Search Results

Search found 19690 results on 788 pages for 'result partitioning'.

Page 266/788 | < Previous Page | 262 263 264 265 266 267 268 269 270 271 272 273  | Next Page >

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • creating QT gui using a thread in c++?

    - by rashid
    I am trying to create this QT gui using a thread but no luck. Below is my code. Problem is gui never shows up. /*INCLUDES HERE... .... */ using namespace std; struct mainStruct { int s_argc;<br> char ** s_argv; }; typedef struct mainStruct mas; void *guifunc(void * arg); int main(int argc, char * argv[]) { mas m;<br> m.s_argc = argc;<br> m.s_argv = argv;<br> pthread_t threadGUI; //start a new thread for gui int result = pthread_create(&threadGUI, NULL, guifunc, (void *) &m); if (result) {<br> printf("Error creating gui thread"); exit(0); } return 0; } void *guifunc(void * arg) { mas m = *(mas *)arg; QApplication app(m.s_argc,m.s_argv); //object instantiation<br> guiClass *gui = new guiClass(); //show gui<br> gui->show(); app.exec(); <br> }

    Read the article

  • Using external SOAP service in Workflow service

    - by whirlwin
    I am using the .NET 4 framework and have made a WCF Workflow Service Application. I want to use a SOAP web service (.NET 3.5) I have running in another instance of VS. The only method that is exposed is the following: [WebMethod] public string Reverse(string input) { char[] chars = input.ToCharArray(); Array.Reverse(chars); return new string(chars); } I have used the following steps to add the service in my Workflow: Add Service Reference Provided the WSDL (the operation shows in the Operations box as expected) Clicked OK Build the solution to ensure that the service shows in my toolbox Drag the service from the toolbox into the workflow However, when I look at the properties of the service in the workflow, there is no way to specify the input argument or where to store the result of the invocation of the service. I only have the option of specifying some obscure parameters such as Body:InArgument<ReverseRequestBody and outBody:OutArgument<ReverseResponseBody (none of which are strings). Here is a screenshot depicting the properties of the service in the workflow: My question is therefore: Is it possible at all to use the SOAP service by specifying a string as the input argument (like it is meant to be used), and also assign the result to a workflow variable?

    Read the article

  • Scalability 101: How can I design a scalable web application using PHP?

    - by Legend
    I am building a web-application and have a couple of quick questions. From what I learnt, one should not worry about scalability when initially building the app and should only start worrying when the traffic increases. However, this being my first web-application, I am not quite sure if I should take an approach where I design things in an ad-hoc manner and later "fix" them. I have been reading stories about how people start off with an app that gets millions of users in a week or two. Not that I will face the same situation but I can't help but wonder, how do these people do it? Currently, I bought a shared hosting account on Lunarpages and that got me started in building and testing the application. However, I am interested in learning how to build the same application in a scalable-manner using the cloud, for instance, Amazon's EC2. From my understanding, I can see a couple of components: There is a load balancer that first receives requests and then decides where to route each request This request is then handled by a server replica that then processes the request and updates (if required) the database and sends back the response to the client If a similar request comes in, then a caching mechanism like memcached kicks into picture and returns objects from the cache A blackbox that handles database replication Specifically, I am trying to do the following: Setting up a load balancer (my homework revealed that HAProxy is one such load balancer) Setting up replication so that databases can be synchronized Using memcached Configuring Apache to work with multiple web servers Partitioning application to use Amazon EC2 and Amazon S3 (my application is something that will need great deal of storage) Finally, how can I avoid burning myself when using Amazon services? Because this is just a learning phase, I can probably do with 2-3 servers with a simple load balancer and replication but until I want to avoid paying loads of money accidentally. I am able to find resources on individual topics but am unable to find something that starts off from the big picture. Can someone please help me get started?

    Read the article

  • How to rewrite data-driven test suites of JUnit 3 in Junit 4?

    - by rics
    I am using data-driven test suites running JUnit 3 based on Rainsberger's JUnit Recipes. The purpose of these tests is to check whether a certain function is properly implemented related to a set of input-output pairs. Here is the definition of the test suite: public static Test suite() throws Exception { TestSuite suite = new TestSuite(); Calendar calendar = GregorianCalendar.getInstance(); calendar.set(2009, 8, 05, 13, 23); // 2009. 09. 05. 13:23 java.sql.Date date = new java.sql.Date(calendar.getTime().getTime()); suite.addTest(new DateFormatTestToString(date, JtDateFormat.FormatType.YYYY_MON_DD, "2009-SEP-05")); suite.addTest(new DateFormatTestToString(date, JtDateFormat.FormatType.DD_MON_YYYY, "05/SEP/2009")); return suite; } and the definition of the testing class: public class DateFormatTestToString extends TestCase { private java.sql.Date date; private JtDateFormat.FormatType dateFormat; private String expectedStringFormat; public DateFormatTestToString(java.sql.Date date, JtDateFormat.FormatType dateFormat, String expectedStringFormat) { super("testGetString"); this.date = date; this.dateFormat = dateFormat; this.expectedStringFormat = expectedStringFormat; } public void testGetString() { String result = JtDateFormat.getString(date, dateFormat); assertTrue( expectedStringFormat.equalsIgnoreCase(result)); } } How is it possible to test several input-output parameters of a method using JUnit 4? This question and the answers explained to me the distinction between JUnit 3 and 4 in this regard. This question and the answers describe the way to create test suite for a set of class but not for a method with a set of different parameters.

