Search Results

Search found 21984 results on 880 pages for 'android location'.

Page 254/880 | < Previous Page | 250 251 252 253 254 255 256 257 258 259 260 261  | Next Page >

  • What does ActiveSync on Android(Nexus One) actually do?

    - by aaronls
    Under the accounts settings of my nexus one I added a Microsoft ActiveSync account and pointed it to our OWA url. It doesn't seem to do anything, and I'm not really sure what it is supposed to do. I have both email sync and contacts sync enabled in the settings, but none of the email I get through outlook shows up on the phone nor are there any contacts added to my contacts list. When I setup the account settings if I type something in wrong it gives me an error, so it is doing something to test the connection, so to some extent I must have it setup right. It just doesn't seem to do anything. What is it actually supposed to do? Where would the contacts and emails show up if it sync'd successfully? How can I test it to ensure I have the correct URL specified?

    Read the article

  • Is there a PC equivalent for the Android 'Wifi Analyzer' App?

    - by Connor W
    I'm using the Wifi Analyzer app on my phone a lot at the moment as I need to set up and test some wireless networks. For people unfamiliar with the app, i've posted some screenshots of the app that I found on the internet. I'm looking for some software that will do the same or similar thing, but on a PC. I've looked on Google, but could not find anything of use. Thanks in advance for any information.

    Read the article

  • How do I stop linux from trying to mount android phone as usb storage?

    - by user1160711
    When I plug in my Motorola Triumph to my fedora 17 linux box USB port, I get an endless series of errors on the linux box as it desperately attempts to mount the phone as a USB drive. Stuff like this: Jun 23 10:26:00 zooty kernel: [528926.714884] end_request: critical target error, dev sdg, sector 4 Jun 23 10:26:00 zooty kernel: [528926.715865] sd 16:0:0:1: [sdg] Result: hostbyte=DID_OK driverbyte=DRIVER_SENSE Jun 23 10:26:00 zooty kernel: [528926.715869] sd 16:0:0:1: [sdg] Sense Key : Illegal Request [current] Jun 23 10:26:00 zooty kernel: [528926.715872] sd 16:0:0:1: [sdg] Add. Sense: Invalid field in cdb Jun 23 10:26:00 zooty kernel: [528926.715876] sd 16:0:0:1: [sdg] CDB: Read(10): 28 20 00 00 00 00 00 00 04 00 If I go ahead and tell the phone to allow linux to mount the USB storage, the messages stop, and I get a mounted drive, but if all I want to do is use the debug bridge, my log on linux will continue to fill with this junk. Is there some udev magic I can do to make the system ignore this particular device as far as usb storage goes? I just noticed that if I tell the phone to enable USB storage, let linux recognize the new disk, then tell the phone to disable USB storage again, I get one additional log message about capacity changing to zero, but the endless spew of messages stops, so I guess one work around is to enable and disable USB right away.

    Read the article

  • Is there a more powerful and feautre rich calender for android?

    - by the_drow
    I am looking for something that can manage my tasks (Or even incoparate with astrid tasks which is a great app), notes, meetings and color code them like in the google calander. Also I am looking for an app that will allow me to schedule forthnightly meetings ect. like in the google calander as I see that it's not supported in the default app. Is there some app you can recommend to me? Something that you guys used?

    Read the article

  • Which is the best way to sync and share contacts and calender between Thunderbird, iPhone and Android?

    - by bensch
    I would like to keep my contacts and a calendar synchronized between several desktops and cellphones. Is there a way to achieve this without using Google or similar organisations? I want to keep my data protected and safe, so an encrypted transfer would be useful. Do i need to install a service on my own rootserver? or are there any services available, that are safe? I read this post, but there is not mentioned not to use Google: Thunderbird contacts sync so no solutions with SoGo or LDAP. maybe Zimbra is a solution? or Funambol? I tried kolab, but had some unsolveable problems.

    Read the article

  • How to know if it's phishing or not in android apps?

