Search Results

Search found 35149 results on 1406 pages for 'yield return'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 266/1406 | < Previous Page | 262 263 264 265 266 267 268 269 270 271 272 273  | Next Page >

  • How to drop null values with a native Oracle XML DB Web Service?

    - by gfjr
    I am using native Oracle XML DB Web Services (using a PL/SQL function with a web service). I want to drop null values (put nothing in the output (no XML element)). It's working with Oracle 11.2.0.1.0 but not with Oracle 11.2.0.3.0. Just to clarify... I don't want to consume a webservice with PL/SQL, I want to publish my PL/SQL packages/procedures/functions as a web service! Hope someone can help me. Thank you. In this example is the column "country" null. Oracle 11.2.0.1.0 (this is what I want): <soap:Envelope xmlns:soap="http://schemas.xmlsoap.org/soap/envelope/"> <soap:Body> <GET_PERSONOutput xmlns="http://xmlns.oracle.com/orawsv/TESTSTUFF/GET_PERSON"> <RETURN> <PERSON> <PERSON_ID>3</PERSON_ID> <FIRST_NAME>Harry</FIRST_NAME> <LAST_NAME>Potter</LAST_NAME> </PERSON> </RETURN> </GET_PERSONOutput> </soap:Body> </soap:Envelope> Oracle 11.2.0.3.0: <soap:Envelope xmlns:soap="http://schemas.xmlsoap.org/soap/envelope/"> <soap:Body> <GET_PERSONOutput xmlns="http://xmlns.oracle.com/orawsv/TESTSTUFF/GET_PERSON"> <RETURN> <PERSON> <PERSON_ID>3</PERSON_ID> <FIRST_NAME>Harry</FIRST_NAME> <LAST_NAME>Potter</LAST_NAME> <COUNTRY/> </PERSON> </RETURN> </GET_PERSONOutput> </soap:Body> </soap:Envelope>

    Read the article

  • warning: returning reference to temporary

    - by Jack
    I have a function like this const string &SomeClass::Foo(int Value) { if (Value < 0 or Value > 10) return ""; else return SomeClass::StaticMember[i]; } I get warning: returning reference to temporary. Why is that? I thought the both values the function returns (reference to const char* "" and reference to a static member) cannot be temporary.

    Read the article

  • LINQ Query returns false when it should be true.

    - by deliriousDev
    I have the following LINQ query written by a former developer and it isn't working when it should. public bool IsAvailable(Appointment appointment) { var appointments = _appointmentRepository.Get; var shifts = _scheduleRepository.Get; var city = _customerRepository.Find(appointment.CustomerId).City ?? appointment.Customer.City; const int durationHour = 1; DateTime scheduledEndDate = appointment.ScheduledTime.Add(new TimeSpan(durationHour, 0, 0)); var inWorkingHours = shifts .Where(x => //Check if any available working hours x.Employee.City == city && x.ShiftStart <= appointment.ScheduledTime && x.ShiftEnd >= scheduledEndDate && //check if not booked yet !appointments .Where(a => (appointment.Id == 0 || a.Id != appointment.Id) && a.Employee.Id == x.Employee.Id && ( (a.ScheduledTime <= appointment.ScheduledTime && appointment.ScheduledTime <= EntityFunctions.AddHours(a.ScheduledTime, durationHour)) || (a.ScheduledTime <= scheduledEndDate && scheduledEndDate <= EntityFunctions.AddHours(a.ScheduledTime, durationHour)) )) .Select(a => a.Employee.Id) .Contains(x.Employee.Id) ); if (inWorkingHours.Any()) { var assignedEmployee = inWorkingHours.FirstOrDefault().Employee; appointment.EmployeeId = assignedEmployee.Id; appointment.Employee = assignedEmployee; return true; } return false; } The query is suppose to handle the following scenarios Given An Appointment With A ScheduledTime Between A ShiftStart and ShiftEnd time But Does not match any employees in same city - (Return true, Assign as "Unassigned") Given An Appointment With A ScheduledTime Between A ShiftStart and ShiftEnd time AND Employee for that shift is in the same city as the customer (Return True AND Assign to the employee) If the customer is NOT in the same city as an employee we assign the appointment as "Unassigned" as along as the scheduledTime is within an of the employees shift start/end times If the customer is in the same city as an employee we assign the appointment to one of the employees (firstOrdefault) and occupy that timeslot. Appointments CAN NOT overlap (Assigned Ones). Unassigned can't overlap each other. This query use to work (I've been told). But now it doesn't and I have tried refactoring it and various other paths with no luck. I am now on week two and just don't know where the issue in the query is or how to write it. Let me know if I need to post anything further. I have verified appointments, shifts, city all populate with valid data so the issue doesn't appear to be with null or missing data.