    Read the article

  • Problem prompting user for extended permissions using showPermissionDialog in FB page tab

    - by snipe
    I have an FBML app that will use the tab as a promo tab before the full app goes live. The purpose of the promo tab is to allow users to opt in to email notifications (using the FB API sendNotifications call), so I need to prompt them to allow the app and grant extended permissions on that promo tab. The tab code is: <?php require_once 'config.php'; ?> <form id="form1"> <h1> <a href="#" clickrewriteform="form1" clickrewriteurl="http://www.mydomain.com/fanpageajax/result.php" clickrewriteid="allowapp">Step 1. Allow the Application</a> </h1> <div id="allowapp"></div> </form> <h1><a onclick="Facebook.showPermissionDialog('email');return false;"> Step 2. Grant extended permissions (intab)</a></h1> The result.php page just tags the API to ensure the allow prompt will show up. The problem is with the Step 2. Once the user has allowed the app, and they click on the Step 2, nothing happens. If they click on it twice, THEN the extended permissions dialog box popups up, but it asks them to grant extended permissions TWICE. OR.... If the user clicks on Step 1, and allows the app, and then reloads the fan page tab, they only have to click on the Step 2 link once, and the permissions show up. Anyone have any ideas? I have been beating myself in the head over this for hours.

    Read the article

  • can this problem be solved with a single SQL query?

    - by PierrOz
    I have the two following tables (with some sample datas) LOGS: ID | SETID | DATE ======================== 1 | 1 | 2010-02-25 2 | 2 | 2010-02-25 3 | 1 | 2010-02-26 4 | 2 | 2010-02-26 5 | 1 | 2010-02-27 6 | 2 | 2010-02-27 7 | 1 | 2010-02-28 8 | 2 | 2010-02-28 9 | 1 | 2010-03-01 STATS: ID | OBJECTID | FREQUENCY | STARTID | ENDID ============================================= 1 | 1 | 0.5 | 1 | 5 2 | 2 | 0.6 | 1 | 5 3 | 3 | 0.02 | 1 | 5 4 | 4 | 0.6 | 2 | 6 5 | 5 | 0.6 | 2 | 6 6 | 6 | 0.4 | 2 | 6 7 | 1 | 0.35 | 3 | 7 8 | 2 | 0.6 | 3 | 7 9 | 3 | 0.03 | 3 | 7 10 | 4 | 0.6 | 4 | 8 11 | 5 | 0.6 | 4 | 8 7 | 1 | 0.45 | 5 | 9 8 | 2 | 0.6 | 5 | 9 9 | 3 | 0.02 | 5 | 9 Every day new logs are analyzed on different sets of objects and stored in table LOGS. Among other processes, some statistics are computed on the objects contained into these sets and the result are stored in table STATS. These statistic are computed through several logs (identified by the STARTID and ENDID columns). So, what could be the SQL query that would give me the latest computed stats for all the objects with the corresponding log dates. In the given example, the result rows would be: OBJECTID | SETID | FREQUENCY | STARTDATE | ENDDATE ====================================================== 1 | 1 | 0.45 | 2010-02-27 | 2010-03-01 2 | 1 | 0.6 | 2010-02-27 | 2010-03-01 3 | 1 | 0.02 | 2010-02-27 | 2010-03-01 4 | 2 | 0.6 | 2010-02-26 | 2010-02-28 5 | 2 | 0.6 | 2010-02-26 | 2010-02-28 So, the most recent stats for set 1 are computed with logs from feb 27 to march 1 whereas stats for set 2 are computed from feb 26 to feb 28. object 6 is not in the results rows as there is no stat on it within the last period of time. Last thing, I use MySQL. Any Idea ?

    Read the article

  • LINQ-to-SQL - Join, Count

    - by ile
    I have following query: var result = ( from role in db.Roles join user in db.Users on role.RoleID equals user.RoleID where user.CreatedByUserID == userID orderby user.FirstName ascending select new UserViewModel { UserID = user.UserID, PhotoID = user.PhotoID.ToString(), FirstName = user.FirstName, LastName = user.LastName, FullName = user.FirstName + " " + user.LastName, Email = user.Email, PhoneNumber = user.Phone, AccessLevel = role.Name }); Now, I need to modify this query... Other table I have is table Deals. I would like to count how many deals user created last month and last year. I tried something like this: var result = ( from role in db.Roles join user in db.Users on role.RoleID equals user.RoleID //join dealsYear in db.Deals on date.Year equals dealsYear.DateCreated.Year join dealsYear in ( from deal in db.Deals group deal by deal.DateCreated into d select new { DateCreated = d.Key, dealsCount = d.Count() } ) on date.Year equals dealsYear.DateCreated.Year into dYear join dealsMonth in ( from deal in db.Deals group deal by deal.DateCreated into d select new { DateCreated = d.Key, dealsCount = d.Count() } ) on date.Month equals dealsMonth.DateCreated.Month into dMonth where user.CreatedByUserID == userID orderby user.FirstName ascending select new UserViewModel { UserID = user.UserID, PhotoID = user.PhotoID.ToString(), FirstName = user.FirstName, LastName = user.LastName, FullName = user.FirstName + " " + user.LastName, Email = user.Email, PhoneNumber = user.Phone, AccessLevel = role.Name, DealsThisYear = dYear, DealsThisMonth = dMonth }); but here is even syntax not correct. Any idea? Btw, is there any good book of LINQ to SQL with examples?