    - by Zakaria Dza
    In IM apps (not only), there is a browser frame that appears and prompts for example to connect to facebook account, ebuddy for example (can't post pictures :( ) http://nsa34.casimages.com/img/2013/06/26//130626121230193046.jpg My question is: how can I know if this frame is from facebook.com and not a phishing website. I know that the apps in the play store are legit (mostly at least), but how can we trust apps that we install from outside the store? Or is there any way to check the credentials form action? Thanks for your answers and sorry for my bad english. (And sorry for the picture, couldn't make a screenshot ;-) )

    Read the article

  • deWitters Game loop in libgdx(Android)

    - by jaysingh
    I am a beginner and I want a complete example in LibGDX for android(Fixed time game loop) how to limit the framerate to 50 or 60. Also how to mangae interpolation between game state with simple example code e.g. deWiTTERS Game Loop: @Override public void render() { float deltaTime = Gdx.graphics.getDeltaTime(); Update(deltaTime); Render(deltaTime); } libgdx comments:- There is a Gdx.graphics.setVsync() method (generic = backend-independant), but it is not present in 0.9.1, only in the Nightlies. "Relying on vsync for fixed time steps is a REALLY bad idea. It will break on almost all hardware out there. See LwjglApplicationConfiguration, there's a flag in there that let s use toggle gpu/software vsynching. Play around with it." (Mario) NOTE that none of these limit the framerate to a specific value... if you REALLY need to limit the framerate for some reason, you'll have to handle it yourself by returning from render calls if xxx ms haven't passed since the last render call. li

    Read the article

  • Android device unable to obtain ip address connecting to AP created with Hostapd

    - by user114392
    I have a wired internet connection that works behind an authenticated proxy server. I followed the steps mentioned here and managed to create a hotspot which my google nexus 7 detects. However, it seems stuck at "obtaining an ip address" and is not able to connect to the internet. I initially received the following error message when running the script in the terminal: dnsmasq: failed to create listening socket for 127.0.0.1: Address already in use [fail] I figured it is because of a conflict with the network manager, I commented out the "dns=dnsmasq" line in the nm configuration file. After a network-manager restart, the first error doesn't show up but I get the following: Configuration file: /etc/hostapd.conf Failed to create interface mon.wlan0: -23 (Too many open files in system) Try to remove and re-create mon.wlan0 In both cases, however, the hotspot is created and is detected by my android device. only that it cannot "obtain an ip address" and connect to it. Is it because my eth0 connects via a proxy server? Or could there be something wrong with the dnsmasq config? Any help would be appreciated.

    Read the article

  • how can convert bitmap to byte array

    - by narasimha
    hi sir i am implementing image upload in sdcard image converting bitmap in bitmap convert in bytearray i am implementing this code import java.io.ByteArrayOutputStream; import java.io.DataInputStream; import java.io.EOFException; import java.io.File; import java.io.FileDescriptor; import java.io.FileInputStream; import java.io.FileNotFoundException; import java.io.IOException; import android.R.array; import android.app.Activity; import android.graphics.Bitmap; import android.graphics.BitmapFactory; import android.os.Bundle; import android.util.Log; import android.widget.ImageView; public class Photo extends Activity { @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); File f = new File("/sdcard/DCIM/1.jpg"); FileInputStream is = null; try { is = new FileInputStream(f); Bitmap bm; bm = BitmapFactory.decodeStream(is,null,null); ByteArrayOutputStream baos = new ByteArrayOutputStream(1000); bm.compress(Bitmap.CompressFormat.JPEG,75, baos); System.out.println("3........................"+bm); ImageView pic=(ImageView)this.findViewById(R.id.picview); pic.setImageBitmap(bm); } catch (Exception e) { // TODO: handle exception e.printStackTrace(); } } }this code is i am implementing how can convert bitmap in byte array INFO/System.out(12658): 3........................android.graphics.Bitmap@4358e3d0 in debug this will be displayed how can retrieve bitmap to byte array

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Different location of assemblies stoped the type casting.

    - by smwikipedia
    I am writing a custom Control class in C# for my main project. There're 2 projects, one for my Control and one for my main project. These 2 projects are in the same solution. I add a reference from my main project to my Control project. I notice that the first time after I drag my Control from the Tool Panel onto my main winform, an assembly folder was generated at the C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and the folder name is something like "jlebh-py01". The first build is always OK, but after I rebuild my Control class or whole solution, a new assembly folder will be generated at C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and then problem arises, my Control fails to behave well because Visual Studio says that the two types "originates from different location". The error message is as below: [A]MyControl.TypeXXX cannot be cast to [B]MyControl.TypeXXX. Type A orginates from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\jlebh-py01\MyControl.dll' Type B originats from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\ue4i-z3j01\MyControl.dll' If I reference the Control DLL directly instead of through project reference, or never rebuild the Control project after use my Control in the main project, things seem to be OK. Does anyone knows why? Is it the proper way to develop a control and a main project within the same solution? Many thanks...

