Search Results

Search found 23134 results on 926 pages for 'program counter'.

Page 266/926 | < Previous Page | 262 263 264 265 266 267 268 269 270 271 272 273  | Next Page >

  • Linking with Boost error

    - by drhorrible
    I just downloaded and ran the boost installer for version 1.42 (from boostpro.com), and set up my project according to the getting started guide. However, when I build the program, I get this linker error: LINK : fatal error LNK1104: cannot open file 'libboost_program_options-vc90-mt-gd-1_42.lib' The build log adds this (I've replaced project-specific paths with *'s): Creating temporary file "******\Debug\RSP00001252363252.rsp" with contents [ /OUT:"*********.exe" /INCREMENTAL /LIBPATH:"C:\Program Files\boost\boost_1_42_0\lib" /MANIFEST /MANIFESTFILE:"Debug\hw6.exe.intermediate.manifest" /MANIFESTUAC:"level='asInvoker' uiAccess='false'" /DEBUG /PDB:"********\Debug\***.pdb" /SUBSYSTEM:CONSOLE /DYNAMICBASE /NXCOMPAT /MACHINE:X86 kernel32.lib user32.lib gdi32.lib winspool.lib comdlg32.lib advapi32.lib shell32.lib ole32.lib oleaut32.lib uuid.lib odbc32.lib odbccp32.lib ".\Debug\****.obj" ".\Debug\****.exe.embed.manifest.res" ] Creating command line "link.exe @********\Debug\RSP00001252363252.rsp /NOLOGO /ERRORREPORT:PROMPT" I've also emailed [email protected] (with a message very similar to this), but I thought maybe so would be faster.

    Read the article

  • Easier debugging stl array

    - by bobobobo
    In MSVC++ I have a vector. Whenever you go out of bounds of the vector (in debug mode, launched as "Start Debugging"), when you step out of bounds of the vector the program halts with a dialog box: Microsoft Visual C++ Debug Library ==== Debug Assertion Failed! Expression: Vector subscript out of range Abort | Retry | Ignore So what I want though is the MSVC++ debugger within visual studio to STOP AT THE LINE WHERE THE OUT OF BOUNDS OCCURRED, not give me this dialog box. How can I cause the program to "break" properly and be able to step through code /inspect variables when an out of bounds occurs on an STL vector?

    Read the article

  • 'dxerr9.h': No such file or directory

    - by numerical25
    I am trying to compile a program I took off a cd from a book that uses directx to render 3d objects. when i press compile I get the following error C1083: Cannot open include file: 'dxerr9.h': No such file or directory I am using VC++ 2008 Express Edition and i am running off of Vista. I went to the following folder C:\Program Files\Microsoft SDKs\Windows\v6.0A\Include and I was not able to find the header there. Unless I am looking in the wrong place. When I initially installed DX sdk I allowed the installer to put everything in a default location. I am not sure If I am looking in the right places or what.

    Read the article

  • How to combine library with my jar?

    - by Dacto
    Ok so i wrote a program that makes use of a 3rd party open source library and i want to package it with my program in a single jar. I'm using netbeans 6.8 and everything I've tried java always spit back the error: java.lang.NoClassDefFoundError: libraryname; off topic:also i would like to know how to make an executable-jar(exe) through netbeans if it is possible. (ive seen programs that were written in java but were an .exe) EDIT discovered a plugin for eclipse called FatJar which can do what i want, but i cant find something similar for netbeans, is there such thing?

