Search Results

Search found 19690 results on 788 pages for 'result partitioning'.

Page 267/788 | < Previous Page | 263 264 265 266 267 268 269 270 271 272 273 274  | Next Page >

  • Adding extra data to a Variable

    - by DogPooOnYourShoe
    Right now, my code plucks out only one value using Mysql. So I thought I might aswell add each found result to a variable, however I dont know how to do this. This must be a very basic question, but I cant find a answer for it echo '<table border="1">'; echo "<tr><td><b>Surname</b></td><td><b>Title/Name</b></td><td><b>Numbers</b></td><td><b>Telephone</b></td><td><b>Edit</b></td><td><b>Del</b></td></tr>\n"; while ($row= mysql_fetch_array($result)) { $Surname = $row["Surname"]; $Title = $row["TitleName"]; $Email = $row["Email"]; $Telephone = $row["Telephone"]; $id = $row["id"]; $MooringNumbers = $row['Number']; $Assignedto['AssignedTo']; } $MooringQuery = "select * FROM mooring WHERE AssignedTo='$id'"; $MooringResult = mysql_query($MooringQuery) or die("Couldn't execute query"); while ($row1= mysql_fetch_array($MooringResult)) { $AssignedTo = $row1["AssignedTo"]; $MooringNumbers = $row1["Number"]; echo '<tr><td>' .$Surname.'</td><td>'.$Title.'</td><td>'.$MooringNumbers . '</td><td>'.$Telephone.'</td><td>' . '<a href="rlayCustomerUpdtForm.php?id='.$id.'">[EDIT]</a></td>'.'<td>'. '<a href="deleteCustomer.php?id='.$id.'">[x]</a></td>'. '</tr>'; }

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Accessing and inheriting Windows Message for other Windows Message in Delphi

    - by HX_unbanned
    I am using WMSysCommand messages to modify Caption bar button ( Maximize / Minimize ) behaivor and recent update requiered to use WMNCHitTest, but I do not want to split these two related messages in multiplie procedures because of lengthy code. Can I access private declaration ( message ) from other message? And if I can - How to do it? procedure TForm1.WMNCHitTest(var Msg: TWMNCHitTest) ; begin SendMessage(Handle, HTCAPTION, WM_NCHitTest, 0); // or other wParam or lParam ???? end; procedure TForm1.WMSysCommand; begin if (Msg.CmdType = SC_MAXIMIZE or 61488) or (Msg.Result = htCaption or 2) then // if command is Maximize or reciever message of Caption Bar click begin if CheckWin32Version(6, 0) then Constraints.MaxHeight := 507 else Constraints.MaxHeight := 499; Constraints.MaxWidth := 0; end else if (Msg.CmdType = SC_MINIMIZE or 61472) or (Msg.Result = htCaption or 2) then // if command is Minimize begin if (EnsureRange(Width, 252, 510) >= (510 / 2)) then PreviewOpn.Caption := '<' else PreviewOpn.Caption := '>'; end; DefaultHandler(Msg); // reset Message handler to default ( Application ) end; Soo ... do I think correctly and sipmly do not know correct commands or I am thinking total bullsh*t? Regards. Thanks for any help...

    Read the article

  • Redirect in codeigniter after login

    - by edelweiss
    Trying to do a redirect after a successful login. The login info is sent using ajax to the controller. My controller code as below public function login_controller_function() { $this->load->model('login_model'); if ($this->input->is_ajax_request()) { $user_name=$this->input->post('username'); $user_password = $this->input->post('password'); $this->load->helper('url'); $result = $this->login_model->verify_user($user_name,$user_password); // echo 'user_logged_in'; if(strcmp($result,'user_logged_in')==0) { redirect('welcome'); } } } But it is not working at all. Anyone knows whats wrong? Hi my html as requested. i am using twitter bootstrap as well <li class="divider-vertical"></li> <li><a href="#" id="login_btn">Login</a></li> <li><a href="<?php echo base_url('register'); ?>">Register</a></li> for the buttons so when i click the login button, a modal window will appear and ask for login info. so when i click on the login button, my js code will send an ajax request my js code as below /*Attempt register user jquery ajax*/ $('#login').click(function(){ var user_name = $('#loginHere').find('#user_name').val(); var user_password = $('#loginHere').find('#login_pwd').val(); if(user_name==""||user_password=="") return; var login_data = { username:user_name, password:user_password}; $.ajax({ type: "POST", dataType: "json", async: false, url:"login_register/login_controller_function", data: login_data, success: function(data) { if(data.login) { alert(data.redirect); window.location.replace(data.redirect); } else if(!data.login) { alert('data login not true'); } }, error:function(data){ alert('ajax error'); } }); }); });

    Read the article

  • Facebook connect with iPhone not working?