    Read the article

  • longitude and latitude for current location returned from CLLocationManager in UK region is not corr

    - by bond
    Hi I am getting latitude and longitude of current location from CLLocationManager delegate method. It works fine for some region but its giving problem in UK region. When it is used in UK region, the current location longitude and latitude returned from CLLocationManager is not proper. Thanks heres a part of the logic i am using. -(void)viewWillAppear:(BOOL)animated { [super viewWillAppear:animated]; self.locationManager = [[CLLocationManager alloc] init]; if(self.locationManager.locationServicesEnabled) { self.locationManager.delegate = self; self.locationManager.distanceFilter = kCLDistanceFilterNone; self.locationManager.desiredAccuracy = kCLLocationAccuracyBest; } } -(void)locationManager:(CLLocationManager *)manager didUpdateToLocation:(CLLocation *)newLocation fromLocation:(CLLocation *)oldLocation { NSLog(@"Updating"); //if the time interval returned from core location is more than 15 seconds //we ignore it because it might be from an old session if ( abs([newLocation.timestamp timeIntervalSinceDate: [NSDate date]]) < 15) { self.latitude = newLocation.coordinate.latitude; self.longitude = newLocation.coordinate.longitude; NSLog(@"longitude=%f-- latitude=%f--",self.longitude,self.latitude); [self.locationManager stopUpdatingLocation]; [self removeActivityIndicator]; [[self locationSaved] setHidden:NO]; [[self viewLocationInMap] setEnabled:YES]; }}

    Read the article

  • when updating location.hash in Chrome the jQuery animation "freezes" for a second

    - by ubunut
    I'm trying to create a sort of "virtual gallery". I'm using Coda Slider 2.0 & jQuery v1.4.2 It behaves perfectly in IE, FF & Safari, but Chrome seems to reload/hang for a second when setting location.hash. This causes the jQuery animation to freeze for a second :S Example: http://hardyernst.dk/gallery.html try clicking on the navigation links above the pictures. The jQuery code that is being executed when clicking a navigation link: $('#coda-nav-' + sliderCount + ' a').each(function(z) { // What happens when a nav link is clicked $(this).bind("click", function() { offset = -(panelWidth*z); navClicks++; $(this).addClass('current').parents('ul').find('a').not($(this)).removeClass('current'); alterPanelHeight(z); currentPanel = z + 1; $('.panel-container', slider).stop().animate({ left: offset }, settings.slideEaseDuration, settings.slideEaseFunction, function(){ if (!settings.crossLinking) { return false; } // Don't change the URL hash unless cross-linking is specified }); }); }); if I add return false; at the end of the function. The animation will slide smoothly :)... BUT as you might have guessed the location.hash value remains unchanged :( I have tried setting the location.hash earlier in the function alas it did not change the behavior in Chrome Would be immensely grateful for any help :) Regards Ubunut

    Read the article

  • Specifiy package path for Androd:entries

    - by Priyank
    Hi. I am using following code in preferences page in android to show a list of items. The list and values are located in a file at location "app/res/xml/time.xml" <ListPreference android:title="Time unit list" android:summary="Select the time unit" android:dependency="Main_Option" android:key="listPref" android:defaultValue="1" android:entries="?xml:time/timet" android:entryValues="@xml:time/timet_values" /> The code for the time.xml is as follow: <?xml version="1.0" encoding="utf-8"?> <resources> <string-array name="timet"> <item>seconds</item> <item>minutes</item> <item>hours</item> </string-array> <string-array name="timet_values"> <item>3600</item> <item>60</item> <item>1</item> </string-array> </resources> I am not able to reference these values in my preference xml file. (The code snippet above). It gives an error. How can I specify packaged path for the List preferences entry and entry_values Any help is appreciated. Cheers

    Read the article

  • Quitting an application - is that frowned upon?

    - by Ted
    Moving on in my attempt to learn Android I just read the following: Question: Does the user have a choice to kill the application unless we put a menu option in to kill it? If no such option exists, how does the user terminate the application? Answert (Romain Guy): The user doesn't, the system handles this automatically. That's what the activity lifecycle (especially onPause/onStop/onDestroy) is for. No matter what you do, do not put a "quit" or "exit" application button. It is useless with Android's application model. This is also contrary to how core applications work. Hehe, for every step I take in the Android world I run into some sort of problem =( Apparently, you cannot quit an application in Android (but Android can very well totally destroy your app whenever it feels like it). Whats up with that? I am starting to think that its impossible to write an app that functions as a "normal app" - that the user can quit the app when he/she decides to do so. That is not something that should be relied upon the OS to do. The application I am trying to create is not an application for the Android Market. It is not an application for "wide use" by the general public, it is a business app that is going to be used in a very narrow business field. I was actually really looking forward to developing for the Android-platform, since it addresses a lot of issues that exist in Windows Mobile and .NET. However, the last week has been somewhat of a turnoff for me... I hope I dont have to abandon Android, but it doesnt look very good right now =( Is there a way for me to really quit the application?