    Read the article

  • c# Properties.Settings.Default Doesn't work as expected

    - by Jack
    I've been working on a program to automate my backup checks with LogMeIn backup (a windows forms based program). I now need a way to store user settings, to save information easily. I've never worked with the Application/User settings that is somewhat "built-in" - and decided to try it, but ran into problems. I added four settings for now: IncludeCriteria (Specialized.StringCollection) ExcludeCriteria (Specialized.StringCollection) ReportPath (string) ReportType (int) But the behavior doesn't act as expected (go figure). After saving some values in my program, I go back into edit/view my settings values using the VS 2008 settings editor. None of my values are stored. While I think this may be because those values are just default values, wouldn't that be where they can be stored/read/changed? Here is my load form code (still very unrefined): private void setupForm() { txtPath.Text = BackupReport.Properties.Settings.Default.ReportPath == null ? "" : BackupReport.Properties.Settings.Default.ReportPath; if (BackupReport.Properties.Settings.Default.ReportType == 0) { radioHTML.Checked = true; } else radioExcel.Checked = true; if (BackupReport.Properties.Settings.Default.IncludeCriteria.Count > 0) { listIncludeCriteria.DataSource = Properties.Settings.Default.IncludeCriteria; //foreach (string s in Properties.Settings.Default.IncludeCriteria) // listIncludeCriteria.Items.Add(s); } if (BackupReport.Properties.Settings.Default.ExcludeCriteria.Count > 0) { listExcludeCriteria.DataSource = BackupReport.Properties.Settings.Default.ExcludeCriteria; //foreach (string s in Properties.Settings.Default.ExcludeCriteria) // listExcludeCriteria.Items.Add(s); } } listIncludeCriteria is just a listbox. When the user saves I call this method: private void saveSettings() { //var settings = BackupReport.Properties.Settings; if (txtPath.Text != "") { BackupReport.Properties.Settings.Default.ReportPath = txtPath.Text; } if (listIncludeCriteria.Items.Count > 0) { //BackupReport.Properties.Settings.Default.IncludeCriteria = (StringCollection)listIncludeCriteria.Items.AsQueryable(); foreach (var i in listIncludeCriteria.Items) { if (!isIncludeDuplicate(i.ToString())) BackupReport.Properties.Settings.Default.IncludeCriteria.Add(i.ToString()); } } if (listExcludeCriteria.Items.Count > 0) { //BackupReport.Properties.Settings.Default.ExcludeCriteria = (StringCollection)listExcludeCriteria.Items.AsQueryable(); foreach (var i in listExcludeCriteria.Items) { if (!isExcludeDuplicate(i.ToString())) Properties.Settings.Default.ExcludeCriteria.Add(i.ToString()); } } if (radioExcel.Checked == true) BackupReport.Properties.Settings.Default.ReportType = 1; else BackupReport.Properties.Settings.Default.ReportType = 0; BackupReport.Properties.Settings.Default.Save(); //Properties.Settings.Default.Save(); this.DialogResult = DialogResult.OK; this.Close(); } The wierd thing is when the form loads, the path I put in the first time seems to come up (ReportPath) - even the listBoxes are populated with a bunch of crap I put in - yet I cant find these values anywhere. Any help would be appreciated! Josh

    Read the article

  • Undefined variable from import when using wxPython in pydev

    - by Bibendum
    I just downloaded wxPython, and was running some of the sample programs from here. However, on every line that uses a variable from wx.*, I get a "Undefined variable from import error" For example, the following program generates five errors on lines 1,4,8, and two on line 5: import wx class MyFrame(wx.Frame): """ We simply derive a new class of Frame. """ def __init__(self, parent, title): wx.Frame.__init__(self, parent, title=title, size=(200,100)) self.control = wx.TextCtrl(self, style=wx.TE_MULTILINE) self.Show(True) app = wx.App(False) frame = MyFrame(None, 'Small editor') app.MainLoop() The program, however, compiles and runs perfectly. I haven't made any significant modifications to pydev or eclipse, and the wxPython install is fresh.

    Read the article

  • Reader for Android Updates; Now with Feed Widgets and More

    - by ETC
    Android phone owners rocking the official Google Reader app will be pleased to see the new update includes much requested features such as polished feed widgets, unread counter widgets, and a handy “mark previous as read” button. Widgets have long been one of the most requested feature for Google Reader for Android. This update rolls them out in two forms. News ticker widgets show you current headlines for your Google Reader folders (as seen in the screenshot here); folder widgets function just as unread counters and only take up a 1×1 space. In addition to the widgets another much requested feature made an appearance. While scrolling through your feed you can now mark all the previous entries as read. Hit up the link below to read more or visit the Android Market on your phone to update the application. Updates to the Google Reader App for Android [The Official Google Reader Blog] Latest Features How-To Geek ETC How to Enable User-Specific Wireless Networks in Windows 7 How to Use Google Chrome as Your Default PDF Reader (the Easy Way) How To Remove People and Objects From Photographs In Photoshop Ask How-To Geek: How Can I Monitor My Bandwidth Usage? Internet Explorer 9 RC Now Available: Here’s the Most Interesting New Stuff Here’s a Super Simple Trick to Defeating Fake Anti-Virus Malware Comix is an Awesome Comics Archive Viewer for Linux Get the MakeUseOf eBook Guide to Speeding Up Windows for Free Need Tech Support? Call the Star Wars Help Desk! [Video Classic] Reclaim Vertical UI Space by Adding a Toolbar to the Left or Right Side of Firefox Androidify Turns You into an Android-style Avatar Reader for Android Updates; Now with Feed Widgets and More