    Read the article

  • lapply slower than for-loop when used for a BiomaRt query. Is that expected?

    - by ptocquin
    I would like to query a database using BiomaRt package. I have loci and want to retrieve some related information, let say description. I first try to use lapply but was surprise by the time needed for the task to be performed. I thus tried a more basic for-loop and get a faster result. Is that expected or is something wrong with my code or with my understanding of apply ? I read other posts dealing with *apply vs for-loop performance (Here, for example) and I was aware that improved performance should not be expected but I don't understand why performance here is actually lower. Here is a reproducible example. 1) Loading the library and selecting the database : library("biomaRt") athaliana <- useMart("plants_mart_14") athaliana <- useDataset("athaliana_eg_gene",mart=athaliana) 2) Querying the database : loci <- c("at1g01300", "at1g01800", "at1g01900", "at1g02335", "at1g02790", "at1g03220", "at1g03230", "at1g04040", "at1g04110", "at1g05240" ) I create a function for the use in lapply : foo <- function(loci) { getBM("description","tair_locus",loci,athaliana) } When I use this function on the first element : > system.time(foo(cwp_loci[1])) utilisateur système écoulé 0.020 0.004 1.599 When I use lapply to retrieve the data for all values : > system.time(lapply(loci, foo)) utilisateur système écoulé 0.220 0.000 16.376 I then created a new function, adding a for-loop : foo2 <- function(loci) { for (i in loci) { getBM("description","tair_locus",loci[i],athaliana) } } Here is the result : > system.time(foo2(loci)) utilisateur système écoulé 0.204 0.004 10.919 Of course, this will be applied to a big list of loci, so the best performing option is needed. I thank you for assistance. EDIT Following recommendation of @MartinMorgan Simply passing the vector loci to getBM greatly improves the query efficiency. Simpler is better. > system.time(lapply(loci, foo)) utilisateur système écoulé 0.236 0.024 110.512 > system.time(foo2(loci)) utilisateur système écoulé 0.208 0.040 116.099 > system.time(foo(loci)) utilisateur système écoulé 0.028 0.000 6.193

    Read the article

  • "|" pipe operator not working in command line in C++

    - by user332024
    I am having a windows application interacting with DB2 database. In my application i have code to execute some DB2 commands through command line interface. I have used windowsAPI "ShellExecuteEx()" to execute those DB2 commands through command line. Following is the code written to execute DB2 command through command line. string command = "/c /w /i DB2 UNCATALOG NODE DB_DATABASE "" test.log | echo %date% %time% test.log SHELLEXECUTEINFO shellInfo; ZeroMemory(&shellInfo, sizeof(shellInfo)); shellInfo.cbSize = sizeof(shellInfo); shellInfo.fMask = SEE_MASK_FLAG_NO_UI | SEE_MASK_NOCLOSEPROCESS; //shellInfo.lpFile = "db2cmd"; shellInfo.lpFile = "db2cmd"; shellInfo.lpParameters = command.c_str(); The code is executed successfully , however if test.log is observered i only get result of DB2 command and not date and time. If you see the above command there is "|" pipe operator and echo command to log date and time in test.log Please note that if I execute above DB2 command through separately command line i.e. not through code. I am able to view date and time log along with DB2 command result in test.log. Following is the full command which i executed through command line. DB2CMD /c /i /w DB2 UNCATALOG NODE DB_DATABASE "" test.log | echo %date% %time% test.log According to me since DB2 command is executed successfully through code, there is problem with only usage of "|" pipe operator or echo command.

    Read the article

  • c# warn if text box is empty or contains a non-whole number

    - by Jamaul Smith
    In my specific case, I need the value in propertyPriceTextBox to be numeric only, and a whole number. A value also has to be entered, and I can just Messagebox.Show() a warning and that's all I'd need to do. This is what I have so far. private void computeButton_Click(object sender, EventArgs e) { decimal propertyPrice; if ((decimal.TryParse(propertyPriceTextBox.Text, out propertyPrice))) decimal.Parse(propertyPriceTextBox.Text); { if (residentialRadioButton.Checked == true) commisionLabel.Text = (residentialCom * propertyPrice).ToString("c"); if (commercialRadioButton.Checked == true) commisionLabel.Text = (commercialCom * propertyPrice).ToString("c"); if (hillsRadioButton.Checked == true) countySalesTaxTextBox.Text = ( hilssTax * propertyPrice).ToString("c"); if (pascoRadioButton.Checked == true) countySalesTaxTextBox.Text = (pascoTax * propertyPrice).ToString("c"); if (polkRadioButton.Checked == true) countySalesTaxTextBox.Text = (polkTax * propertyPrice).ToString("c"); decimal result; result = (countySalesTaxTextBox.Text + stateSalesTaxTextBox.Text + propertyPriceTextBox.Text + comissionTextBox.Text).ToString("c"); } else (.) MessageBox.Show("Property Price must be a whole number."); }

    Read the article

  • Can FFT length affect filtering accuracy?