    Read the article

  • org.apache.http.conn.HttpHostConnectException:Connection to http://172.20.38.143 refused

    - by Passion
    I have developed client server Application .I am accessing mysql with php running on my machine and client running on my cell which is connected to machine.WI-FI is also switched ON. Internet Permission are also added in Manifest file but then also the i encounter error 172.20.38.143 is IP OF MY MACHINE 06-01 13:20:10.391: W/System.err(11157): org.apache.http.conn.HttpHostConnectException: Connection to http://172.20.38.143 refused 06-01 13:20:10.401: W/System.err(11157): at org.apache.http.impl.conn.DefaultClientConnectionOperator.openConnection(DefaultClientConnectionOperator.java:183) 06-01 13:20:10.401: W/System.err(11157): at org.apache.http.impl.conn.AbstractPoolEntry.open(AbstractPoolEntry.java:164) 06-01 13:20:10.401: W/System.err(11157): at org.apache.http.impl.conn.AbstractPooledConnAdapter.open(AbstractPooledConnAdapter.java:119) 06-01 13:20:10.401: W/System.err(11157): at org.apache.http.impl.client.DefaultRequestDirector.execute(DefaultRequestDirector.java:360) 06-01 13:20:10.401: W/System.err(11157): at org.apache.http.impl.client.AbstractHttpClient.execute(AbstractHttpClient.java:674) 06-01 13:20:10.401: W/System.err(11157): at org.apache.http.impl.client.AbstractHttpClient.execute(AbstractHttpClient.java:511) 06-01 13:20:10.401: W/System.err(11157): at org.apache.http.impl.client.AbstractHttpClient.execute(AbstractHttpClient.java:489) 06-01 13:20:10.401: W/System.err(11157): at nineandroid.net.example.library.JSONParser.getJSONFromUrl(JSONParser.java:42) 06-01 13:20:10.401: W/System.err(11157): at nineandroid.net.example.library.UserFunctions.registerUser(UserFunctions.java:59) 06-01 13:20:10.401: W/System.err(11157): at nineandroid.net.example.RegisterActivity$1.onClick(RegisterActivity.java:52) 06-01 13:20:10.411: W/System.err(11157): at android.view.View.performClick(View.java:3567) 06-01 13:20:10.411: W/System.err(11157): at android.view.View$PerformClick.run(View.java:14224) 06-01 13:20:10.411: W/System.err(11157): at android.os.Handler.handleCallback(Handler.java:605) 06-01 13:20:10.411: W/System.err(11157): at android.os.Handler.dispatchMessage(Handler.java:92) 06-01 13:20:10.411: W/System.err(11157): at android.os.Looper.loop(Looper.java:137) 06-01 13:20:10.411: W/System.err(11157): at android.app.ActivityThread.main(ActivityThread.java:4517) 06-01 13:20:10.411: W/System.err(11157): at java.lang.reflect.Method.invokeNative(Native Method) 06-01 13:20:10.411: W/System.err(11157): at java.lang.reflect.Method.invoke(Method.java:511) 06-01 13:20:10.411: W/System.err(11157): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:993) 06-01 13:20:10.421: W/System.err(11157): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:760) 06-01 13:20:10.421: W/System.err(11157): at dalvik.system.NativeStart.main(Native Method) 06-01 13:20:10.421: W/System.err(11157): Caused by: java.net.ConnectException: failed to connect to /172.20.38.143 (port 80): connect failed: ENETUNREACH (Network is unreachable) 06-01 13:20:10.431: W/System.err(11157): at libcore.io.IoBridge.connect(IoBridge.java:114) 06-01 13:20:10.431: W/System.err(11157): at java.net.PlainSocketImpl.connect(PlainSocketImpl.java:192) 06-01 13:20:10.431: W/System.err(11157): at java.net.PlainSocketImpl.connect(PlainSocketImpl.java:459) 06-01 13:20:10.431: W/System.err(11157): at java.net.Socket.connect(Socket.java:848) 06-01 13:20:10.431: W/System.err(11157): at org.apache.http.conn.scheme.PlainSocketFactory.connectSocket(PlainSocketFactory.java:119) 06-01 13:20:10.431: W/System.err(11157): at org.apache.http.impl.conn.DefaultClientConnectionOperator.openConnection(DefaultClientConnectionOperator.java:144) 06-01 13:20:10.431: W/System.err(11157): ... 