print " " print "item,lmin= ",item,lmin print "(item-lmin)/width= ",(item-lmin)," / ",width," ====== ",(float(item)-float(lmin))/float(width) print "int((item-lmin)/width)= ",int((item-lmin)/width) print item , " belongs to interval ", int_number, " which is from ", lmin+width*(int_number-1), " to ",lmin+width*int_number Histogram[int_number] = Histogram[int_number] + 1 4 but somehow I am completely lost, I get strange errors, can anybody help¿ Thanks

  Read the article

• Normalizing Strings using Regexes

  - by RasputinJones

  How do I match this string "1 & 2" from this string "Foo Bar 1 & 2"? How do I match this string "1, 2 & 3" from this string "Foo Baz 1, 2 & 3"? Trying to split out "Foo Bar" from the string using regexes while using the presence of "1 & 2" or "1, 2 & 3" as conditionals to normalize these strings into "Foo Bar 1" and "Foo Bar 2" or "Foo Baz 1", "Foo Baz 2" and "Foo Baz 3" respectively.

  Read the article

• Show elipses where text will be truncated as per iTunes

  - by Burt

  I a building an application with a similar layout to iTunes i.e. it has a sidebar that doubles as a menu. Some of the text will exceed the boundary and rather that having it be truncated I would like to show ellipses (see line image below "Purchased on My iPh..."). How would I go about this in WPF? Suppose I made the boundary movable i.e. user can change the size of the panel (split panel in Windows Forms), how would I go about dynamically showing the ellipses/text? Thanks in advance, B

  Read the article

• How to distribute the chance to display each SWF evenly among banner collection?

  - by Michael Mao

  Hi all: I am working on The ausdcf.org to try adding several banner ads in swf format to the top. Everything starts to work, but I've got several questions that need your help: The client chose not to go with Google AdManager, but prefer a "minimal approach" to do this task. What I am trying to do is sort of "mimicking" the way Google AdManager does for banners, that is, to split the chance of each particular swf to be shown to the visitor evenly among the banner collection. Definitely I can add some jQuery code to do this from client-side, a random number generator and if-else statement would work - just $.load() it! However, what if I'd like to make sure those disabled Javascript (is there any now btw?) still be able to see different swfs in each visit. Any suggestion on how to approach this? Many thanks in advance.

  Read the article

< Previous Page | 248 249 250 251 252 253 254 255 256 257 258 259  | Next Page >