    - by Charles
    Hi, I am designing a fractional delay filter, and my lagrange coefficient of order 5 h(n) have 6 taps in time domain. I have tested to convolute the h(n) with x(n) which is 5000 sampled signal using matlab, and the result seems ok. When I tried to use FFT and IFFT method, the output is totally wrong. Actually my FFT is computed with 8192 data in frequency domain, which is the nearest power of 2 for 5000 signal sample. For the IFFT portion, I convert back the 8192 frequency domain data back to 5000 length data in time domain. So, the problem is, why this thing works in convolution, but not in FFT multiplication. Does converting my 6 taps h(n) to 8192 taps in frequency domain causes this problem? Actually I have tried using overlap-save method, which perform the FFT and multiplication with smaller chunks of x(n) and doing it 5 times separately. The result seems slight better than the previous, and at least I can see the waveform pattern, but still slightly distorted. So, any idea where goes wrong, and what is the solution. Thank you.

    Read the article

  • how to decrease queries in php/mysql array selection loop

    - by Mac Taylor
    hey guys i need to show stories details and tags' names in my php/mysql project . for every story row, there is a filed named : tags that save tags id as an array Table name: stories table filed : tags example of tags filed : 1 5 6 space between them and i have a tag table that looks like this Table name : bt_tags Table fileds : tid,tag now problem : when using while loop to fetch all fields in story table , the page uses 1 query to show every stories' detail but for showing tag's names , i should query another table to find names , we have ids stored in story table now i used for loop between while loop to show tag names but im sure there is a better way to decrease page queries $result = $db->sql_query("SELECT * FROM ".STORY_TABLE." "); while ($row = $db->sql_fetchrow($result)) { //fetching other $vars ---- $tags_id = explode(" ",$row['tags']); $c = count($tags_id); for($i=1;$i<$c-1;$i++){ list($tag_name,$slug) = $db->sql_fetchrow($db->sql_query( 'SELECT `tag`,`slug` FROM `bt_tags` WHERE `tid` = "'.tags_id[$i].'" LIMIT 1' )); $sow_tags = '$tag_name,'; } im not allowed to change anything in database table how can i improve this script and show tag's names without using *for loop ?*

    Read the article

  • Cant fetch production db results using Google app engine remote_api

    - by Alon
    Hey, im trying to work out with /remote_api with a django-patch app engine app i got running. i want to select a few rows from my online production app locally. i cant seem to manage todo so, everything authenticates fine, it doesnt breaks on imports, but when i try to fetch something it just doesnt print anything. Placed the test python inside my local app dir. #!/usr/bin/env python # import os import sys # Hardwire in appengine modules to PYTHONPATH # or use wrapper to do it more elegantly appengine_dirs = ['myworkingpath'] sys.path.extend(appengine_dirs) # Add your models to path my_root_dir = os.path.abspath(os.path.dirname(__file__)) sys.path.insert(0, my_root_dir) from google.appengine.ext import db from google.appengine.ext.remote_api import remote_api_stub import getpass APP_NAME = 'Myappname' os.environ['AUTH_DOMAIN'] = 'gmail.com' os.environ['USER_EMAIL'] = '[email protected]' def auth_func(): return (raw_input('Username:'), getpass.getpass('Password:')) # Use local dev server by passing in as parameter: # servername='localhost:8080' # Otherwise, remote_api assumes you are targeting APP_NAME.appspot.com remote_api_stub.ConfigureRemoteDatastore(APP_NAME, '/remote_api', auth_func) # Do stuff like your code was running on App Engine from channel.models import Channel, Channel2Operator myresults = mymodel.all().fetch(10) for result in myresults: print result.key() it doesnt give any error or print anything. so does the remote_api console example google got. when i print the myresults i get [].

    Read the article

  • why does my <br> not work ?

    - by Vince
    I am returning a PHP array back to a JQuery call for appending into a div called "name-data". I want my array to be listed vertically, so I concatenate a br tag in the PHP however, when it gets to the HTML page the br is not being rendered, it just comes out as text. I have tried the various forms of br all without luck. I am new to JQuery - What am I doing wrong ? Many Thanks ! PHP: $result = mysqli_query($con,"SELECT FirstName FROM customer limit 5"); while($row = mysqli_fetch_array($result)) { echo $row['FirstName']."<br />"; } JQuery: $('input#name-submit').on('click',function(){ var name = $('input#name').val(); if($.trim(name) !=''){ $.post('search.php',{name:name}, function(data){ $('div#name-data').text(data); }); } }); HTML Name:<input type="text" id="name"> <input type="submit" id="name-submit" value="grab"> <div id="name-data"> </div>

    Read the article

  • Wrong logic in If Statement?

    - by Charles
    $repeat_times = mysql_real_escape_string($repeat_times); $result = mysql_query("SELECT `code`,`datetime` FROM `fc` ORDER by datetime desc LIMIT 25") or die(mysql_error()); $output .=""; $seconds = time() - strtotime($fetch_array["datetime"]); if($seconds < 60) $interval = "$seconds seconds"; else if($seconds < 3600) $interval = floor($seconds / 60) . " minutes"; else if($seconds < 86400) $interval = floor($seconds / 3600) . " hours"; else $interval = floor($seconds / 86400) . " days"; while ($fetch_array = mysql_fetch_array($result)) { $fetch_array["code"] = htmlentities($fetch_array["code"]); $output .= "<li><a href=\"http://www.***.com/code=" . htmlspecialchars(urlencode($fetch_array["code"])) . "\" target=\"_blank\">" . htmlspecialchars($fetch_array["code"]) . "</a> (" . $interval . ") ago.</li>"; } $output .=""; return $output; Why is this returning janice (14461 days) instead of janice (15 minutes ago) The datetime function table has the DATETIME type in my table so it's returning a full string for the date.