    Read the article

  • PHP Detect if any URL variables have been set

    - by zuk1
    Hey guys, it's kind of hard to explain but basically I want to detect if any variables have been set through the URL. So with my IF statement all of the following should return true: http://domain.com/index.php?m=100 http://domain.com/index.php?q=harhar http://domain.com/index.php?variable=poo&crazy=yes and all the following return false: http://domain.com/index.php http://domain.com/test.php http://domain.com/no_variables.php Any ideas?

    Read the article

  • How to properly downcast in C# with a SWIG generated interface?

    - by JG
    I've got a very large and mature C++ code base that I'm trying to use SWIG on to generate a C# interface for. I cannot change the actual C++ code itself but we can use whatever SWIG offers in the way of extending/updating it. I'm facing an issue where a function C++ is written as such: A* SomeClass::next(A*) The caller might do something like: A* acurr = 0; while( (acurr = sc->next(acurr)) != 0 ){ if( acurr isoftype B ){ B* b = (B*)a; ...do some stuff with b.. } elseif( acurr isoftype C ) ... } Essentially, iterating through a container elements that depending on their true type, do something different. The SWIG generated C# layer for the "next" function unfortunately does the following: return new A(); So the calling code in C# land cannot determine if the returned object is actually a derived class or not, it actually appears to always be the base class (which does make sense). I've come across several solutions: Use the %extend SWIG keyword to add a method on an object and ultimately call dynamic_cast. The downside to this approach, as I see it, is that this requires you to know the inheritance hierarchy. In my case it is rather huge and I see this is as a maintenance issue. Use the %factory keyword to supply the method and the derived types and have SWIG automatically generate the dynamic_cast code. This appears to be a better solution that the first, however upon a deeper look it still requires you to hunt down all the methods and all the possible derived types it could return. Again, a huge maintenance issue. I wish I had a doc link for this but I can't find one. I found out about this functionality by looking through the example code that comes with SWIG. Create a C# method to create an instance of the derived object and transfer the cPtr to the new instance. While I consider this clumsy, it does work. See an example below. public static object castTo(object fromObj, Type toType) { object retval = null; BaseClass fromObj2 = fromObj as BaseClass; HandleRef hr = BaseClass.getCPtr(fromObj2); IntPtr cPtr = hr.Handle; object toObj = Activator.CreateInstance(toType, cPtr, false); // make sure it actually is what we think it is if (fromObj.GetType().IsInstanceOfType(toObj)) { return toObj; } return retval; } Are these really the options? And if I'm not willing to dig through all the existing functions and class derivations, then I'm left with #3? Any help would be appreciated.

    Read the article

  • Javascript AJAX function returns undefined instead of true / false

    - by Josh K
    I have a function that issues an AJAX call (via jQuery). In the complete section I have a function that says: complete: function(XMLHttpRequest, textStatus) { if(textStatus == "success") { return(true); } else { return(false); } } However, if I call this like so: if(callajax()) { // Do something } else { // Something else } The first is never called. If I put an alert(textStatus) in the complete function I get true, but not before that function returns undefined.

    Read the article

  • How to translate,use JSON in GWT?