20 more 06-01 13:20:10.431: W/System.err(11157): Caused by: libcore.io.ErrnoException: connect failed: ENETUNREACH (Network is unreachable) 06-01 13:20:10.441: W/System.err(11157): at libcore.io.Posix.connect(Native Method) 06-01 13:20:10.441: W/System.err(11157): at libcore.io.BlockGuardOs.connect(BlockGuardOs.java:85) 06-01 13:20:10.441: W/System.err(11157): at libcore.io.IoBridge.connectErrno(IoBridge.java:127) 06-01 13:20:10.441: W/System.err(11157): at libcore.io.IoBridge.connect(IoBridge.java:112) 06-01 13:20:10.441: W/System.err(11157): ... 25 more 06-01 13:20:10.441: E/Buffer Error(11157): Error converting result java.lang.NullPointerException 06-01 13:20:10.451: E/JSON Parser(11157): Error parsing data org.json.JSONException: End of input at character 0 of 06-01 13:20:10.451: D/AndroidRuntime(11157): Shutting down VM 06-01 13:20:10.451: W/dalvikvm(11157): threadid=1: thread exiting with uncaught exception (group=0x40c0aa68) 06-01 13:20:10.451: E/AndroidRuntime(11157): FATAL EXCEPTION: main 06-01 13:20:10.451: E/AndroidRuntime(11157): java.lang.NullPointerException 06-01 13:20:10.451: E/AndroidRuntime(11157): at nineandroid.net.example.RegisterActivity$1.onClick(RegisterActivity.java:56) 06-01 13:20:10.451: E/AndroidRuntime(11157): at android.view.View.performClick(View.java:3567) 06-01 13:20:10.451: E/AndroidRuntime(11157): at android.view.View$PerformClick.run(View.java:14224) 06-01 13:20:10.451: E/AndroidRuntime(11157): at android.os.Handler.handleCallback(Handler.java:605) 06-01 13:20:10.451: E/AndroidRuntime(11157): at android.os.Handler.dispatchMessage(Handler.java:92) 06-01 13:20:10.451: E/AndroidRuntime(11157): at android.os.Looper.loop(Looper.java:137) 06-01 13:20:10.451: E/AndroidRuntime(11157): at android.app.ActivityThread.main(ActivityThread.java:4517) 06-01 13:20:10.451: E/AndroidRuntime(11157): at java.lang.reflect.Method.invokeNative(Native Method) 06-01 13:20:10.451: E/AndroidRuntime(11157): at java.lang.reflect.Method.invoke(Method.java:511) 06-01 13:20:10.451: E/AndroidRuntime(11157): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:993) 06-01 13:20:10.451: E/AndroidRuntime(11157): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:760) 06-01 13:20:10.451: E/AndroidRuntime(11157): at dalvik.system.NativeStart.main(Native Method) UserFunctions.java to call jsonParser public class UserFunctions { private JSONParser jsonParser; private static String loginURL = "http://172.20.38.143/ah_login_api/"; private static String registerURL = "http://172.20.38.143/ah_login_api/"; private static String login_tag = "login"; private static String register_tag = "register"; // constructor public UserFunctions(){ jsonParser = new JSONParser(); } /** * function make Login Request * @param email * @param password * */ public JSONObject loginUser(String email, String password){ // Building Parameters List<NameValuePair> params = new ArrayList<NameValuePair>(); params.add(new BasicNameValuePair("tag", login_tag)); params.add(new BasicNameValuePair("email", email)); params.add(new BasicNameValuePair("password", password)); JSONObject json = jsonParser.getJSONFromUrl(loginURL, params); // return json // Log.e("JSON", json.toString()); return json; } /** * function make Login Request * @param name * @param email * @param password * */ public JSONObject registerUser(String name, String email, String password){ // Building Parameters List<NameValuePair> params = new ArrayList<NameValuePair>(); params.add(new BasicNameValuePair("tag", register_tag)); params.add(new BasicNameValuePair("name", name)); params.add(new BasicNameValuePair("email", email)); params.add(new BasicNameValuePair("password", password)); // getting JSON Object JSONObject json = jsonParser.getJSONFromUrl(registerURL, params); // return json return json; } /** * Function get Login status * */ public boolean isUserLoggedIn(Context context){ DatabaseHandler db = new DatabaseHandler(context); int count = db.getRowCount(); if(count > 0){ // user logged in return true; } return false; } /** * Function to logout user * Reset Database * */ public boolean logoutUser(Context context){ DatabaseHandler db = new