    Read the article

  • Prime Numbers Code Help

    - by andrew
    Hello Everybody, I am suppose to "write a Java program that reads a positive integer n from standard input, then prints out the first n prime number." It's divided into 3 parts. 1st: This function will return true or false according to whether m is prime or composite. The array argument P will contain a sufficient number of primes to do the testing. Specifically, at the time isPrime() is called, array P must contain (at least) all primes p in the range 2 p m . For instance, to test m = 53 for primality, one must do successive trial divisions by 2, 3, 5, and 7. We go no further since 11 53 . Thus a precondition for the function call isPrime(53, P) is that P[0] = 2 , P[1] = 3 , P[2] = 5, and P[3] = 7 . The return value in this case would be true since all these divisions fail. Similarly to test m =143 , one must do trial divisions by 2, 3, 5, 7, and 11 (since 13 143 ). The precondition for the function call isPrime(143, P) is therefore P[0] = 2 , P[1] = 3 , P[2] = 5, P[3] = 7 , and P[4] =11. The return value in this case would be false since 11 divides 143. Function isPrime() should contain a loop that steps through array P, doing trial divisions. This loop should terminate when 2 either a trial division succeeds, in which case false is returned, or until the next prime in P is greater than m , in which case true is returned. Then there is the "main function" • Check that the user supplied exactly one command line argument which can be interpreted as a positive integer n. If the command line argument is not a single positive integer, your program will print a usage message as specified in the examples below, then exit. • Allocate array Primes[] of length n and initialize Primes[0] = 2 . • Enter a loop which will discover subsequent primes and store them as Primes[1] , Primes[2], Primes[3] , ……, Primes[n -1] . This loop should contain an inner loop which walks through successive integers and tests them for primality by calling function isPrime() with appropriate arguments. • Print the contents of array Primes[] to stdout, 10 to a line separated by single spaces. In other words Primes[0] through Primes[9] will go on line 1, Primes[10] though Primes[19] will go on line 2, and so on. Note that if n is not a multiple of 10, then the last line of output will contain fewer than 10 primes. The last function is called "usage" which I am not sure how to execute this! Your program will include a function called Usage() having signature static void Usage() that prints this message to stderr, then exits. Thus your program will contain three functions in all: main(), isPrime(), and Usage(). Each should be preceded by a comment block giving it’s name, a short description of it’s operation, and any necessary preconditions (such as those for isPrime().) And hear is my code, but I am having a bit of a problem and could you guys help me fix it? If I enter the number "5" it gives me the prime numbers which are "6,7,8,9" which doesn't make much sense. import java.util.; import java.io.; import java.lang.*; public class PrimeNumber { static boolean isPrime(int m, int[] P){ int squarert = Math.round( (float)Math.sqrt(m) ); int i = 2; boolean ans=false; while ((i<=squarert) & (ans==false)) { int c= P[i]; if (m%c==0) ans= true; else ans= false; i++; } /* if(ans ==true) ans=false; else ans=true; return ans; } ///****main public static void main(String[] args ) { Scanner in= new Scanner(System.in); int input= in.nextInt(); int i, j; int squarert; boolean ans = false; int userNum; int remander = 0; System.out.println("input: " + input); int[] prime = new int[input]; prime[0]= 2; for(i=1; i ans = isPrime(j,prime); j++;} prime[i] = j; } //prnt prime System.out.println("The first " + input + " prime number(s) are: "); for(int r=0; r }//end of main } Thanks for the help

    Read the article

  • .gitconfig error

    - by Tanner
    I edited my .gitconfig file to add support for LabView and it appears that I did something that Git doesn't exactly like. The problem is it (Git) doesn't tell me what it doesn't like. What did I do wrong? The error message doesn't help much either: "fatal: bad config file line 13 in c:/Users/Tanner/.gitconfig" [gui] recentrepo = C:/Users/Tanner/Desktop/FIRST 2010 Beta/Java/LoganRover [user] name = Tanner Smith email = [email protected] [merge "labview"] name = LabView 3-Way Merge driver = “C:\Program Files\National Instruments\Shared\LabVIEW Merge\LVMerge.exe” “C:\Program Files\National Instruments\LabVIEW 8.6\LabVIEW.exe” %O %B %A %A recursive = binary And I'm not seeing a line 13, but usually that would mean something is wrong at the end? I don't know, Git is new to me.