    Read the article

  • Delphi: EInvalidOp in neural network class (TD-lambda)

    - by user89818
    I have the following draft for a neural network class. This neural network should learn with TD-lambda. It is started by calling the getRating() function. But unfortunately, there is an EInvalidOp (invalid floading point operation) error after about 1000 iterations in the following lines: neuronsHidden[j] := neuronsHidden[j]+neuronsInput[t][i]*weightsInput[i][j]; // input -> hidden weightsHidden[j][k] := weightsHidden[j][k]+LEARNING_RATE_HIDDEN*tdError[k]*eligibilityTraceOutput[j][k]; // adjust hidden->output weights according to TD-lambda Why is this error? I can't find the mistake in my code :( Can you help me? Thank you very much in advance! unit uNeuronalesNetz; interface uses Windows, Messages, SysUtils, Variants, Classes, Graphics, Controls, Forms, Dialogs, ExtCtrls, StdCtrls, Grids, Menus, Math; const NEURONS_INPUT = 43; // number of neurons in the input layer NEURONS_HIDDEN = 60; // number of neurons in the hidden layer NEURONS_OUTPUT = 1; // number of neurons in the output layer NEURONS_TOTAL = NEURONS_INPUT+NEURONS_HIDDEN+NEURONS_OUTPUT; // total number of neurons in the network MAX_TIMESTEPS = 42; // maximum number of timesteps possible (after 42 moves: board is full) LEARNING_RATE_INPUT = 0.25; // in ideal case: decrease gradually in course of training LEARNING_RATE_HIDDEN = 0.15; // in ideal case: decrease gradually in course of training GAMMA = 0.9; LAMBDA = 0.7; // decay parameter for eligibility traces type TFeatureVector = Array[1..43] of SmallInt; // definition of the array type TFeatureVector TArtificialNeuralNetwork = class // definition of the class TArtificialNeuralNetwork private // GENERAL SETTINGS START learningMode: Boolean; // does the network learn and change its weights? // GENERAL SETTINGS END // NETWORK CONFIGURATION START neuronsInput: Array[1..MAX_TIMESTEPS] of Array[1..NEURONS_INPUT] of Extended; // array of all input neurons (their values) for every timestep neuronsHidden: Array[1..NEURONS_HIDDEN] of Extended; // array of all hidden neurons (their values) neuronsOutput: Array[1..NEURONS_OUTPUT] of Extended; // array of output neurons (their values) weightsInput: Array[1..NEURONS_INPUT] of Array[1..NEURONS_HIDDEN] of Extended; // array of weights: input->hidden weightsHidden: Array[1..NEURONS_HIDDEN] of Array[1..NEURONS_OUTPUT] of Extended; // array of weights: hidden->output // NETWORK CONFIGURATION END // LEARNING SETTINGS START outputBefore: Array[1..NEURONS_OUTPUT] of Extended; // the network's output value in the last timestep (the one before) eligibilityTraceHidden: Array[1..NEURONS_INPUT] of Array[1..NEURONS_HIDDEN] of Array[1..NEURONS_OUTPUT] of Extended; // array of eligibility traces: hidden layer eligibilityTraceOutput: Array[1..NEURONS_TOTAL] of Array[1..NEURONS_TOTAL] of Extended; // array of eligibility traces: output layer reward: Array[1..MAX_TIMESTEPS] of Array[1..NEURONS_OUTPUT] of Extended; // the reward value for all output neurons in every timestep tdError: Array[1..NEURONS_OUTPUT] of Extended; // the network's error value for every single output neuron t: Byte; // current timestep cyclesTrained: Integer; // number of cycles trained so far (learning rates could be decreased accordingly) last50errors: Array[1..50] of Extended; // LEARNING SETTINGS END public constructor Create; // create the network object and do the initialization procedure UpdateEligibilityTraces; // update the eligibility traces for the hidden and output layer procedure tdLearning; // learning algorithm: adjust the network's weights procedure ForwardPropagation; // propagate the input values through the network to the output layer function getRating(state: TFeatureVector; explorative: Boolean): Extended; // get the rating for a given state (feature vector) function HyperbolicTangent(x: Extended): Extended; // calculate the hyperbolic tangent [-1;1] procedure StartNewCycle; // start a new cycle with everything set to default except for the weights procedure setLearningMode(activated: Boolean=TRUE); // switch the learning mode on/off procedure setInputs(state: TFeatureVector); // transfer the given feature vector to the input layer (set input neurons' values) procedure setReward(currentReward: SmallInt); // set the reward for the current timestep (with learning then or without) procedure nextTimeStep; // increase timestep t function getCyclesTrained(): Integer; // get the number of cycles trained so far procedure Visualize(imgHidden: Pointer); // visualize