    - by Atulkumar V. Jain
    Hi Everybody, I am trying to use Facebook connect in my application, but its not working as I desire. When I am trying to use the API Key and the API SecretKey of my application which I have registered with the facebook its not working. I have downloaded the code for the facebook. In the SessionViewController.m file when I pass my key values its not working. What I am trying to achieve is, when the app launches the first page is the Facebook Login Page. The user enters his username and password and then the next view should display. But nothing is happening, even the label doesn't display the username. Heres the code which I am using - (void)request:(FBRequest*)request didLoad:(id)result { NSArray* users = result; NSDictionary* user = [users objectAtIndex:0]; NSString* name = [user objectForKey:@"name"]; _label.text = [NSString stringWithFormat:@"Logged in as %@",name]; NSLog(@"Username is :- %@",name); FrontController *main = [[FrontController alloc] init]; [self.view addSubview:main.view]; [main release]; } I am not able to figure out what is wrong with this code. When I try with some other key values such as the key for connect application its working fine. Can anyone help me with this... Thanx in advance...

    Read the article

  • Assigning Object to View, big MySQL resultset.

    - by A Finn
    Hello (Sorry for my bad English) Is it bad practice to assign object to view and call its methods in there? I use smarty as my template engine. In my controller I could do like this 1# $this->view->assign("name", $this->model->getName); and in my view <p>{$name}</p> OR 2# $this->view->assign("Object", $this->model); and in my view <p>{$Report->getName()}</p> Well my biggest problem is that I have to handle a big amount of data coming out from the MySQL and I thought that if I would made a method that would print out the data while looping mysql_fetch_row. Well at least I know that using html-tags in the model is a bad thing to do. So I would assign the object to the view to get the result to the right position on the page.. Reading a mysql-result to an array first may cause memory problems am I right? So what is the solution doing things MVC style.. And yes Im using a framework of my own.

    Read the article

  • Task Parallel Library exception handling

    - by user1680766
    When handling exceptions in TPL tasks I have come across two ways to handle exceptions. The first catches the exception within the task and returns it within the result like so: var task = Task<Exception>.Factory.StartNew( () => { try { // Do Something return null; } catch (System.Exception e) { return e; } }); task.ContinueWith( r => { if (r.Result != null) { // Handle Exception } }); The second is the one shown within the documentation and I guess the proper way to do things: var task = Task.Factory.StartNew( () => { // Do Something }); task.ContinueWith( r => { if (r.Exception != null) { // Handle Aggregate Exception r.Exception.Handle(y => true); } }); I am wondering if there is anything wrong with the first approach? I have received 'unhandled aggregate exception' exceptions every now and again using this technique and was wondering how this can happen?

    Read the article

  • Generate unique ID from multiple values with fault tolerance

    - by ojreadmore
    Given some values, I'd like to make a (pretty darn) unique result. $unique1 = generate(array('ab034', '981kja7261', '381jkfa0', 'vzcvqdx2993883i3ifja8', '0plnmjfys')); //now $unique1 == "sqef3452y"; I also need something that's pretty close to return the same result. In this case, 20% of the values is missing. $unique2 = generate(array('ab034', '981kja7261', '381jkfa0', 'vzcvqdx2993883i3ifja8')); //also $unique2 == "sqef3452y"; I'm not sure where to begin with such an algorithm but I have some assumptions. I assume that the more values given, the more accurate the resulting ID – in other words, using 20 values is better than 5. I also assume that a confidence factor can be calculated and adjusted. What would be nice to have is a weight factor where one can say 'value 1 is more important than value 3'. This would require a multidimensional array for input instead of one dimension. I just mashed on the keyboard for these values, but in practice they may be short or long alpha numeric values.

    Read the article

  • Wrong logic in If Statement?

    - by Charles
    $repeat_times = mysql_real_escape_string($repeat_times); $result = mysql_query("SELECT `code`,`datetime` FROM `fc` ORDER by datetime desc LIMIT 25") or die(mysql_error()); $output .=""; $seconds = time() - strtotime($fetch_array["datetime"]); if($seconds < 60) $interval = "$seconds seconds"; else if($seconds < 3600) $interval = floor($seconds / 60) . " minutes"; else if($seconds < 86400) $interval = floor($seconds / 3600) . " hours"; else $interval = floor($seconds / 86400) . " days"; while ($fetch_array = mysql_fetch_array($result)) { $fetch_array["code"] = htmlentities($fetch_array["code"]); $output .= "<li><a href=\"http://www.***.com/code=" . htmlspecialchars(urlencode($fetch_array["code"])) . "\" target=\"_blank\">" . htmlspecialchars($fetch_array["code"]) . "</a> (" . $interval . ") ago.</li>"; } $output .=""; return $output; Why is this returning janice (14461 days) instead of janice (15 minutes ago) The datetime function table has the DATETIME type in my table so it's returning a full string for the date.