    Read the article

  • Performance Optimization &ndash; It Is Faster When You Can Measure It

    - by Alois Kraus
    Performance optimization in bigger systems is hard because the measured numbers can vary greatly depending on the measurement method of your choice. To measure execution timing of specific methods in your application you usually use Time Measurement Method Potential Pitfalls Stopwatch Most accurate method on recent processors. Internally it uses the RDTSC instruction. Since the counter is processor specific you can get greatly different values when your thread is scheduled to another core or the core goes into a power saving mode. But things do change luckily: Intel's Designer's vol3b, section 16.11.1 "16.11.1 Invariant TSC The time stamp counter in newer processors may support an enhancement, referred to as invariant TSC. Processor's support for invariant TSC is indicated by CPUID.80000007H:EDX[8]. The invariant TSC will run at a constant rate in all ACPI P-, C-. and T-states. This is the architectural behavior moving forward. On processors with invariant TSC support, the OS may use the TSC for wall clock timer services (instead of ACPI or HPET timers). TSC reads are much more efficient and do not incur the overhead associated with a ring transition or access to a platform resource." DateTime.Now Good but it has only a resolution of 16ms which can be not enough if you want more accuracy.   Reporting Method Potential Pitfalls Console.WriteLine Ok if not called too often. Debug.Print Are you really measuring performance with Debug Builds? Shame on you. Trace.WriteLine Better but you need to plug in some good output listener like a trace file. But be aware that the first time you call this method it will read your app.config and deserialize your system.diagnostics section which does also take time.   In general it is a good idea to use some tracing library which does measure the timing for you and you only need to decorate some methods with tracing so you can later verify if something has changed for the better or worse. In my previous article I did compare measuring performance with quantum mechanics. This analogy does work surprising well. When you measure a quantum system there is a lower limit how accurately you can measure something. The Heisenberg uncertainty relation does tell us that you cannot measure of a quantum system the impulse and location of a particle at the same time with infinite accuracy. For programmers the two variables are execution time and memory allocations. If you try to measure the timings of all methods in your application you will need to store them somewhere. The fastest storage space besides the CPU cache is the memory. But if your timing values do consume all available memory there is no memory left for the actual application to run. On the other hand if you try to record all memory allocations of your application you will also need to store the data somewhere. This will cost you memory and execution time. These constraints are always there and regardless how good the marketing of tool vendors for performance and memory profilers are: Any measurement will disturb the system in a non predictable way. Commercial tool vendors will tell you they do calculate this overhead and subtract it from the measured values to give you the most accurate values but in reality it is not entirely true. After falling into the trap to trust the profiler timings several times I have got into the habit to Measure with a profiler to get an idea where potential bottlenecks are. Measure again with tracing only the specific methods to check if this method is really worth optimizing. Optimize it Measure again. Be surprised that your optimization has made things worse. Think harder Implement something that really works. Measure again Finished! - Or look for the next bottleneck. Recently I have looked into issues with serialization performance. For serialization DataContractSerializer was used and I was not sure if XML is really the most optimal wire format. After looking around I have found protobuf-net which uses Googles Protocol Buffer format which is a compact binary serialization format. What is good for Google should be good for us. A small sample app to check out performance was a matter of minutes: using ProtoBuf; using System; using System.Diagnostics; using System.IO; using System.Reflection; using System.Runtime.Serialization; [DataContract, Serializable] class Data { [DataMember(Order=1)] public int IntValue { get; set; } [DataMember(Order = 2)] public string StringValue { get; set; } [DataMember(Order = 3)] public bool IsActivated { get; set; } [DataMember(Order = 4)] public BindingFlags Flags { get; set; } } class Program { static MemoryStream _Stream = new MemoryStream(); static MemoryStream Stream { get { _Stream.Position = 0; _Stream.SetLength(0); return _Stream; } } static void Main(string[] args) { DataContractSerializer ser = new DataContractSerializer(typeof(Data)); Data data = new Data { IntValue = 100, IsActivated = true, StringValue = "Hi this is a small string value to check if serialization does work as expected" }; var sw = Stopwatch.StartNew(); int Runs = 1000 * 1000; for (int i = 0; i < Runs; i++) { //ser.WriteObject(Stream, data); Serializer.Serialize<Data>(Stream, data); } sw.Stop(); Console.WriteLine("Did take {0:N0}ms for {1:N0} objects", sw.Elapsed.TotalMilliseconds, Runs); Console.ReadLine(); } } The results are indeed promising: Serializer Time in ms N objects protobuf-net   807 1000000 DataContract 4402 1000000 Nearly a factor 5 faster and a much more compact wire format. Lets use it! After switching over to protbuf-net the transfered wire data has dropped by a factor two (good) and the performance has worsened by nearly a factor two. How is that possible? We have measured it? Protobuf-net is much faster! As it turns out protobuf-net is faster but it has a cost: For the first time a type is de/serialized it does use some very smart code-gen which does not come for free. Lets try to measure this one by setting of our performance test app the Runs value not to one million but to 1. Serializer Time in ms N objects protobuf-net 85 1 DataContract 24 1 The code-gen overhead is significant and can take up to 200ms for more complex types. The break even point where the code-gen cost is amortized by its faster serialization performance is (assuming small objects) somewhere between 20.000-40.000 serialized objects. As it turned out my specific scenario involved about 100 types and 1000 serializations in total. That explains why the good old DataContractSerializer is not so easy to take out of business. The final approach I ended up was to reduce the number of types and to serialize primitive types via BinaryWriter directly which turned out to be a pretty good alternative. It sounded good until I measured again and found that my optimizations so far do not help much. After looking more deeper at the profiling data I did found that one of the 1000 calls did take 50% of the time. So how do I find out which call it was? Normal profilers do fail short at this discipline. A (totally undeserved) relatively unknown profiler is SpeedTrace which does unlike normal profilers create traces of your applications by instrumenting your IL code at runtime. This way you can look at the full call stack of the one slow serializer call to find out if this stack was something special. Unfortunately the call stack showed nothing special. But luckily I have my own tracing as well and I could see that the slow serializer call did happen during the serialization of a bool value. When you encounter after much analysis something unreasonable you cannot explain it then the chances are good that your thread was suspended by the garbage collector. If there is a problem with excessive GCs remains to be investigated but so far the serialization performance seems to be mostly ok.  When you do profile a complex system with many interconnected processes you can never be sure that the timings you just did measure are accurate at all. Some process might be hitting the disc slowing things down for all other processes for some seconds as well. There is a big difference between warm and cold startup. If you restart all processes you can basically forget the first run because of the OS disc cache, JIT and GCs make the measured timings very flexible. When you are in need of a random number generator you should measure cold startup times of a sufficiently complex system. After the first run you can try again getting different and much lower numbers. Now try again at least two times to get some feeling how stable the numbers are. Oh and try to do the same thing the next day. It might be that the bottleneck you found yesterday is gone today. Thanks to GC and other random stuff it can become pretty hard to find stuff worth optimizing if no big bottlenecks except bloatloads of code are left anymore. When I have found a spot worth optimizing I do make the code changes and do measure again to check if something has changed. If it has got slower and I am certain that my change should have made it faster I can blame the GC again. The thing is that if you optimize stuff and you allocate less objects the GC times will shift to some other location. If you are unlucky it will make your faster working code slower because you see now GCs at times where none were before. This is where the stuff does get really tricky. A safe escape hatch is to create a repro of the slow code in an isolated application so you can change things fast in a reliable manner. Then the normal profilers do also start working again. As Vance Morrison does point out it is much more complex to profile a system against the wall clock compared to optimize for CPU time. The reason is that for wall clock time analysis you need to understand how your system does work and which threads (if you have not one but perhaps 20) are causing a visible delay to the end user and which threads can wait a long time without affecting the user experience at all. Next time: Commercial profiler shootout.