the neural network's hidden layer end; implementation procedure TArtificialNeuralNetwork.UpdateEligibilityTraces; var i, j, k: Integer; begin // how worthy is a weight to be adjusted? for j := 1 to NEURONS_HIDDEN do begin for k := 1 to NEURONS_OUTPUT do begin eligibilityTraceOutput[j][k] := LAMBDA*eligibilityTraceOutput[j][k]+(neuronsOutput[k]*(1-neuronsOutput[k]))*neuronsHidden[j]; for i := 1 to NEURONS_INPUT do begin eligibilityTraceHidden[i][j][k] := LAMBDA*eligibilityTraceHidden[i][j][k]+(neuronsOutput[k]*(1-neuronsOutput[k]))*weightsHidden[j][k]*neuronsHidden[j]*(1-neuronsHidden[j])*neuronsInput[t][i]; end; end; end; end; procedure TArtificialNeuralNetwork.setReward; VAR i: Integer; begin for i := 1 to NEURONS_OUTPUT do begin // +1 = player A wins // 0 = draw // -1 = player B wins reward[t][i] := currentReward; end; end; procedure TArtificialNeuralNetwork.tdLearning; var i, j, k: Integer; begin if learningMode then begin for k := 1 to NEURONS_OUTPUT do begin if reward[t][k] = 0 then begin tdError[k] := GAMMA*neuronsOutput[k]-outputBefore[k]; // network's error value when reward is 0 end else begin tdError[k] := reward[t][k]-outputBefore[k]; // network's error value in the final state (reward received) end; for j := 1 to NEURONS_HIDDEN do begin weightsHidden[j][k] := weightsHidden[j][k]+LEARNING_RATE_HIDDEN*tdError[k]*eligibilityTraceOutput[j][k]; // adjust hidden->output weights according to TD-lambda for i := 1 to NEURONS_INPUT do begin weightsInput[i][j] := weightsInput[i][j]+LEARNING_RATE_INPUT*tdError[k]*eligibilityTraceHidden[i][j][k]; // adjust input->hidden weights according to TD-lambda end; end; end; end; end; procedure TArtificialNeuralNetwork.ForwardPropagation; var i, j, k: Integer; begin for j := 1 to NEURONS_HIDDEN do begin neuronsHidden[j] := 0; for i := 1 to NEURONS_INPUT do begin neuronsHidden[j] := neuronsHidden[j]+neuronsInput[t][i]*weightsInput[i][j]; // input -> hidden end; neuronsHidden[j] := HyperbolicTangent(neuronsHidden[j]); // activation of hidden neuron j end; for k := 1 to NEURONS_OUTPUT do begin neuronsOutput[k] := 0; for j := 1 to NEURONS_HIDDEN do begin neuronsOutput[k] := neuronsOutput[k]+neuronsHidden[j]*weightsHidden[j][k]; // hidden -> output end; neuronsOutput[k] := HyperbolicTangent(neuronsOutput[k]); // activation of output neuron k end; end; procedure TArtificialNeuralNetwork.setLearningMode; begin learningMode := activated; end; constructor TArtificialNeuralNetwork.Create; var i, j, k: Integer; begin inherited Create; Randomize; // initialize random numbers generator learningMode := TRUE; cyclesTrained := -2; // only set to -2 because it will be increased twice in the beginning StartNewCycle; for j := 1 to NEURONS_HIDDEN do begin for k := 1 to NEURONS_OUTPUT do begin weightsHidden[j][k] := abs(Random-0.5); // initialize weights: 0 <= random < 0.5 end; for i := 1 to NEURONS_INPUT do begin weightsInput[i][j] := abs(Random-0.5); // initialize weights: 0 <= random < 0.5 end; end; for i := 1 to 50 do begin last50errors[i] := 0; end; end; procedure TArtificialNeuralNetwork.nextTimeStep; begin t := t+1; end; procedure TArtificialNeuralNetwork.StartNewCycle; var i, j, k, m: Integer; begin t := 1; // start in timestep 1 cyclesTrained := cyclesTrained+1; // increase the number of cycles trained so far for j := 1 to NEURONS_HIDDEN do begin neuronsHidden[j] := 0; for k := 1 to NEURONS_OUTPUT do begin eligibilityTraceOutput[j][k] := 0; outputBefore[k] := 0; neuronsOutput[k] := 0; for m := 1 to MAX_TIMESTEPS do begin reward[m][k] := 0; end; end; for i := 1 to NEURONS_INPUT do begin for k := 1 to NEURONS_OUTPUT do begin eligibilityTraceHidden[i][j][k] := 0; end; end; end; end; function TArtificialNeuralNetwork.getCyclesTrained; begin result := cyclesTrained; end; procedure TArtificialNeuralNetwork.setInputs; var k: Integer; begin for k := 1 to NEURONS_INPUT do begin neuronsInput[t][k] := state[k]; end; end; function TArtificialNeuralNetwork.getRating; begin setInputs(state); ForwardPropagation; result := neuronsOutput[1]; if not explorative then begin tdLearning; // adjust the weights according to TD-lambda ForwardPropagation; // calculate the network's output again outputBefore[1] := neuronsOutput[1]; // set outputBefore which will then be used in the next timestep UpdateEligibilityTraces; // update the eligibility traces for the next timestep nextTimeStep; // go to the next timestep end; end; function TArtificialNeuralNetwork.HyperbolicTangent; begin if x > 5500 then // prevent overflow result := 1 else result := (Exp(2*x)-1)/(Exp(2*x)+1); end; end.