    Read the article

  • Why should I abstract my data layer?

    - by Gazillion
    OOP principles were difficult for me to grasp because for some reason I could never apply them to web development. As I developed more and more projects I started understanding how some parts of my code could use certain design patterns to make them easier to read, reuse, and maintain so I started to use it more and more. The one thing I still can't quite comprehend is why I should abstract my data layer. Basically if I need to print a list of items stored in my DB to the browser I do something along the lines of: $sql = 'SELECT * FROM table WHERE type = "type1"';' $result = mysql_query($sql); while($row = mysql_fetch_assoc($result)) { echo '<li>'.$row['name'].'</li>'; } I'm reading all these How-Tos or articles preaching about the greatness of PDO but I don't understand why. I don't seem to be saving any LoCs and I don't see how it would be more reusable because all the functions that I call above just seem to be encapsulated in a class but do the exact same thing. The only advantage I'm seeing to PDO are prepared statements. I'm not saying data abstraction is a bad thing, I'm asking these questions because I'm trying to design my current classes correctly and they need to connect to a DB so I figured I'd do this the right way. Maybe I'm just reading bad articles on the subject :) I would really appreciate any advice, links, or concrete real-life examples on the subject!

    Read the article

  • How do I make a function in SQL Server that accepts a column of data?

    - by brandon k
    I made the following function in SQL Server 2008 earlier this week that takes two parameters and uses them to select a column of "detail" records and returns them as a single varchar list of comma separated values. Now that I get to thinking about it, I would like to take this table and application-specific function and make it more generic. I am not well-versed in defining SQL functions, as this is my first. How can I change this function to accept a single "column" worth of data, so that I can use it in a more generic way? Instead of calling: SELECT ejc_concatFormDetails(formuid, categoryName) I would like to make it work like: SELECT concatColumnValues(SELECT someColumn FROM SomeTable) Here is my function definition: FUNCTION [DNet].[ejc_concatFormDetails](@formuid AS int, @category as VARCHAR(75)) RETURNS VARCHAR(1000) AS BEGIN DECLARE @returnData VARCHAR(1000) DECLARE @currentData VARCHAR(75) DECLARE dataCursor CURSOR FAST_FORWARD FOR SELECT data FROM DNet.ejc_FormDetails WHERE formuid = @formuid AND category = @category SET @returnData = '' OPEN dataCursor FETCH NEXT FROM dataCursor INTO @currentData WHILE (@@FETCH_STATUS = 0) BEGIN SET @returnData = @returnData + ', ' + @currentData FETCH NEXT FROM dataCursor INTO @currentData END CLOSE dataCursor DEALLOCATE dataCursor RETURN SUBSTRING(@returnData,3,1000) END As you can see, I am selecting the column data within my function and then looping over the results with a cursor to build my comma separated varchar. How can I alter this to accept a single parameter that is a result set and then access that result set with a cursor?

    Read the article

  • Why can't we just use a hash of passphrase as the encryption key (and IV) with symmetric encryption algorithms?

    - by TX_
    Inspired by my previous question, now I have a very interesting idea: Do you really ever need to use Rfc2898DeriveBytes or similar classes to "securely derive" the encryption key and initialization vector from the passphrase string, or will just a simple hash of that string work equally well as a key/IV, when encrypting the data with symmetric algorithm (e.g. AES, DES, etc.)? I see tons of AES encryption code snippets, where Rfc2898DeriveBytes class is used to derive the encryption key and initialization vector (IV) from the password string. It is assumed that one should use a random salt and a shitload of iterations to derive secure enough key/IV for the encryption. While deriving bytes from password string using this method is quite useful in some scenarios, I think that's not applicable when encrypting data with symmetric algorithms! Here is why: using salt makes sense when there is a possibility to build precalculated rainbow tables, and when attacker gets his hands on hash he looks up the original password as a result. But... with symmetric data encryption, I think this is not required, as the hash of password string, or the encryption key, is never stored anywhere. So, if we just get the SHA1 hash of password, and use it as the encryption key/IV, isn't that going to be equally secure? What is the purpose of using Rfc2898DeriveBytes class to generate key/IV from password string (which is a very very performance-intensive operation), when we could just use a SHA1 (or any other) hash of that password? Hash would result in random bit distribution in a key (as opposed to using string bytes directly). And attacker would have to brute-force the whole range of key (e.g. if key length is 256bit he would have to try 2^256 combinations) anyway. So either I'm wrong in a dangerous way, or all those samples of AES encryption (including many upvoted answers here at SO), etc. that use Rfc2898DeriveBytes method to generate encryption key and IV are just wrong.

    Read the article

  • Can FFT length affect filtering accuracy?