    Read the article

  • How is IntelliJ better than Eclipse?

    - by NickC
    I know there have been questions like What is your favorite editor/IDE?, but none of them have answered this question: Why spend the money on IntelliJ when Eclipse is free? I'm personally a big IntelliJ fan, but I haven't really tried Eclipse. I've used IntelliJ for projects that were Java, JSP, HTML/CSS, Javascript, PHP, and Actionscript, and the latest version, 9, has been excellent for all of them. Many coworkers in the past have told me that they believe Eclipse to be "pretty much the same" as IntelliJ, but, to counter that point, I've occasionally sat behind a developer using Eclipse who's seemed comparably inefficient (to accomplish roughly the same task), and I haven't experienced this with IntelliJ. They may be on par feature-by-feature but features can be ruined by a poor user experience, and I wonder if it's possible that IntelliJ is easier to pick up and discover time-saving features. For users who are already familiar with Eclipse, on top of the real cost of IntelliJ, there is also the cost of time spent learning the new app. Eclipse gets a lot of users who simply don't want to spend $250 on an IDE. If IntelliJ really could help my team be more productive, how could I sell it to them? For those users who've tried both, I'd be very interested in specific pros or cons either way.

    Read the article

  • Why do I get a null pointer exception from TabWidget?

    - by rushinge
    I'm writing an android program in which I have an activity that uses tabs. The Activity public class UnitActivity extends TabActivity { @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); TabHost tabHost = getTabHost(); TabSpec spec; Resources res = getResources(); LayoutInflater.from(this).inflate(R.layout.unit_view, tabHost.getTabContentView(), true); spec = tabHost.newTabSpec("controls"); spec.setIndicator("Control", res.getDrawable(R.drawable.ic_tab_equalizer)); spec.setContent(R.id.txtview); tabHost.addTab(spec); } } The XML referenced by R.layout.unit_view <?xml version="1.0" encoding="utf-8"?> <TabHost xmlns:android="http://schemas.android.com/apk/res/android" android:id="@android:id/tabhost" android:layout_width="fill_parent" android:layout_height="fill_parent"> <LinearLayout android:layout_width="fill_parent" android:layout_height="fill_parent" android:padding="5dp"> <TabWidget android:id="@android:id/tabs" android:layout_width="fill_parent" android:layout_height="wrap_content"/> <FrameLayout android:id="@android:id/tabcontent" android:layout_width="fill_parent" android:layout_height="fill_parent" android:padding="5dp"> <TextView android:id="@+id/txtview" android:layout_width="fill_parent" android:layout_height="fill_parent" android:gravity="bottom" android:text="nullpointer this!" /> </FrameLayout> </LinearLayout> </TabHost> As far as I can see I'm doing the same thing I see in the tabs1 api sample from the android sdk. I've tried "getLayoutInflator()" instead of "LayoutInflator.from(this)" with the same result. If I replace the LayoutInflater line with "setContentView(R.layout.unit_view)" my program doesn't crash with a null pointer exception but my content is completely blank and empty. I get the tab and that's it. I've checked to make sure R.layout.unit_view and tabHost are not null when it runs the LayoutInflater line and they seem to be fine. They're defenitely not null. I've also checked to make sure LayoutInflater.from(this) returns a valid layout inflater object and it does. The logcat indicating the error says E/AndroidRuntime( 541): java.lang.NullPointerException E/AndroidRuntime( 541): at android.widget.TabWidget.dispatchDraw(TabWidget.java:206) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.View.draw(View.java:6538) E/AndroidRuntime( 541): at android.widget.FrameLayout.draw(FrameLayout.java:352) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1531) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.View.draw(View.java:6538) E/AndroidRuntime( 541): at android.widget.FrameLayout.draw(FrameLayout.java:352) E/AndroidRuntime( 541): at com.android.internal.policy.impl.PhoneWindow$DecorView.draw(PhoneWindow.java:1830) E/AndroidRuntime( 541): at android.view.ViewRoot.draw(ViewRoot.java:1349) E/AndroidRuntime( 541): at android.view.ViewRoot.performTraversals(ViewRoot.java:1114) E/AndroidRuntime( 541): at android.view.ViewRoot.handleMessage(ViewRoot.java:1633) E/AndroidRuntime( 541): at android.os.Handler.dispatchMessage(Handler.java:99) E/AndroidRuntime( 541): at android.os.Looper.loop(Looper.java:123) E/AndroidRuntime( 541): at android.app.ActivityThread.main(ActivityThread.java:4363) E/AndroidRuntime( 541): at java.lang.reflect.Method.invokeNative(Native Method) E/AndroidRuntime( 541): at java.lang.reflect.Method.invoke(Method.java:521) E/AndroidRuntime( 541): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:860) E/AndroidRuntime( 541): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:618) E/AndroidRuntime( 541): at dalvik.system.NativeStart.main(Native Method) I/Process ( 61): Sending signal. PID: 541 SIG: 3 I/dalvikvm( 541): threadid=7: reacting to signal 3 I/dalvikvm( 541): Wrote stack trace to '/data/anr/traces.txt' Anybody have any idea how I can get this content into a tab without crashing my application? My actual program is more complex and has more than one tab but I simplified it down to this in an attempt to find out why it's crashing but it still crashes and I don't know why. If I don't use LayoutInflator my program doesn't crash but I don't get any content either, just tabs.

    Read the article

  • C Privilege Escalation (With Password)

    - by AriX
    Hey everyone, I need to write a C program that will allow me to read/write files that are owned by root. However, I can only run the code under another user. I have the root password, but there are no "sudo" or "su" commands on the system, so I have no way of accessing the root account (there are practically no shell commands whatsoever, actually). I don't know a whole lot about UNIX permissions, so I don't know whether or not it is actually possible to do this without exploiting the system in some way or running a program owned by root itself (with +s or whatever). Any advice? Thanks! P.S. No, this isn't anything malicious, this is on an iPhone.

    Read the article

  • Aging vs. Coding Skills

    - by Renan Malke Stigliani
    A little background, since it can be part of my point fo view. I'm a C#/Java programmer with age of 23, coding since my 18's. I started studying C and working with Cobol, and after 1 year I quickly moved to C#/Java Web Development, and have worked with it in about 3/4 companies. (I've just moved again) In my (brief) professional career I encountered some older programmers, all the times it was very hard to work with them, since I was way better programmer than they. And it is not about just the language skills, some of them had seriously problems understanding basic logic. Now I wonder how theese programmer get jobs on the market since (I imagine) they have more expenses, and thus have to make more money, and are really counter-productives. In theese examples, others project member have to constantly keep stoping for helping them out. All the times, they eventually quit... So I wonder... May the aging process slow down the learning rate and logic thinking? Does the programmer has to, or at least should, move to a management area before getting old? Please, my intention is not to be disrespectful with older persons. I am fully aware that this is NOT the case of all older programmers, I often see around very good old programmers on the net, I just never met them for close.

    Read the article

  • Lotus Notes rich text field to RTF File - VB

    - by user236105
    Here is my problem, I am doing a data migration from Lotus notes to another type of software that does not support Rich Text Fields. I am trying to write a VB 2005 program that will take any rich text fields that are found and place them into an RTF file - which will be uploaded as an attachment in the new software. I cannot get the program to take the rich text formating or objects to the RTF file, only the plain text. I have tried everything under the sun using the COM library to get these objects out to no avail. Any ideas or suggestions? Thank you in advance Bryan