    - by graybow
    I'm new in gwt. and need to know how to use JSON in gwt so i try this simple data loader but i'm still confuse. I create a project named 'tesdb3' in eclipse. I create the PHP side to access the database, and made the output as JSON.. I create the userdata.php in folder war. then I compile tesdb3 project. Folder tesdb3 and the userdata.php in war moved in local server(I use WAMP). I put the PHP in folder tesdb3. This is the result from my localhost/phpmyadmin/tesdb3/userdata.php [{"kode":"002","nama":"bambang gentolet"}{"kode":"012","nama":"Algiz"}] From that result I think the PHP side was working good.Then I create UserData.java as JSNI overlay like this: package com.tesdb3.client; import com.google.gwt.core.client.JavaScriptObject; class UserData extends JavaScriptObject{ protected UserData() {} public final native String getKode() /*-{ return this.kode; }-*/; public final native String getNama() /*-{ return this.nama; }-*/; public final String getFullData() { return getKode() + ":" + getNama(); } } Then Finally in the tesdb3.java: public class Tesdb3 implements EntryPoint { String url= "http://localhost/phpmyadmin/tesdb3/datauser.php"; private native JsArray<UserData> getuserdata(String Json) /*-{ return eval(json); }-*/; public void LoadData() throws RequestException{ RequestBuilder builder = new RequestBuilder(RequestBuilder.POST, URL.encode(url)); builder.sendRequest(null, new RequestCallback(){ @Override public void onError(Request request, Throwable exception) { Window.alert("error " + exception); } public void onResponseReceived(Request request, Response response) { getuserdata(response.getText()); //this is how i use the userdata json(is this already translated?) UserData UD = null; String LKode =UD.getKode(); String LName =UD.getNama(); Label L = new Label(LKode+""+LName); RootPanel.get().add(L); } }); } public void onModuleLoad() { try { LoadData(); } catch (RequestException e) { e.printStackTrace(); } } } The result is blank(i use development mode). and there was an eror like this:(I show it just some part) 10:46:29.984 [ERROR] [tesdb3] Uncaught exception escaped com.google.gwt.core.client.JavaScriptException: (ReferenceError): json is not defined fileName: http://localhost:1092 lineNumber: 2 stack: ("")@http://localhost:1092:2 My question is: How I use the translated Json in right way?? Is there any wrong use from my code? Is that necessary to move the compiled project to local server folder?(i do it following a tutorial from google). Sorry too many ask. but i'm really really confused.

    Read the article

  • How to find attribute value

    - by Pramodh
    Hi, I need to find an inner text of an element inside an XmlDocument and return it's Xpath. for example, searching for "ThisText" inside : <xml> <xml2 val="ThisText"></xml2> </xml> should return the Xpath of xml2 what's the most efficient way of doing this in c#?

    Read the article

  • Getting jQuery slideshow animation to stop on click

    - by hollyb
    I have a slide show built with jQuery that pauses on hover. It has a group of thumbnails sitting on top of the image that advances the image when clicked, otherwise the slideshow just auto-rotates through all the images. There is also a +/- to expand and contract a caption related to each image. I want to have the slideshow's automatic advancing to stop if one of the thumbnails is clicked, or the +/-. Basically, just stop whenever a user clicks anywhere within the gallery (div class=".homeImg"). I'm having a major brain fart in getting this working properly and could use some advice. Here's the jQuery: $(document).ready(function() { $(".main_image .desc").show(); //Show image info $(".main_image .block").animate({ opacity: 0.85 }, 1 ); //Set Opacity //Click and Hover events for thumbnail list $(".image_thumb ul li:first").addClass('active'); // * Adds a class 'last' to the last li to let the rotator know when to return to the first $(".image_thumb ul li:last").addClass('last'); $(".image_thumb ul li").click(function(){ //Set Variables var imgAlt = $(this).find('img').attr("alt"); //Get Alt Tag of Image var imgTitle = $(this).find('a').attr("href"); //Get Main Image URL var imgDesc = $(this).find('.block').html(); //Get HTML of block var imgDescHeight = $(".main_image").find('.block').height(); //Calculate height of block if ($(this).is(".active")) { //If it's already active, then… return false; // Don't click through } else { //Animate $(".main_image img").animate({ opacity: 0}, 800 ); $(".main_image .block").animate({ opacity: 0, marginBottom: -imgDescHeight }, 800, function() { $(".main_image .block").html(imgDesc).animate({ opacity: 0.85, marginBottom: "0" }, 250 ); $(".main_image img").attr({ src: imgTitle , alt: imgAlt}).animate({ opacity: 1}, 250 ); }); } $(".image_thumb ul li").removeClass('active'); //Remove class of 'active' on all lists $(this).addClass('active'); //add class of 'active' on this list only return false; }) .hover(function(){ $(this).addClass('hover'); }, function() { $(this).removeClass('hover'); }); //Toggle teaser $("a.collapse").click(function(){ $(".main_image .block").slideToggle(); $("a.collapse").toggleClass("show"); return false; // added to remove # browser jump }); // If we are hovering over the image area, pause the clickNext function pauseClickNext = false; $(".homeImg").hover( function () { pauseClickNext = true; }, function () { pauseClickNext = false; } ); // Define function to click the next li var clickNext = function(){ if(!pauseClickNext) { /// find the next li after .active var $next_li = $("li.active").next("li"); if($("li.active").hasClass("last") ){ $(".image_thumb ul li:first").trigger("click"); } else { $next_li.trigger("click"); } } }; // Time between image transition setInterval(clickNext, 6000); });