    Read the article

  • How do I make a function in SQL Server that accepts a column of data?

    - by brandon k
    I made the following function in SQL Server 2008 earlier this week that takes two parameters and uses them to select a column of "detail" records and returns them as a single varchar list of comma separated values. Now that I get to thinking about it, I would like to take this table and application-specific function and make it more generic. I am not well-versed in defining SQL functions, as this is my first. How can I change this function to accept a single "column" worth of data, so that I can use it in a more generic way? Instead of calling: SELECT ejc_concatFormDetails(formuid, categoryName) I would like to make it work like: SELECT concatColumnValues(SELECT someColumn FROM SomeTable) Here is my function definition: FUNCTION [DNet].[ejc_concatFormDetails](@formuid AS int, @category as VARCHAR(75)) RETURNS VARCHAR(1000) AS BEGIN DECLARE @returnData VARCHAR(1000) DECLARE @currentData VARCHAR(75) DECLARE dataCursor CURSOR FAST_FORWARD FOR SELECT data FROM DNet.ejc_FormDetails WHERE formuid = @formuid AND category = @category SET @returnData = '' OPEN dataCursor FETCH NEXT FROM dataCursor INTO @currentData WHILE (@@FETCH_STATUS = 0) BEGIN SET @returnData = @returnData + ', ' + @currentData FETCH NEXT FROM dataCursor INTO @currentData END CLOSE dataCursor DEALLOCATE dataCursor RETURN SUBSTRING(@returnData,3,1000) END As you can see, I am selecting the column data within my function and then looping over the results with a cursor to build my comma separated varchar. How can I alter this to accept a single parameter that is a result set and then access that result set with a cursor?

    Read the article

  • Adding extra data to a Variable

    - by DogPooOnYourShoe
    Right now, my code plucks out only one value using Mysql. So I thought I might aswell add each found result to a variable, however I dont know how to do this. This must be a very basic question, but I cant find a answer for it echo '<table border="1">'; echo "<tr><td><b>Surname</b></td><td><b>Title/Name</b></td><td><b>Numbers</b></td><td><b>Telephone</b></td><td><b>Edit</b></td><td><b>Del</b></td></tr>\n"; while ($row= mysql_fetch_array($result)) { $Surname = $row["Surname"]; $Title = $row["TitleName"]; $Email = $row["Email"]; $Telephone = $row["Telephone"]; $id = $row["id"]; $MooringNumbers = $row['Number']; $Assignedto['AssignedTo']; } $MooringQuery = "select * FROM mooring WHERE AssignedTo='$id'"; $MooringResult = mysql_query($MooringQuery) or die("Couldn't execute query"); while ($row1= mysql_fetch_array($MooringResult)) { $AssignedTo = $row1["AssignedTo"]; $MooringNumbers = $row1["Number"]; echo '<tr><td>' .$Surname.'</td><td>'.$Title.'</td><td>'.$MooringNumbers . '</td><td>'.$Telephone.'</td><td>' . '<a href="rlayCustomerUpdtForm.php?id='.$id.'">[EDIT]</a></td>'.'<td>'. '<a href="deleteCustomer.php?id='.$id.'">[x]</a></td>'. '</tr>'; }

    Read the article

  • byte + byte = int... why?

    - by Robert C. Cartaino
    Looking at this C# code... byte x = 1; byte y = 2; byte z = x + y; // ERROR: Cannot implicitly convert type 'int' to 'byte' The result of any math performed on byte (or short) types is implicitly cast back to an integer. The solution is to explicitly cast the result back to a byte, so... byte z = (byte)(x + y); // works What I am wondering is why? Is it architectural? Philosophical? We have: int + int = int long + long = long float + float = float double + double = double So why not: byte + byte = byte short + short = short ? A bit of background: I am performing a long list of calculations on "small numbers" (i.e. < 8) and storing the intermediate results in a large array. Using a byte array (instead of an int array) is faster (because of cache hits). But the extensive byte-casts spread through the code make it that much more unreadable.

    Read the article

  • GUnload is null or undefined using Directions Service

    - by user1677756
    I'm getting an error using Google Maps API V3 that I don't understand. My initial map displays just fine, but when I try to get directions, I get the following two errors: Error: The value of the property 'GUnload' is null or undefined, not a Function object Error: Unable to get value of the property 'setDirections': object is null or undefined I'm not using GUnload anywhere, so I don't understand why I'm getting that error. As far as the second error is concerned, it's as if something is wrong with the Directions service. Here is my code: var directionsDisplay; var directionsService = new google.maps.DirectionsService(); var map; function initialize(address) { directionsDisplay = new google.maps.DirectionsRenderer(); var geocoder = new google.maps.Geocoder(); var latlng = new google.maps.LatLng(42.733963, -84.565501); var mapOptions = { center: latlng, zoom: 15, mapTypeId: google.maps.MapTypeId.ROADMAP }; map = new google.maps.Map(document.getElementById("map_canvas"), mapOptions); geocoder.geocode({ 'address': address }, function (results, status) { if (status == google.maps.GeocoderStatus.OK) { map.setCenter(results[0].geometry.location); var marker = new google.maps.Marker({ map: map, position: results[0].geometry.location }); } else { alert("Geocode was not successful for the following reason: " + status); } }); directionsDisplay.setMap(map); } function getDirections(start, end) { var request = { origin:start, destination:end, travelMode: google.maps.TravelMode.DRIVING }; directionsService.route(request, function(result, status) { if (status == google.maps.DirectionsStatus.OK) { directionsDisplay.setDirections(result); } else { alert("Directions cannot be displayed for the following reason: " + status); } }); } I'm not very savvy with javascript, so I could have made some sort of error there. I appreciate any help I can get.