    Read the article

  • On contract work, obligations to said contract, and looking out for yourself…

    - by jlnorsworthy
    Without boring you all with details, my last two contract assignments were cut short; I was given 3 days notice on one, and 4 weeks notice on the other. Neither of these were due to performance – they both basically came down budget issues. On my second contract, I got the feeling that I may not have been a great place to stay for the duration of my contract. Because of money/time spent getting me in the door, and the possible negative effect of my employer/recruiter, I decided to stay at least for a few months (and start looking several weeks before the end of my supposedly “extendable” contract). These experiences have left me a little wary of contract work. It seems that if I land a bad contract, that my recruiter would take a hit (reputation or otherwise) if I quickly found another job. But on the other hand, the client company won’t think twice of ending the contract early for any reason. I know that the counter argument to this is “maybe your recruiter shouldn’t have put you into a crappy assignment”… either way, it seems that since I am relying on him to provide me with work, that I should try to not damage his reputation with client companies. I’m basically brand new to contracting (these were my first two contracts) so these concerns are new to me. TLDR: Is contract work, by its very nature, largely unstable? Am I worried too much about my recruiter? Should I be quicker to start looking for a new job even after just weeks at a new company (when the environment seems unstable)? If so, do I look through my recruiter or just find another position by any means necessary?

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Using Python to call Mencoder with some arguments

    - by Manu
    Hello, I'll start by saying that I am very, very new to Python. I used to have a Windows/Dos batch file in order to launch Mencoder with the right set of parameters, without having to type them each time. Things got messy when I tried to improve my script, and I decided that it would be a good opportunity to try coding something in python. I've come up with that : #!/usr/bin/python import sys, os #Path to mencoder mencoder = "C:\Program Files\MPlayer-1.0rc2\mencoder.exe" infile = "holidays.avi" outfile = "holidays (part1).avi" startTime = "00:48:00" length = "00:00:15" commande = "%s %s -ovc copy -oac copy -ss %s -endpos %s -o %s" os.system(commande % (mencoder, infile, startTime, length, outfile)) #Pause raw_input() But that doesn't work, windows complains that "C:\Program" is not recognized command. I've trying putting some "\"" here and there, but that didn't help.

    Read the article

  • WIX will not add HKLM registry setting during Windows 7 install

    - by Scott Boettger
    Good Morning, I have written a WiX installer that works perfectly with Windows XP but when installing to a Windows 7 box I am running into difficulty with Registry Entries. What I need to do is add a HKLM entry as well as the registry entry for the program to show in the start menu. Here is the code i am using for both types of entry: <!-- Create the registry entries for the program --> <DirectoryRef Id="TARGETDIR"> <Component Id="RegistryEntriesInst" Guid="..."> <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)\$(var.ProductName)" Action="createAndRemoveOnUninstall"> <RegistryValue Type="string" Name="installed" Value="true" KeyPath="yes"/> </RegistryKey> </Component> <Component Id="RegistryEntriesVer" Guid="..."> <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)\$(var.ProductName)" Action="createAndRemoveOnUninstall"> <RegistryValue Type="string" Name="version" Value="$(var.ProductVersion)" KeyPath="yes"/> </RegistryKey> </Component> </DirectoryRef> <!-- To add shortcuts to the start menu to run and uninstall the program--> <DirectoryRef Id="ApplicationProgramsFolder"> <Component Id="ApplicationShortcut" Guid="..."> <Shortcut Id="ApplicationStartMenuShortcut" Name="$(var.ProductName)" Description="..." Target="[SERVERLOCATION]$(var.Project.TargetFileName)" WorkingDirectory="SERVERLOCATION"/> <Shortcut Id="UninstallProduct" Name="Uninstall $(var.ProductName)" Description="..." Target="[System64Folder]msiexec.exe" Arguments="/x [ProductCode]"/> <RemoveFolder Id="SERVERLOCATION" On="uninstall"/> <RegistryValue Root="HKCU" Key="Software\$(var.Manufacturer)\$(var.ProductName)" Name="installed" Type="integer" Value="1" KeyPath="yes"/> </Component> </DirectoryRef> Any help/suggestions that can be given will be appreciated. On a side note the registry permissions are the same on the XP and 7 computers. Thanks

    Read the article

  • C# timer won't tick

    - by Andrej
    hi, i have a strange problem... I've been going out of my mind for the past couple of hours... the timer i put in my winform code (from the toolbar) won't tick... I have timers on a couple of forms in my program, they all work fine... I try to do exactly the same it this it won't tick... I select it, drag it on to a form, enable it, set interval and handle the tick event... and nothing happens... i even tried putting random code like messagebox.show in the tick event just to see if anything happens, and nothing!!! as I said, a have a couple of more timer in my program (on other forms, not in the one i'm trying to put this timer) and they all work fine... any suggestions? thanks in advance!

    Read the article

  • MIPS assembly: how to declare integer values in the .data section?