    Read the article

  • How do I use a custom #theme function to a fieldset in a drupal module?

    - by Rob Crowell
    I have a module that builds a form that includes a fieldset. Instead of using the <legend> element to render the fieldset title, I want to place this content in a <div> element instead. But I want to change the behavior only for the form returned by my module, so I don't want to place any new functionality into my theme's template.php file. In mymod.module I have defined: // custom rendering function for fieldset elements function theme_mymod_fieldset($element) { return 'test'; } // implement hook_theme function mymod_theme() { return array( 'mymod_fieldset' => array('arguments' => array('element' => NULL)), 'mymod_form' => array('arguments' => array()) ); } // return a form that is based on the 'Basic Account Info' category of the user profile function mymod_form() { // load the user's profile global $user; $account = user_load($user->uid); // load the profile form, and then edit it $form_state = array(); $form = drupal_retrieve_form('user_profile_form', $form_state, $account, 'Basic Account Info'); // set the custom #theme function for this fieldset $form['Basic Account Info']['#theme'] = 'mymod_fieldset'; // more form manipulations // ... return $form; } When my page gets rendered, I expected to see the fieldset representing 'Basic Account Info' to be wholly replaced by my test message 'test'. Instead what happens is that the <fieldset> and <legend> elements are rendered as normal, but with the body of the fieldset replaced by the test message instead, like this: <fieldset> <legend>Basic Account Info</legend> test </fieldset> Why doesn't my #theme function have the chance to replace the entire <fieldset> element? If I wrap a textfield in this function instead, I am able to completely replace the <input> element along with its label. Furthermore, if I provide an override in my site's template.php for theme_fieldset, it works as expected and I am able to completely replace the <fieldset>, so I know it is possible. What's different about providing #theme functions to fieldsets inside a module?