DatabaseHandler(context); db.resetTables(); return true; } } jsonParser.java public class JSONParser { static InputStream is = null; static JSONObject jObj = null; static String json = ""; // constructor public JSONParser() { } public JSONObject getJSONFromUrl(String url, List<NameValuePair> params) { // Making HTTP request try { // defaultHttpClient DefaultHttpClient httpClient = new DefaultHttpClient(); HttpPost httpPost = new HttpPost(url); httpPost.setEntity(new UrlEncodedFormEntity(params)); HttpResponse httpResponse = httpClient.execute(httpPost); HttpEntity httpEntity = httpResponse.getEntity(); is = httpEntity.getContent(); } catch (UnsupportedEncodingException e) { e.printStackTrace(); } catch (ClientProtocolException e) { e.printStackTrace(); } catch (IOException e) { e.printStackTrace(); } try { BufferedReader reader = new BufferedReader(new InputStreamReader( is, "iso-8859-1"), 8); StringBuilder sb = new StringBuilder(); String line = null; while ((line = reader.readLine()) != null) { sb.append(line + "\n"); } is.close(); json = sb.toString(); Log.e("JSON", json); } catch (Exception e) { Log.e("Buffer Error", "Error converting result " + e.toString()); } // try parse the string to a JSON object try { jObj = new JSONObject(json); } catch (JSONException e) { Log.e("JSON Parser", "Error parsing data " + e.toString()); } // return JSON String return jObj; } } RegisterActivity.java public class RegisterActivity extends Activity { Button btnRegister; Button btnLinkToLogin; EditText inputFullName; EditText inputEmail; EditText inputPassword; TextView registerErrorMsg; // JSON Response node names private static String KEY_SUCCESS = "success"; private static String KEY_UID = "uid"; private static String KEY_NAME = "name"; private static String KEY_EMAIL = "email"; private static String KEY_CREATED_AT = "created_at"; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.register); // Importing all assets like buttons, text fields inputFullName = (EditText) findViewById(R.id.registerName); inputEmail = (EditText) findViewById(R.id.registerEmail); inputPassword = (EditText) findViewById(R.id.registerPassword); btnRegister = (Button) findViewById(R.id.btnRegister); btnLinkToLogin = (Button) findViewById(R.id.btnLinkToLoginScreen); registerErrorMsg = (TextView) findViewById(R.id.register_error); // Register Button Click event btnRegister.setOnClickListener(new View.OnClickListener() { public void onClick(View view) { String name = inputFullName.getText().toString(); String email = inputEmail.getText().toString(); String password = inputPassword.getText().toString(); UserFunctions userFunction = new UserFunctions(); JSONObject json = userFunction.registerUser(name, email, password); // check for login response try { if (json.getString(KEY_SUCCESS) != null) { registerErrorMsg.setText(""); String res = json.getString(KEY_SUCCESS); if(Integer.parseInt(res) == 1){ // user successfully registred // Store user details in SQLite Database DatabaseHandler db = new DatabaseHandler(getApplicationContext()); JSONObject json_user = json.getJSONObject("user"); // Clear all previous data in database userFunction.logoutUser(getApplicationContext()); db.addUser(json_user.getString(KEY_NAME), json_user.getString(KEY_EMAIL), json.getString(KEY_UID), json_user.getString(KEY_CREATED_AT)); // Launch Dashboard Screen Intent dashboard = new Intent(getApplicationContext(), DashboardActivity.class); // Close all views before launching Dashboard dashboard.addFlags(Intent.FLAG_ACTIVITY_CLEAR_TOP); startActivity(dashboard); // Close Registration Screen finish(); }else{ // Error in registration registerErrorMsg.setText("Error occured in registration"); } } } catch (JSONException e) { e.printStackTrace(); } } }); // Link to Login Screen btnLinkToLogin.setOnClickListener(new View.OnClickListener() { public void onClick(View view) { Intent i = new Intent(getApplicationContext(), LoginActivity.class); startActivity(i); // Close Registration View finish(); } }); } }