    - by Barney
    I'm trying to get my feet wet with MIPS assembly language using the MARS simulator. My main problem now is how do I initialize a set of memory locations so that I can access them later via assembly language instructions? For example, I want to initialize addresses 0x1001000 - 0x10001003 with the values 0x99, 0x87, 0x23, 0x45. I think this can be done in the data declaration (.data) section of my assembly program but I'm not sure of the syntax. Is this possible? Alternatively, in the .data section, how do I specify storing the integer values in some memory location (I don't care where, but I just want to reference them somewhere). So I'm looking for the C equivalent of "int x = 20, y=30, z=90;" I know how to do that using MIPS instructions but is it possible to declare something like that in the .data section of a MIPS assembly program?

    Read the article

  • delete pointer to 2d array c ++

    - by user1848054
    i have this pointer to 2d array of Robot class Robot ***rob; and this is here the code for the constructor !! and the program works fine !!! but now i am trying to build a destructor to delete this pointer !! and it keeps on crashing the program !! my question is , how to delete this pointer to 2d array of robots ? RobotsWorld::RobotsWorld(int x , int y) { X=x;Y=y; // returns the limitation of the matrix rob = new Robot**[x]; for(int i = 0; i < x; i++) { rob[i] = new Robot*[y]; for(int j = 0; j < y; j++) { rob[i][j] = NULL; } } }

    Read the article

  • Thoughts on my new template language?

    - by Ralph
    Let's start with an example: using "html5" using "extratags" html { head { title "Ordering Notice" jsinclude "jquery.js" } body { h1 "Ordering Notice" p "Dear @name," p "Thanks for placing your order with @company. It's scheduled to ship on {@ship_date|dateformat}." p "Here are the items you've ordered:" table { tr { th "name" th "price" } for(@item in @item_list) { tr { td @item.name td @item.price } } } if(@ordered_warranty) p "Your warranty information will be included in the packaging." p(class="footer") { "Sincerely," br @company } } } The "using" keyword indicates which tags to use. "html5" might include all the html5 standard tags, but your tags names wouldn't have to be based on their HTML counter-parts at all if you didn't want to. The "extratags" library for example might add an extra tag, called "jsinclude" which gets replaced with something like <script type="text/javascript" src="@content"></script> Tags can be optionally be followed by an opening brace. They will automatically be closed as the closing brace. If no brace is used, they will be closed after taking on element. Variables are prefixed with the @ symbol. They may be used inside double-quoted strings. I think I'll use single-quotes to indicate "no variable substitution" like PHP does. Filter functions can be applied to variables like @variable|filter. Arguments can be passed to the filter @variable|filter:@arg1,arg2="y" Attributes can be passed to tags by including them in (), like p(class="classname"). Some questions: Which symbol should I use to prefix variables? @ (like Razor), $ (like PHP), or something else? Should the @ symbol be necessary in "for" and "if" statements? It's kind of implied that those are variables. Tags and controls (like if,for) presently have the exact same syntax. Should I do something to differentiate the two? If so, what? Do you like the attribute syntax? (round brackets) I'll add more questions in a few minutes, once I get some feedback.

    Read the article

  • PHP Aspect Oriented Design

    - by Devin Dixon
    This is a continuation of this Code Review question. What was taken away from that post, and other aspect oriented design is it is hard to debug. To counter that, I implemented the ability to turn tracing of the design patterns on. Turning trace on works like: //This can be added anywhere in the code Run::setAdapterTrace(true); Run::setFilterTrace(true); Run::setObserverTrace(true); //Execute the functon echo Run::goForARun(8); In the actual log with the trace turned on, it outputs like so: adapter 2012-02-12 21:46:19 {"type":"closure","object":"static","call_class":"\/public_html\/examples\/design\/ClosureDesigns.php","class":"Run","method":"goForARun","call_method":"goForARun","trace":"Run::goForARun","start_line":68,"end_line":70} filter 2012-02-12 22:05:15 {"type":"closure","event":"return","object":"static","class":"run_filter","method":"\/home\/prodigyview\/public_html\/examples\/design\/ClosureDesigns.php","trace":"Run::goForARun","start_line":51,"end_line":58} observer 2012-02-12 22:05:15 {"type":"closure","object":"static","class":"run_observer","method":"\/home\/prodigyview\/public_html\/public\/examples\/design\/ClosureDesigns.php","trace":"Run::goForARun","start_line":61,"end_line":63} When the information is broken down, the data translates to: Called by an adapter or filter or observer The function called was a closure The location of the closure Class:method the adapter was implemented on The Trace of where the method was called from Start Line and End Line The code has been proven to work in production environments and features various examples of to implement, so the proof of concept is there. It is not DI and accomplishes things that DI cannot. I wouldn't call the code boilerplate but I would call it bloated. In summary, the weaknesses are bloated code and a learning curve in exchange for aspect oriented functionality. Beyond the normal fear of something new and different, what are other weakness in this implementation of aspect oriented design, if any? PS: More examples of AOP here: https://github.com/ProdigyView/ProdigyView/tree/master/examples/design

    Read the article

< Previous Page | 262 263 264 265 266 267 268 269 270 271 272 273  | Next Page >