    Read the article

  • Interoperability between two AES algorithms

    - by lpfavreau
    Hello, I'm new to cryptography and I'm building some test applications to try and understand the basics of it. I'm not trying to build the algorithms from scratch but I'm trying to make two different AES-256 implementation talk to each other. I've got a database that was populated with this Javascript implementation stored in Base64. Now, I'm trying to get an Objective-C method to decrypt its content but I'm a little lost as to where the differences in the implementations are. I'm able to encrypt/decrypt in Javascript and I'm able to encrypt/decrypt in Cocoa but cannot make a string encrypted in Javascript decrypted in Cocoa or vice-versa. I'm guessing it's related to the initialization vector, nonce, counter mode of operation or all of these, which quite frankly, doesn't speak to me at the moment. Here's what I'm using in Objective-C, adapted mainly from this and this: @implementation NSString (Crypto) - (NSString *)encryptAES256:(NSString *)key { NSData *input = [self dataUsingEncoding: NSUTF8StringEncoding]; NSData *output = [NSString cryptoAES256:input key:key doEncrypt:TRUE]; return [Base64 encode:output]; } - (NSString *)decryptAES256:(NSString *)key { NSData *input = [Base64 decode:self]; NSData *output = [NSString cryptoAES256:input key:key doEncrypt:FALSE]; return [[[NSString alloc] initWithData:output encoding:NSUTF8StringEncoding] autorelease]; } + (NSData *)cryptoAES256:(NSData *)input key:(NSString *)key doEncrypt:(BOOL)doEncrypt { // 'key' should be 32 bytes for AES256, will be null-padded otherwise char keyPtr[kCCKeySizeAES256 + 1]; // room for terminator (unused) bzero(keyPtr, sizeof(keyPtr)); // fill with zeroes (for padding) // fetch key data [key getCString:keyPtr maxLength:sizeof(keyPtr) encoding:NSUTF8StringEncoding]; NSUInteger dataLength = [input length]; // See the doc: For block ciphers, the output size will always be less than or // equal to the input size plus the size of one block. // That's why we need to add the size of one block here size_t bufferSize = dataLength + kCCBlockSizeAES128; void* buffer = malloc(bufferSize); size_t numBytesCrypted = 0; CCCryptorStatus cryptStatus = CCCrypt(doEncrypt ? kCCEncrypt : kCCDecrypt, kCCAlgorithmAES128, kCCOptionECBMode | kCCOptionPKCS7Padding, keyPtr, kCCKeySizeAES256, nil, // initialization vector (optional) [input bytes], dataLength, // input buffer, bufferSize, // output &numBytesCrypted ); if (cryptStatus == kCCSuccess) { // the returned NSData takes ownership of the buffer and will free it on deallocation return [NSData dataWithBytesNoCopy:buffer length:numBytesCrypted]; } free(buffer); // free the buffer; return nil; } @end Of course, the input is Base64 decoded beforehand. I see that each encryption with the same key and same content in Javascript gives a different encrypted string, which is not the case with the Objective-C implementation that always give the same encrypted string. I've read the answers of this post and it makes me believe I'm right about something along the lines of vector initialization but I'd need your help to pinpoint what's going on exactly. Thank you!

    Read the article

  • polymorphism, inheritance in c# - base class calling overridden method?

    - by Andrew Johns
    This code doesn't work, but hopefully you'll get what I'm trying to achieve here. I've got a Money class, which I've taken from http://www.noticeablydifferent.com/CodeSamples/Money.aspx, and extended it a little to include currency conversion. The implementation for the actual conversion rate could be different in each project, so I decided to move the actual method for retrieving a conversion rate (GetCurrencyConversionRate) into a derived class, but the ConvertTo method contains code that would work for any implementation assuming the derived class has overriden GetCurrencyConversionRate so it made sense to me to keep it in the parent class? So what I'm trying to do is get an instance of SubMoney, and be able to call the .ConvertTo() method, which would in turn use the overriden GetCurrencyConversionRate, and return a new instance of SubMoney. The problem is, I'm not really understanding some concepts of polymorphism and inheritance yet, so not quite sure what I'm trying to do is even possible in the way I think it is, as what is currently happening is that I end up with an Exception where it has used the base GetCurrencyConversionRate method instead of the derived one. Something tells me I need to move the ConvertTo method down to the derived class, but this seems like I'll be duplicating code in multiple implementations, so surely there's a better way? public class Money { public CurrencyConversionRate { get { return GetCurrencyConversionRate(_regionInfo.ISOCurrencySymbol); } } public static decimal GetCurrencyConversionRate(string isoCurrencySymbol) { throw new Exception("Must override this method if you wish to use it."); } public Money ConvertTo(string cultureName) { // convert to base USD first by dividing current amount by it's exchange rate. Money someMoney = this; decimal conversionRate = this.CurrencyConversionRate; decimal convertedUSDAmount = Money.Divide(someMoney, conversionRate).Amount; // now convert to new currency CultureInfo cultureInfo = new CultureInfo(cultureName); RegionInfo regionInfo = new RegionInfo(cultureInfo.LCID); conversionRate = GetCurrencyConversionRate(regionInfo.ISOCurrencySymbol); decimal convertedAmount = convertedUSDAmount * conversionRate; Money convertedMoney = new Money(convertedAmount, cultureName); return convertedMoney; } } public class SubMoney { public SubMoney(decimal amount, string cultureName) : base(amount, cultureName) {} public static new decimal GetCurrencyConversionRate(string isoCurrencySymbol) { // This would get the conversion rate from some web or database source decimal result = new Decimal(2); return result; } }

    Read the article

  • How does .NET compiler compare two strings?