    - by Charles
    Hi, I am designing a fractional delay filter, and my lagrange coefficient of order 5 h(n) have 6 taps in time domain. I have tested to convolute the h(n) with x(n) which is 5000 sampled signal using matlab, and the result seems ok. When I tried to use FFT and IFFT method, the output is totally wrong. Actually my FFT is computed with 8192 data in frequency domain, which is the nearest power of 2 for 5000 signal sample. For the IFFT portion, I convert back the 8192 frequency domain data back to 5000 length data in time domain. So, the problem is, why this thing works in convolution, but not in FFT multiplication. Does converting my 6 taps h(n) to 8192 taps in frequency domain causes this problem? Actually I have tried using overlap-save method, which perform the FFT and multiplication with smaller chunks of x(n) and doing it 5 times separately. The result seems slight better than the previous, and at least I can see the waveform pattern, but still slightly distorted. So, any idea where goes wrong, and what is the solution. Thank you.

    Read the article

  • Problems with starting an activity in onStart

    - by Fizz
    Hello everyone. I'm trying to start a floating activity from onStart to retrieve some info from the user right when the initial activity begins. I have the following: @Override public void onStart(){ super.onStart(); callProfileDialog(); } And callProfileDialog() is just: private void callProfileDialog(){ Intent i = new Intent(this, com.utility.ProfileDialog.class); startActivityForResult(i, PROFDIALOG); } ProfileDialog.class returns a String from an input box. If the result returned is RESULT_CANCELED then I restart the activity. The problem I'm having is that when the program starts, the screen is just black. If I hit the Back button a RESULT_CANCELED is returned then the initial activity shows as well as the floating activity (since it recalled itself when it got a RESULT_CANCELED). Why can't I get the activities show by calling ProfileDialog.class from onStart()? I got the same result when I called it at the end of onCreate() which is way I switch over to use onStart(). Thanks for the help.

    Read the article

  • LINQ to XML: suppressing redundant namespace attribute in child nodes

    - by GSerg
    If a node belongs to a namespace, it's children by default belong to the same namespace. So there's no need to provide an xmlns attribute on each child, which is good. However. If I create two nodes like this: Dim parent = <parent xmlns="http://my.namespace.org"/> Dim child = <child xmlns="http://my.namespace.org">value</child> parent.Add(child) Console.WriteLine(parent.ToString) The result is this: <parent xmlns="http://my.namespace.org"> <child xmlns="http://my.namespace.org">value</child> </parent> But, if create them in a less convenient way: Dim parent = <parent xmlns="http://my.namespace.org"/> Dim child As New XElement(XName.Get("child", "http://my.namespace.org")) With {.Value = "value"} parent.Add(child) Console.WriteLine(parent.ToString) The result is more desirable: <parent xmlns="http://my.namespace.org"> <child>value</child> </parent> Obviously, I'd prefer to use the first way because it is so much more intuitive and easy to code. There's also another reason to not use method 2 -- sometimes I need to create nodes with XElement.Parse, parsing a string that contains an xmlns attribute, which produces exactly same results as method 1. So the question is -- how do I get the pretty output of method 2, creating nodes as in method 1? The only option I see is to create a method that would clone given XElement, effectively recreating it according to method 2 pattern, but that seems ugly. I'm looking for a more obvious solution I overlooked for some reason.

    Read the article

  • mySQL select and group by values

    - by Foo
    I'd like to count and group rows by specific values. This seems fairly simple, but I can't seem to do it. I have a table set up similar to this: Table: Ratings id pID uID rating 1 1 2 7 2 1 7 7 3 1 5 4 4 1 1 1 id is the primary key, piD and uID are foreign-keys. Rating contains values between 1 and 10, and only between 1 and 10. I want to run some statistics and count the number of ratings with a certain value. In the example above, two have left a rating of 7. So I wrote the following query: SELECT COUNT(*) AS 'count' , 'rating' FROM 'ratings' WHERE pID= '1' GROUP BY `rating` ORDER BY `rating` Which yields the nice result as: count ratings 1 1 1 4 2 7 I'd like to get the mySQL query to include values between 1 and 10 as well. For example: Desired Result count ratings 1 1 0 2 0 3 1 4 0 5 0 6 2 7 0 8 0 9 0 10 Unfortunately, I'm relatively new to SQL and I've been reading through everything I could get my hands on for the past hour, but I can't get it to work. I've been leaning along the lines of a some type of JOIN. If anyone can point me in the right direction, it'd be appreciated. Thanks.