    Read the article

  • Creating syncable Calendar in ICS

    - by user1390816
    I have a problem with creating a new Calendar in ICS. The Calendar should be synyable to the google Calendar. I try following: Uri calendarUri = CalendarContract.Calendars.CONTENT_URI; calendar.put(CalendarContract.Calendars.ACCOUNT_NAME, sync_account); calendar.put(CalendarContract.Calendars.ACCOUNT_TYPE, "com.google"); calendar.put(CalendarContract.Calendars.NAME, name); calendar.put(CalendarContract.Calendars.CALENDAR_DISPLAY_NAME, displayName); calendar.put(CalendarContract.Calendars.CALENDAR_COLOR, 0xFF008080); calendar.put(CalendarContract.Calendars.CALENDAR_ACCESS_LEVEL, CalendarContract.Calendars.CAL_ACCESS_OWNER); calendar.put(CalendarContract.Calendars.OWNER_ACCOUNT, true); calendar.put(CalendarContract.Calendars.VISIBLE, 1); calendar.put(CalendarContract.Calendars.SYNC_EVENTS, 1); calendarUri = calendarUri.buildUpon() .appendQueryParameter(CalendarContract.CALLER_IS_SYNCADAPTER, "true") .appendQueryParameter(CalendarContract.Calendars.ACCOUNT_NAME, sync_account) .appendQueryParameter(CalendarContract.Calendars.ACCOUNT_TYPE, "com.google") // CalendarContract.ACCOUNT_TYPE_LOCAL .build(); Uri result = activity.getContentResolver().insert(calendarUri, calendar); an I get always this error: 09-17 17:11:30.278: E/AndroidRuntime(13243): FATAL EXCEPTION: CalendarSyncAdapterAccountMonitor 09-17 17:11:30.278: E/AndroidRuntime(13243): java.lang.IllegalArgumentException: the name must not be empty: null 09-17 17:11:30.278: E/AndroidRuntime(13243): at android.accounts.Account.<init>(Account.java:48) 09-17 17:11:30.278: E/AndroidRuntime(13243): at com.google.android.syncadapters.calendar.CalendarSyncAdapter.onAccountsUpdated(CalendarSyncAdapter.java:1129) 09-17 17:11:30.278: E/AndroidRuntime(13243): at android.accounts.AccountManager$11.run(AccountManager.java:1279) 09-17 17:11:30.278: E/AndroidRuntime(13243): at android.os.Handler.handleCallback(Handler.java:605) 09-17 17:11:30.278: E/AndroidRuntime(13243): at android.os.Handler.dispatchMessage(Handler.java:92) 09-17 17:11:30.278: E/AndroidRuntime(13243): at android.os.Looper.loop(Looper.java:137) 09-17 17:11:30.278: E/AndroidRuntime(13243): at android.os.HandlerThread.run(HandlerThread.java:60) 09-17 17:11:30.293: E/android.os.Debug(1989): !@Dumpstate > dumpstate -k -t -n -z -d -o /data/log/dumpstate_app_error What can I do with the CalendarSyncAdapterAccountMonitor, that it is not empty? Thanks in advance.

    Read the article

  • Where to prompt for required file location at start of Win Forms application

    - by Murph
    I have an application that uses a file to store its data. I store the location of the file in the app settings so have two tests at startup: Do I have a setting for the file and Does the file (if I have a setting) exist If I fail either test I want to prompt the user for the file location - the mechanics of the are not the problem, I can read and write the app settings, fire off dialogs and otherwise request the data. If the user refuses to choose a file (or at least a file location) I want to exit the app. My problem is where to do this i.e. at what point in the flow of code. In an ideal world you start the app, show a splash screen, load the main form and run from there... I'm looking for a general pattern that allows me to slot the test for parameters into the right place so that I can prompt the user for whatever (and allowing that I have to worry about the fact that my splash screen is currently topmost for my app). I appreciate that this is a bit vague so will update this with code as we go along.

    Read the article

  • OnClickListener cannot be resolved to a type

    - by Webnet
    I'm diving into Java (this is day 1) and I'm trying to create a button that will trigger a notification when I click it... This code is based off of the notification documentation here, and UI events documentation here package com.example.contactwidget; import android.app.Activity; import android.app.Notification; import android.app.NotificationManager; import android.app.PendingIntent; import android.content.Context; import android.content.Intent; import android.os.Bundle; import android.widget.Button; public class ContactWidget extends Activity { /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); Button calc1 = (Button) findViewById(R.id.calc_button_1); calc1.setOnClickListener(buttonListener); setContentView(R.layout.main); } private static final int HELLO_ID = 1; //Error: OnClickListener cannot be resolved to a type private OnClickListener buttonListener = new OnClickListener() { public void onClick (View v) { String ns = Context.NOTIFICATION_SERVICE; NotificationManager mNotificationManager = (NotificationManager) getSystemService(ns); int icon = R.drawable.icon; CharSequence ticketBrief = "Button Pressed Brief"; CharSequence ticketTitle = "Button pressed"; CharSequence ticketText = "You pressed button 1"; long when = System.currentTimeMillis(); Notification notification = new Notification(icon, ticketBrief, when); Intent notificationIntent = new Intent(this, ContactWidget.class); PendingIntent contentIntent = PendingIntent.getActivity(this, 0, notificationIntent, 0); notification.setLatestEventInfo(getApplicationContext(), ticketTitle, ticketText, contentIntent); mNotificationManager.notify(HELLO_ID, notification); } } } I'm running into a problem: OnClickListener cannot be resolved to a type. The problem here is that I don't see any problems with my code in relation to the example I'm using

    Read the article

  • Change clickable TextView's color on focus and click?