    - by Pankaj
    string a="I am comparing 2 string"; string b="I am comparing 2 string"; if(a==b) return true; else return false; How does a .NET compiler compare two strings? Does a string work like a struct(int)? string is class so a=b means we are comparing 2 object, but i want to compare 2 values.

    Read the article

  • Python datetime to Unix timestamp

    - by Off Rhoden
    I have to create an "Expires" value 5 minutes in the future, but I have to supply it in UNIX Timestamp format. I have this so far, but it seems like a hack. def expires(): '''return a UNIX style timestamp representing 5 minutes from now''' epoch = datetime.datetime(1970, 1, 1) seconds_in_a_day = 60 * 60 * 24 five_minutes = datetime.timedelta(seconds=5*60) five_minutes_from_now = datetime.datetime.now() + five_minutes since_epoch = five_minutes_from_now - epoch return since_epoch.days * seconds_in_a_day + since_epoch.seconds Is there a module or function that does the timestamp conversion for me?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • SQLAlchemy returns tuple not dictionary

    - by Ivan
    Hi everyone, I've updated SQLAlchemy to 0.6 but it broke everything. I've noticed it returns tuple not a dictionary anymore. Here's a sample query: query = session.query(User.id, User.username, User.email).filter(and_(User.id == id, User.username == username)).limit(1) result = session.execute(query).fetchone() This piece of code used to return a dictionary in 0.5. My question is how can I return a dictionary?

    Read the article

  • A* algorithm works OK, but not perfectly. What's wrong?

    - by Bart van Heukelom
    This is my grid of nodes: I'm moving an object around on it using the A* pathfinding algorithm. It generally works OK, but it sometimes acts wrongly: When moving from 3 to 1, it correctly goes via 2. When going from 1 to 3 however, it goes via 4. When moving between 3 and 5, it goes via 4 in either direction instead of the shorter way via 6 What can be wrong? Here's my code (AS3): public static function getPath(from:Point, to:Point, grid:NodeGrid):PointLine { // get target node var target:NodeGridNode = grid.getClosestNodeObj(to.x, to.y); var backtrace:Map = new Map(); var openList:LinkedSet = new LinkedSet(); var closedList:LinkedSet = new LinkedSet(); // begin with first node openList.add(grid.getClosestNodeObj(from.x, from.y)); // start A* var curNode:NodeGridNode; while (openList.size != 0) { // pick a new current node if (openList.size == 1) { curNode = NodeGridNode(openList.first); } else { // find cheapest node in open list var minScore:Number = Number.MAX_VALUE; var minNext:NodeGridNode; openList.iterate(function(next:NodeGridNode, i:int):int { var score:Number = curNode.distanceTo(next) + next.distanceTo(target); if (score < minScore) { minScore = score; minNext = next; return LinkedSet.BREAK; } return 0; }); curNode = minNext; } // have not reached if (curNode == target) break; else { // move to closed openList.remove(curNode); closedList.add(curNode); // put connected nodes on open list for each (var adjNode:NodeGridNode in curNode.connects) { if (!openList.contains(adjNode) && !closedList.contains(adjNode)) { openList.add(adjNode); backtrace.put(adjNode, curNode); } } } } // make path var pathPoints:Vector.<Point> = new Vector.<Point>(); pathPoints.push(to); while(curNode != null) { pathPoints.unshift(curNode.location); curNode = backtrace.read(curNode); } pathPoints.unshift(from); return new PointLine(pathPoints); } NodeGridNode::distanceTo() public function distanceTo(o:NodeGridNode):Number { var dx:Number = location.x - o.location.x; var dy:Number = location.y - o.location.y; return Math.sqrt(dx*dx + dy*dy); }