    Read the article

  • Twitter Favorites and more than 20

    - by danit
    Im using curl to fetch my Twitter favorites: <?php $username = "bob"; $password = "password"; $twitterHost = "http://twitter.com/favorites.xml"; $curl; $curl = curl_init(); curl_setopt($curl, CURLOPT_CONNECTTIMEOUT, 2); curl_setopt($curl, CURLOPT_HEADER, false); curl_setopt($curl, CURLOPT_HTTPAUTH, CURLAUTH_BASIC); curl_setopt($curl, CURLOPT_RETURNTRANSFER, 1); curl_setopt($curl, CURLOPT_USERPWD, "$username:$password"); curl_setopt($curl, CURLOPT_HTTP_VERSION, CURL_HTTP_VERSION_1_1); curl_setopt($curl, CURLOPT_URL, $twitterHost); $result = curl_exec($curl); curl_close($curl); header('Content-Type: application/xml; charset=ISO-8859-1'); print $result; ?> However this only fetches the last 20 favorites, not all of them. If i amend this line: $twitterHost = "http://twitter.com/favorites.xml"; And change it to: $twitterHost = "http://twitter.com/favorites.xml?page=2"; I can get the next set of 20 favorites. There doesnt appear to be anyway, using the Twitter API, to find out how many pages of favorites there are. As such can anyone suggest the best way to get all favorites? Or if this is not possible, get all the Tweets for a date range?

    Read the article

  • "|" pipe operator not working in command line in C++

    - by user332024
    I am having a windows application interacting with DB2 database. In my application i have code to execute some DB2 commands through command line interface. I have used windowsAPI "ShellExecuteEx()" to execute those DB2 commands through command line. Following is the code written to execute DB2 command through command line. string command = "/c /w /i DB2 UNCATALOG NODE DB_DATABASE "" test.log | echo %date% %time% test.log SHELLEXECUTEINFO shellInfo; ZeroMemory(&shellInfo, sizeof(shellInfo)); shellInfo.cbSize = sizeof(shellInfo); shellInfo.fMask = SEE_MASK_FLAG_NO_UI | SEE_MASK_NOCLOSEPROCESS; //shellInfo.lpFile = "db2cmd"; shellInfo.lpFile = "db2cmd"; shellInfo.lpParameters = command.c_str(); The code is executed successfully , however if test.log is observered i only get result of DB2 command and not date and time. If you see the above command there is "|" pipe operator and echo command to log date and time in test.log Please note that if I execute above DB2 command through separately command line i.e. not through code. I am able to view date and time log along with DB2 command result in test.log. Following is the full command which i executed through command line. DB2CMD /c /i /w DB2 UNCATALOG NODE DB_DATABASE "" test.log | echo %date% %time% test.log According to me since DB2 command is executed successfully through code, there is problem with only usage of "|" pipe operator or echo command.

    Read the article

  • Delphi: EInvalidOp in neural network class (TD-lambda)