    - by Daniel Jonsson
    I have a clickable TextView that I want to give some colors to. But I don't know how. Here are the relevant code snippets from my two files that I'm working with: TextView title = new TextView(this); title.setLayoutParams(new LayoutParams(LayoutParams.FILL_PARENT, LayoutParams.WRAP_CONTENT)); title.setTextColor(R.color.textcolor); title.setText(titleLine); title.setTypeface(null, Typeface.BOLD); title.setClickable(true); title.setId(idLine); title.setFocusable(true); title.setOnClickListener(new View.OnClickListener() { @Override public void onClick(View v) { /* Irrelevant code */ } }); And this is my textcolor.xml file: <?xml version="1.0" encoding="utf-8"?> <selector xmlns:android="http://schemas.android.com/apk/res/android"> <item android:state_pressed="true" android:color="#000000"/> <!-- pressed --> <item android:state_focused="true" android:color="#000000"/> <!-- focused --> <item android:color="#000000"/> <!-- default --> </selector> When I use the textcolor-file by typing title.setTextColor(R.color.textcolor);, the textcolor just becomes grey, regardless if I press it or so. Which is strange since I have written "#000000" in all color fields. But if I remove the setTextColor code, gets the textView a light grey color, and when I press it, it becomes black. But that aren't the colors that I want. So, can anyone help me with this problem? Just to clarify: I want to be able to specify the colors for the text when it's normal, pressed and focused.

    Read the article

  • displaying a dialog using an activity?

    - by ricardo123
    what am i doing wrong here or what do i need to add? package dialog.com; import android.app.Activity; import android.app.AlertDialog; import android.content.DialogInterface; import android.app.Dialog; import android.os.Bundle; import android.view.View; import android.widget.Button; import android.widget.Toast; public class Dialog extends Activity { CharSequence [] items = { "google", "apple", "microsoft" }; boolean [] itemschecked = new boolean [items.length]; /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); Button btn = (Button) findViewById(R.id.btn_dialog); btn.setOnClickListener(new View.OnClickListener() { public void onClick(View v) { showDialog(0); } }); } @Override protected Dialog onCreateDialog(int id) { switch(id) { case 0: return new AlertDialog.Builder(this) .setIcon(R.drawable.icon) .setTitle("This is a Dialog with some simple text...") .setPositiveButton("ok", new DialogInterface.OnClickListener() { public void onClick(DialogInterface dialog, int whichbutton) { Toast.makeText(getBaseContext(), "OK Clicked!", Toast.LENGTH_SHORT).show(); } }); .setNegativeButton("cancel",new DialogInterface.OnclickListener() { public void onClick(DialogInterface dialog, int whichButton) {Toast.makeText(getBaseContext(), "cancel clicked!", Toast.LENGTH_SHORT).show(); } }); .setMultiChoiceItems(itemschecked, new DialogInterface.OnMultiChoiceClickListener() { @Override public void onClick(dialoginterface dialog, int which, boolean isChecked) { Toast.makeText(getBaseContext(), items[which] + (isChecked ? " checked!": "unchecked!"), Toast.LENGTH_SHORT).show(); } } ) .create(); } return null: }}}

    Read the article

  • OpenVpn: Setting Up Openvpn in Ubuntu 10.04

    - by Deepak
    I am trying to setup OpenVpn Server on Ubuntu 10.04. I am not good in network concepts so its hard to understand the IP address that are given in the setup tutorial.. I could find many sites to setup openvpn server but i have few doubts in it. 1.I am mainly setting up the server to make it work for ANDROID.. So Plz give me a server setup link which will work for Android.. 2.I am setting up the server in my home and my system IP is 192.x.x.x . It will be useful if u share where i should give this IP address in the tutorial (which u share).. Plz help me as i am searching for this many days.. Regards, Deepak

    Read the article

< Previous Page | 250 251 252 253 254 255 256 257 258 259 260 261  | Next Page >