    Read the article

  • Access static class variable of parent class in Python

    - by fuenfundachtzig
    I have someting like this class A: __a = 0 def __init__(self): A.__a = A.__a + 1 def a(self): return A.__a class B(A): def __init__(self): # how can I access / modify A.__a here? A.__a = A.__a + 1 # does not work def a(self): return A.__a Can I access the __astatic variable in B? It's possible writing a instead of __a, is this the only way? (I guess the answer might be rather short: yes :)

    Read the article

  • C# Create Values in Registry Local Machine

    - by Shahmir Javaid
    This is not working for me: public bool createRegistry() { if (!registryExists()) { Microsoft.Win32.Registry.LocalMachine.CreateSubKey("Software\\xelo\\"); Microsoft.Win32.Registry.LocalMachine.OpenSubKey("Software\\xelo").SetValue("hostname", (string)hostname, Microsoft.Win32.RegistryValueKind.String); return true; } else { return updateRegistry(); } } The exception error is to do with Not Authorized to do this. Any Help would be apreaciated Exeption: System.UnauthorizedAccessException | "Cannot write to the registry key"

    Read the article

  • Android GridView - How to change a bitmap dynamically?

    - by Alborz
    Hello I have a gridView which I use to show some pictures on (small thumb of diffrent levels). When the user finishes one level, I would like to change the thumb for that level. (Somehow show that it has been completed). I created two thumbs for each level. One is the original and one that shows that the level is completed. But how can i change the source of the images? The code which I use to draw the images looks like this. The main activity: /** Called when the activity is first created. */ public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.maps); GridView gridview = (GridView) findViewById(R.id.gridview); gridview.setAdapter(new ImageAdapter(this)); gridview.setOnItemClickListener(new OnItemClickListener() { @Override public void onItemClick(AdapterView<?> parent, View v, int position, long id) { //Open the map which was clicked on, if there is one if(position+1 > 1){ Toast.makeText(maps.this, "Level " + (position+1) + " is not yet available!", Toast.LENGTH_SHORT).show(); }else{ Toast.makeText(maps.this, "Opening Level " + (position+1), Toast.LENGTH_SHORT).show(); Intent myIntent = new Intent(v.getContext(), Tutorial2D.class); startActivity(myIntent); } } }); } The ImageAdapter Class: public class ImageAdapter extends BaseAdapter { private Context mContext; public ImageAdapter(Context c) { mContext = c; } public int getCount() { return mThumbIds.length; } public Object getItem(int position) { return null; } public long getItemId(int position) { return 0; } // create a new ImageView for each item referenced by the Adapter public View getView(int position, View convertView, ViewGroup parent) { ImageView imageView; if (convertView == null) { // if it's not recycled, initialize some attributes imageView = new ImageView(mContext); imageView.setLayoutParams(new GridView.LayoutParams(85, 85)); imageView.setScaleType(ImageView.ScaleType.CENTER_CROP); imageView.setPadding(8, 8, 8, 8); } else { imageView = (ImageView) convertView; } //Changing imageView.setImageResource(mThumbIds[position]); return imageView; } // references to our images private Integer[] mThumbIds = { R.drawable.map1, R.drawable.map2, R.drawable.map3, R.drawable.map4, R.drawable.map5, R.drawable.map6, R.drawable.map7, R.drawable.map8, R.drawable.map9, R.drawable.map10, R.drawable.map11, R.drawable.map12, R.drawable.map13, R.drawable.map14, R.drawable.map15, R.drawable.map16, R.drawable.map17, R.drawable.map18, R.drawable.map19 }; }

    Read the article

  • Why can't you call abstract functions from abstract classes in PHP?