    - by user89818
    I have the following draft for a neural network class. This neural network should learn with TD-lambda. It is started by calling the getRating() function. But unfortunately, there is an EInvalidOp (invalid floading point operation) error after about 1000 iterations in the following lines: neuronsHidden[j] := neuronsHidden[j]+neuronsInput[t][i]*weightsInput[i][j]; // input -> hidden weightsHidden[j][k] := weightsHidden[j][k]+LEARNING_RATE_HIDDEN*tdError[k]*eligibilityTraceOutput[j][k]; // adjust hidden->output weights according to TD-lambda Why is this error? I can't find the mistake in my code :( Can you help me? Thank you very much in advance! unit uNeuronalesNetz; interface uses Windows, Messages, SysUtils, Variants, Classes, Graphics, Controls, Forms, Dialogs, ExtCtrls, StdCtrls, Grids, Menus, Math; const NEURONS_INPUT = 43; // number of neurons in the input layer NEURONS_HIDDEN = 60; // number of neurons in the hidden layer NEURONS_OUTPUT = 1; // number of neurons in the output layer NEURONS_TOTAL = NEURONS_INPUT+NEURONS_HIDDEN+NEURONS_OUTPUT; // total number of neurons in the network MAX_TIMESTEPS = 42; // maximum number of timesteps possible (after 42 moves: board is full) LEARNING_RATE_INPUT = 0.25; // in ideal case: decrease gradually in course of training LEARNING_RATE_HIDDEN = 0.15; // in ideal case: decrease gradually in course of training GAMMA = 0.9; LAMBDA = 0.7; // decay parameter for eligibility traces type TFeatureVector = Array[1..43] of SmallInt; // definition of the array type TFeatureVector TArtificialNeuralNetwork = class // definition of the class TArtificialNeuralNetwork private // GENERAL SETTINGS START learningMode: Boolean; // does the network learn and change its weights? // GENERAL SETTINGS END // NETWORK CONFIGURATION START neuronsInput: Array[1..MAX_TIMESTEPS] of Array[1..NEURONS_INPUT] of Extended; // array of all input neurons (their values) for every timestep neuronsHidden: Array[1..NEURONS_HIDDEN] of Extended; // array of all hidden neurons (their values) neuronsOutput: Array[1..NEURONS_OUTPUT] of Extended; // array of output neurons (their values) weightsInput: Array[1..NEURONS_INPUT] of Array[1..NEURONS_HIDDEN] of Extended; // array of weights: input->hidden weightsHidden: Array[1..NEURONS_HIDDEN] of Array[1..NEURONS_OUTPUT] of Extended; // array of weights: hidden->output // NETWORK CONFIGURATION END // LEARNING SETTINGS START outputBefore: Array[1..NEURONS_OUTPUT] of Extended; // the network's output value in the last timestep (the one before) eligibilityTraceHidden: Array[1..NEURONS_INPUT] of Array[1..NEURONS_HIDDEN] of Array[1..NEURONS_OUTPUT] of Extended; // array of eligibility traces: hidden layer eligibilityTraceOutput: Array[1..NEURONS_TOTAL] of Array[1..NEURONS_TOTAL] of Extended; // array of eligibility traces: output layer reward: Array[1..MAX_TIMESTEPS] of Array[1..NEURONS_OUTPUT] of Extended; // the reward value for all output neurons in every timestep tdError: Array[1..NEURONS_OUTPUT] of Extended; // the network's error value for every single output neuron t: Byte; // current timestep cyclesTrained: Integer; // number of cycles trained so far (learning rates could be decreased accordingly) last50errors: Array[1..50] of Extended; // LEARNING SETTINGS END public constructor Create; // create the network object and do the initialization procedure UpdateEligibilityTraces; // update the eligibility traces for the hidden and output layer procedure tdLearning; // learning algorithm: adjust the network's weights procedure ForwardPropagation; // propagate the input values through the network to the output layer function getRating(state: TFeatureVector; explorative: Boolean): Extended; // get the rating for a given state (feature vector) function HyperbolicTangent(x: Extended): Extended; // calculate the hyperbolic tangent [-1;1] procedure StartNewCycle; // start a new cycle with everything set to default except for the weights procedure setLearningMode(activated: Boolean=TRUE); // switch the learning mode on/off procedure setInputs(state: TFeatureVector); // transfer the given feature vector to the input layer (set input neurons' values) procedure setReward(currentReward: SmallInt); // set the reward for the current timestep (with learning then or without) procedure nextTimeStep; // increase timestep t function getCyclesTrained(): Integer; // get the number of cycles trained so far procedure Visualize(imgHidden: Pointer); // visualize the neural network's hidden layer