    Read the article

  • Improve a regex statement in order to be as efficient as it can be

    - by user551625
    I have a PHP program that, at some point, needs to analyze a big amount of HTML+javascript text to parse info. All I want to parse needs to be in two parts. Seperate all "HTML goups" to parse Parse each HTML group to get the needed information. In the 1st parse it needs to find: <div id="myHome" And start capturing after that tag. Then stop capturing before <span id="nReaders" And capture the number that comes after this tag and stop. In the 2nd parse use the capture nº 1 (0 has the whole thing and 2 has the number) from the parse made before and then find . I already have code to do that and it works. Is there a way to improve this, make it easier for the machine to parse? preg_match_all('%<div id="myHome"[^>]>(.*?)<span id="nReaders[^>]>([0-9]+)<"%msi', $data, $results, PREG_SET_ORDER); foreach($results AS $result){ preg_match_all('%<div class="myplacement".*?[.]php[?]((?:next|before))=([0-9]+).*?<tbody.*?<td[^>]>.*?[0-9]+"%msi', $result[1], $mydata, PREG_SET_ORDER); //takes care of the data and finish the program Note: I need this for a freeware program so it must be as general as possible and, if possible, not use php extensions ADD: I ommitted some parts here because I didn't expect for answers like those. There is also a need to parse text inside one of the tags that is in the document. It may be the 6th 7th or 8th tag but I know it is after a certain tag. The parser I've checked (thx profitphp) does work to find the script tag. What now? There are more than 1 tag with the same class. I want them all. But I want only with also one of a list of classes..... Where can I find instructions and demos and limitations of DOM parsers (like the one in http://simplehtmldom.sourceforge.net/)? I need something that will work on, at least, a big amount of free servers.

    Read the article

  • Appending a TR to Table Not Formatting Correctly

    - by TimNguyenBSM
    My PHP script is sending back an array: $currentStatus = ( isset( $status ) ) ? "1" : "0"; $html = "<tr><td>" . $email . "</td><td>" . ( ( $status->type == 0 ) ? "View Only" : ( ( $status->type == 1 ) ? "View & Mark" : "View, Mark & Edit" ) ) . "</td><td>Invited</td></tr>"; echo json_encode( array( $html, $currentStatus ) ); Then my jquery is appending this to the table: ... success: function( result ) { var resultArray = eval( result ); $( "#myTable tr:last").append( resultArray[0] ); ... } Problem is, when it prints, it prints the following extra marks: [email protected]<\/td> View Only<\/td> Invited<\/td><\/tr>","1"] If I only echo the HTML it appends to table just fine, but I cant do that because I need the $currentStatus back too to do something with it. Thanks!

    Read the article

  • Task Parallel Library exception handling

    - by user1680766
    When handling exceptions in TPL tasks I have come across two ways to handle exceptions. The first catches the exception within the task and returns it within the result like so: var task = Task<Exception>.Factory.StartNew( () => { try { // Do Something return null; } catch (System.Exception e) { return e; } }); task.ContinueWith( r => { if (r.Result != null) { // Handle Exception } }); The second is the one shown within the documentation and I guess the proper way to do things: var task = Task.Factory.StartNew( () => { // Do Something }); task.ContinueWith( r => { if (r.Exception != null) { // Handle Aggregate Exception r.Exception.Handle(y => true); } }); I am wondering if there is anything wrong with the first approach? I have received 'unhandled aggregate exception' exceptions every now and again using this technique and was wondering how this can happen?

    Read the article

  • forcing a download using PHP / jQuery

    - by Dirty-flow
    I know there are already many questions about forcing a download with PHP, but I can't find what I'm doing wrong and what should I do. I'm having an list with filenames, and I want to download one of them by clicking a button. My jQuery: $(".MappeDownload").on("click",function(e){ e.stopPropagation(); fileId=$(this).val() $.post("ajax/DownloadFile.php",{ id : fileId}) }) and on the server side I have a table with the file names and the file path. $sql = "SELECT vUploadPfad, vUploadOriginname FROM tabUpload WHERE zUploadId='$_POST[id]'"; $result = mysql_query($sql) or die(""); $file = mysql_fetch_array($result); $localfile = $file["vUploadPfad"]; $name=$file["vUploadOriginname"]; $fp = fopen($localfile, 'rb'); header("Cache-Control: "); header("Pragma: "); header("Content-Type: application/octet-stream"); header("Content-Length: " . filesize($localfile)); header("Content-Disposition: attachment; filename='".$name."';"); header("Content-Transfer-Encoding: binary\n"); fpassthru($fp); exit; The AJAX request is successful, I'm getting the right header(filesize, filename etc...) but the download are not starting.

    Read the article

< Previous Page | 262 263 264 265 266 267 268 269 270 271 272 273  | Next Page >