    - by incrediman
    I've set up an abstract parent class, and a concrete class which extends it. Why can the parent class not call the abstract function? //foo.php <?php abstract class AbstractFoo{ abstract public static function foo(); public static function getFoo(){ return self::foo();//line 5 } } class ConcreteFoo extends AbstractFoo{ public static function foo(){ return "bar"; } } echo ConcreteFoo::getFoo(); ?> Error: Fatal error: Cannot call abstract method AbstractFoo::foo() in foo.php on line 5

    Read the article

  • How to match multiple substrings in jQuery combobox autocomplete

    - by John R
    I found more than a couple examples of this with a plain jquery autocomplete but not in a way that will work with the autocomplete included in the combobox code from the demo because the structure of the code is structured so differently. I want to match every item that has all of the search tokens anywhere in any word. I don't need to match the start of any word, any part of it is fine. I don't care if the search strings are highlighted in the autocomplete list if that makes things too complicated. Desired search/result combos: (please excuse the spacing) "fi th" "fi rst second th ird" "rs on" "fi rs t sec on d third" "ec rd" "first s ec ond thi rd" but not limited to any max/min length or number of tokens. EDIT I figured part of it out using the code structure from the other autocorrect I had working. source: function( requestObj, responseFunc ) { var matchArry = $("select > option").map(function(){return this.innerHTML;}).get(); var srchTerms = $.trim(requestObj.term).split(/\s+/); // For each search term, remove non-matches $.each (srchTerms, function (J, term) { var regX = new RegExp (term, "i"); matchArry = $.map (matchArry, function (item) { if( regX.test(item) ){ return{ label: item, value: item, option: HTMLOptionElement } ? item :null; } } ); }); // Return the match results responseFunc (matchArry); }, and select: function( event, ui ) { ui.item.option.selected = true; self._trigger( "selected", event, { item: ui.item.option }); $("destination").val(ui.item.value); // I added this line }, but I can't get both multiple words AND being able to click to select working at the same time. If I remove the } ? item :null; on the return in the map function I can click to select an item. If I leave it I can type multiple words, but I can't click any of the items... Is that the problem or the option: this? I've tried replacing it with HTMLOptionElement and null and I'm stuck. I am able to set the value of another field with ui.item.value within the select label but that doesn't put the value in the search box or close the dropdown menu. Fiddle of current code: http://jsfiddle.net/eY3hM/

    Read the article

  • Android HelloGoogleMaps to OSMdroid (Open Street Maps)

    - by birgit
    I am trying to reproduce a working HelloGoogleMaps app in Open Street Maps - but I have trouble including the itemized overlay in OSMdroid. I have looked at several resources but I cannot figure out how to fix the error on OsmItemizedOverlay - I guess I am constructing OsmItemizedOverlay wrongly or have a mixup with OsmItemizedOverlay and ItemizedOverlay? But everything I tried to change just raised more errors... "Implicit super constructor ItemizedOverlay() is undefined. Must explicitly invoke another constructor" "Cannot make a static reference to the non-static method setMarker(Drawable) from the type OverlayItem" - I hope someone can help me getting the class definition straight? Thanks so much! package com.example.osmdroiddemomap; import java.util.ArrayList; import android.app.AlertDialog; import android.content.Context; import android.graphics.Point; import android.graphics.drawable.Drawable; import org.osmdroid.api.IMapView; import org.osmdroid.views.*; import org.osmdroid.views.overlay.*; import org.osmdroid.views.overlay.OverlayItem.HotspotPlace; public class OsmItemizedOverlay extends ItemizedOverlay<OverlayItem> { Context mContext; private ArrayList<OverlayItem> mOverlays = new ArrayList<OverlayItem>(); //ERRORS are raised by the following 3 lines: public OsmItemizedOverlay(Drawable defaultMarker, Context context) { OverlayItem.setMarker(defaultMarker); OverlayItem.setMarkerHotspot(HotspotPlace.CENTER); mContext = context; } public void addOverlay(OverlayItem overlay) { mOverlays.add(overlay); populate(); } @Override protected OverlayItem createItem(int i) { return mOverlays.get(i); } @Override public int size() { return mOverlays.size(); } protected boolean onTap(int index) { OverlayItem item = mOverlays.get(index); AlertDialog.Builder dialog = new AlertDialog.Builder(mContext); dialog.setTitle(item.getTitle()); dialog.setMessage(item.getSnippet()); dialog.show(); return true; } @Override public boolean onSnapToItem(int arg0, int arg1, Point arg2, IMapView arg3) { // TODO Auto-generated method stub return false; } }

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 262 263 264 265 266 267 268 269 270 271 272 273  | Next Page >