end; implementation procedure TArtificialNeuralNetwork.UpdateEligibilityTraces; var i, j, k: Integer; begin // how worthy is a weight to be adjusted? for j := 1 to NEURONS_HIDDEN do begin for k := 1 to NEURONS_OUTPUT do begin eligibilityTraceOutput[j][k] := LAMBDA*eligibilityTraceOutput[j][k]+(neuronsOutput[k]*(1-neuronsOutput[k]))*neuronsHidden[j]; for i := 1 to NEURONS_INPUT do begin eligibilityTraceHidden[i][j][k] := LAMBDA*eligibilityTraceHidden[i][j][k]+(neuronsOutput[k]*(1-neuronsOutput[k]))*weightsHidden[j][k]*neuronsHidden[j]*(1-neuronsHidden[j])*neuronsInput[t][i]; end; end; end; end; procedure TArtificialNeuralNetwork.setReward; VAR i: Integer; begin for i := 1 to NEURONS_OUTPUT do begin // +1 = player A wins // 0 = draw // -1 = player B wins reward[t][i] := currentReward; end; end; procedure TArtificialNeuralNetwork.tdLearning; var i, j, k: Integer; begin if learningMode then begin for k := 1 to NEURONS_OUTPUT do begin if reward[t][k] = 0 then begin tdError[k] := GAMMA*neuronsOutput[k]-outputBefore[k]; // network's error value when reward is 0 end else begin tdError[k] := reward[t][k]-outputBefore[k]; // network's error value in the final state (reward received) end; for j := 1 to NEURONS_HIDDEN do begin weightsHidden[j][k] := weightsHidden[j][k]+LEARNING_RATE_HIDDEN*tdError[k]*eligibilityTraceOutput[j][k]; // adjust hidden->output weights according to TD-lambda for i := 1 to NEURONS_INPUT do begin weightsInput[i][j] := weightsInput[i][j]+LEARNING_RATE_INPUT*tdError[k]*eligibilityTraceHidden[i][j][k]; // adjust input->hidden weights according to TD-lambda end; end; end; end; end; procedure TArtificialNeuralNetwork.ForwardPropagation; var i, j, k: Integer; begin for j := 1 to NEURONS_HIDDEN do begin neuronsHidden[j] := 0; for i := 1 to NEURONS_INPUT do begin neuronsHidden[j] := neuronsHidden[j]+neuronsInput[t][i]*weightsInput[i][j]; // input -> hidden end; neuronsHidden[j] := HyperbolicTangent(neuronsHidden[j]); // activation of hidden neuron j end; for k := 1 to NEURONS_OUTPUT do begin neuronsOutput[k] := 0; for j := 1 to NEURONS_HIDDEN do begin neuronsOutput[k] := neuronsOutput[k]+neuronsHidden[j]*weightsHidden[j][k]; // hidden -> output end; neuronsOutput[k] := HyperbolicTangent(neuronsOutput[k]); // activation of output neuron k end; end; procedure TArtificialNeuralNetwork.setLearningMode; begin learningMode := activated; end; constructor TArtificialNeuralNetwork.Create; var i, j, k: Integer; begin inherited Create; Randomize; // initialize random numbers generator learningMode := TRUE; cyclesTrained := -2; // only set to -2 because it will be increased twice in the beginning StartNewCycle; for j := 1 to NEURONS_HIDDEN do begin for k := 1 to NEURONS_OUTPUT do begin weightsHidden[j][k] := abs(Random-0.5); // initialize weights: 0 <= random < 0.5 end; for i := 1 to NEURONS_INPUT do begin weightsInput[i][j] := abs(Random-0.5); // initialize weights: 0 <= random < 0.5 end; end; for i := 1 to 50 do begin last50errors[i] := 0; end; end; procedure TArtificialNeuralNetwork.nextTimeStep; begin t := t+1; end; procedure TArtificialNeuralNetwork.StartNewCycle; var i, j, k, m: Integer; begin t := 1; // start in timestep 1 cyclesTrained := cyclesTrained+1; // increase the number of cycles trained so far for j := 1 to NEURONS_HIDDEN do begin neuronsHidden[j] := 0; for k := 1 to NEURONS_OUTPUT do begin eligibilityTraceOutput[j][k] := 0; outputBefore[k] := 0; neuronsOutput[k] := 0; for m := 1 to MAX_TIMESTEPS do begin reward[m][k] := 0; end; end; for i := 1 to NEURONS_INPUT do begin for k := 1 to NEURONS_OUTPUT do begin eligibilityTraceHidden[i][j][k] := 0; end; end; end; end; function TArtificialNeuralNetwork.getCyclesTrained; begin result := cyclesTrained; end; procedure TArtificialNeuralNetwork.setInputs; var k: Integer; begin for k := 1 to NEURONS_INPUT do begin neuronsInput[t][k] := state[k]; end; end; function TArtificialNeuralNetwork.getRating; begin setInputs(state); ForwardPropagation; result := neuronsOutput[1]; if not explorative then begin tdLearning; // adjust the weights according to TD-lambda ForwardPropagation; // calculate the network's output again outputBefore[1] := neuronsOutput[1]; // set outputBefore which will then be used in the next timestep UpdateEligibilityTraces; // update the eligibility traces for the next timestep nextTimeStep; // go to the next timestep end; end; function TArtificialNeuralNetwork.HyperbolicTangent; begin if x > 5500 then // prevent overflow result := 1 else result := (Exp(2*x)-1)/(Exp(2*x)+1); end; end.

    Read the article

  • NUll exception in filling a querystring by mocing framework

    - by user564101
    There is a simple controller that a querystring is read in constructor of it. public class ProductController : Controller { parivate string productName; public ProductController() { productName = Request.QueryString["productname"]; } public ActionResult Index() { ViewData["Message"] = productName; return View(); } } Also I have a function in unit test that create an instance of this Controller and I fill the querystring by a Mock object like below. [TestClass] public class ProductControllerTest { [TestMethod] public void test() { // Arrange var querystring = new System.Collections.Specialized.NameValueCollection { { "productname", "sampleproduct"} }; var mock = new Mock<ControllerContext>(); mock.SetupGet(p => p.HttpContext.Request.QueryString).Returns(querystring); var controller = new ProductController(); controller.ControllerContext = mock.Object; // Act var result = controller.Index() as ViewResult; // Assert Assert.AreEqual("Index", result.ViewName); } } Unfortunately Request.QueryString["productname"] is null in constructor of ProductController when I run test unit. Is ther any way to fill a querystrin by a mocking and get it in constructor of a control?

    Read the article

  • Display latest date from a HTML attribute

    - by Tron
    I currently have several classes which contain a date inside an attribute. <div id="container"> <div class="date" date="19/11/2013"></div> <div class="date" date="06/11/2013"></div> </div> <div id="result"></div> What I would like to do, is find the latest date and display it on the page. So far, I've found the information in the attribute, checked that it doesn't exist in the array then and pushed it into an array. I'm not entirely sure of the best approach from here, but ideally i would like to find the latest date and then append it to the results container. $('.date').each(function () { var dateArray = []; var date = $(this).attr('date'); if ($.inArray(date, dateArray) == -1) { dateArray.push(date); } $('#result').append(dateArray); }); Any assistance on the above would be greatly appreciated. Thanks :)

    Read the article

  • NVelocity (or Velocity) as a stand-alone formula evaluator

    - by dana
    I am using NVelocity in my application to generate html emails. My application has an event-driven model, where saving and/or updating of objects causes these emails to be sent out. Each event can trigger zero, one or multiple multiple emails. I want to be able to configure which emails get sent out at run-time without having to modify code. I was thinking I could leverage the NVelocity #if() directive to do this. Here is my idea... Step 1) Prior to email sending, the administrator must configure a formula for NVelocity to evaluate. For example: $User.FirstName == "Jack" Step 2) When an object is saved or created, build an NVelocity template in memory based on the input formula. For example: String formula = GetFormulaFromDB(); // $User.FirstName == "Jack" String templ = "#if( " + formula + ") 1 #else 0 #end"; Step 3) Execute the NVelocity engine in memory against the template. Check the results to see if we have to send the email: String result = VelocityMerge(templ); // utility function if( result.Trim() == "1" ) { SendEmail(); } I know this is not exactly what NVelocity was intended to do, but I think it just might work :) One of the benefits of doing things this way is that the same syntax can be used for the formula as is used inside the template. Does anybody have any words of caution or suggestions? Is there a way to execute the #if() directive without jumping through hoops like I have above? Is there a recommended way to validate the formula syntax ahead of time? Thanks.

    Read the article

  • What is the best way to go about grouping rows by the same timestamp?

    - by Luke
    Hello all. I am looking for some advice. I have rows of data in the database that i want to group together. There is a timestamp involved. That column is called date. What is the best way to go about grouping rows by the same timestamp. EDITED..... <? $result = mysql_query("SELECT * FROM ".TBL_FIXTURES." ORDER BY date"); $current_week = null; while ($row = mysql_fetch_assoc($result)) { if ($row['date'] != $current_week) { $current_week = $row['date']; echo 'Week ' . $current_week .': '; } echo $row['home_user']; echo $row['home_team']; echo $row['away_user']; echo $row['away_team']; } ?> I have this code. What i am trying to do is organise each round of fixtures in a row with a title Week 1 - date. I want Week 1 and the date and all fixtures with that date displayed. Then move onto week 2 and the date and all fixtures again. This should be done for every fixture in the database, so if there are 6 rounds of fixtures, there will be 6 dates and therefore 6 blocks of fixtures.. Please help, thanks

    Read the article

  • Shell script for generating HTML out put

    - by user1638016
    The following script is generating the desired out put but not redirecting the result to /home/myuser/slavedelay.html #!/bin/bash host=<ip> echo $host user=usr1 password=mypass threshold=300 statusok=OK statuscritical=CRITICAL for i in ert7 ert9 do echo "<html>" > /home/myuser/slavedelay.html if [ "$i" == "ert7" ]; then slvdelay=`mysql -u$user -p$password -h<ip> -S /backup/mysql/mysql.sock -e 'show slave status\G' | grep Seconds_Behind_Master | sed -e 's/ *Seconds_Behind_Master: //'` if [ $slvdelay -ge $threshold ]; then echo "<tr><td>$i</td><td>CRITICAL</td>" >> /home/myuser/slavedelay.html echo "<tr><td>$i</td><td>CRITICAL</td>" else echo "<tr><td>$i</td><td>OK</td>" >> /home/myuser/slavedelay.html echo "<tr><td>$i</td><td>OK</td>" fi fi done echo "</html>" >> /home/myuser/slavedelay.html If I cat the output file /home/myuser/slavedelay.html it gives. <html> </html> Execution result : sh slave_delay.sh <tr><td>sdb7</td><td>OK</td>

    Read the article

  • how to do validations when composing object of a class in other class ?

    - by haansi
    Hi, I have an IPAddress class which has one property named ip and in its setter I am validating data coming and if data is invalid it throws an error. (Its code is as the following): private string ip; public string IP { get { return ip; } set { string PartsOfIP = value.Split('.'); if (PartsOfIP.Length == 4) { foreach (string part in PartsOfIP) { int a = 0; bool result = int.TryParse(part, out a); if (result != true) { throw new Exception("Invalid IP"); } else { ip = value; } } } else { throw new Exception("Invalid IP"); } } In User Class I want to compose an object of IPAddress class. I am doing validations for properties of User in User class and validations of Ip in IPAddress class. My question is how I will compose IPAddress object in UserClass and what will be syntax for this ? If I again mention get and set here with IPAddress object in User class will my earlier mentioned (in IPAddress class) getter and setter work ? plz advice me in details thanks

    Read the article

< Previous Page | 263 264 265 266 267 268 269 270 271 272 273 274  | Next Page >