Search Results

Search found 35149 results on 1406 pages for 'yield return'.

Page 267/1406 | < Previous Page | 263 264 265 266 267 268 269 270 271 272 273 274  | Next Page >

  • Calling and writing jquery/javascript functions

    - by Ankur
    I think I have not got the syntax correct for writing a javascript function and calling it to assign its return value to a variable. My function is: getObjName(objId){ var objName =""; $.ajax( { type : "GET", url : "Object", dataType: 'json', data : "objId="+objId, success : function(data) { objName = data; } }); return objName; } I am trying to call it and assign it to a variable with: var objName = getObjName(objId); However Eclipse is telling me that "the function getObjName(any) is undefined"

    Read the article

  • Postgres Stored procedure using iBatis

    - by Om Yadav
    --- The error occurred while applying a parameter map. --- Check the newSubs-InlineParameterMap. --- Check the statement (query failed). --- Cause: org.postgresql.util.PSQLException: ERROR: wrong record type supplied in RETURN NEXT Where: PL/pgSQL function "getnewsubs" line 34 at return next the function detail is as below.... CREATE OR REPLACE FUNCTION getnewsubs(timestamp without time zone, timestamp without time zone, integer) RETURNS SETOF record AS $BODY$declare v_fromdt alias for $1; v_todt alias for $2; v_domno alias for $3; v_cursor refcursor; v_rec record; v_cpno bigint; v_actno int; v_actname varchar(50); v_actid varchar(100); v_cpntypeid varchar(100); v_mrp double precision; v_domname varchar(100); v_usedt timestamp without time zone; v_expirydt timestamp without time zone; v_createdt timestamp without time zone; v_ctno int; v_phone varchar; begin open v_cursor for select cpno,c.actno,usedt from cpnusage c inner join account s on s.actno=c.actno where usedt = $1 and usedt < $2 and validdomstat(s.domno,v_domno) order by c.usedt; fetch v_cursor into v_cpno,v_actno,v_usedt; while found loop if isactivation(v_cpno,v_actno,v_usedt) IS TRUE then select into v_actno,v_actname,v_actid,v_cpntypeid,v_mrp,v_domname,v_ctno,v_cpno,v_usedt,v_expirydt,v_createdt,v_phone a.actno,a.actname as name,a.actid as actid,c.descr as cpntypeid,l.mrp as mrp,s.domname as domname,c.ctno as ctno,b.cpno,b.usedt,b.expirydt,d.createdt,a.phone from account a inner join cpnusage b on a.actno=b.actno inner join cpn d on b.cpno=d.cpno inner join cpntype c on d.ctno=c.ctno inner join ssgdom s on a.domno=s.domno left join price_class l ON l.price_class_id=b.price_class_id where validdomstat(a.domno,v_domno) and b.cpno=v_cpno and b.actno=v_actno; select into v_rec v_actno,v_actname,v_actid,v_cpntypeid,v_mrp,v_domname,v_ctno,v_cpno,v_usedt,v_expirydt,v_createdt,v_phone; return next v_rec; end if; fetch v_cursor into v_cpno,v_actno,v_usedt; end loop; return ; end;$BODY$ LANGUAGE 'plpgsql' VOLATILE; ALTER FUNCTION getnewsubs(timestamp without time zone, timestamp without time zone, integer) OWNER TO radius If i am running the function from the console it is running fine and giving me the correct response. But when using through java causing the above error. Can ay body help in it..Its very urgent. Please response as soon as possible. Thanks in advance.

    Read the article

  • Good style for handling constructor failure of critical object

    - by mtlphil
    I'm trying to decide between two ways of instantiating an object & handling any constructor exceptions for an object that is critical to my program, i.e. if construction fails the program can't continue. I have a class SimpleMIDIOut that wraps basic Win32 MIDI functions. It will open a MIDI device in the constructor and close it in the destructor. It will throw an exception inherited from std::exception in the constructor if the MIDI device cannot be opened. Which of the following ways of catching constructor exceptions for this object would be more in line with C++ best practices Method 1 - Stack allocated object, only in scope inside try block #include <iostream> #include "simplemidiout.h" int main() { try { SimpleMIDIOut myOut; //constructor will throw if MIDI device cannot be opened myOut.PlayNote(60,100); //..... //myOut goes out of scope outside this block //so basically the whole program has to be inside //this block. //On the plus side, it's on the stack so //destructor that handles object cleanup //is called automatically, more inline with RAII idiom? } catch(const std::exception& e) { std::cout << e.what() << std::endl; std::cin.ignore(); return 1; } std::cin.ignore(); return 0; } Method 2 - Pointer to object, heap allocated, nicer structured code? #include <iostream> #include "simplemidiout.h" int main() { SimpleMIDIOut *myOut; try { myOut = new SimpleMIDIOut(); } catch(const std::exception& e) { std::cout << e.what() << std::endl; delete myOut; return 1; } myOut->PlayNote(60,100); std::cin.ignore(); delete myOut; return 0; } I like the look of the code in Method 2 better, don't have to jam my whole program into a try block, but Method 1 creates the object on the stack so C++ manages the object's life time, which is more in tune with RAII philosophy isn't it? I'm still a novice at this so any feedback on the above is much appreciated. If there's an even better way to check for/handle constructor failure in a siatuation like this please let me know.

    Read the article

  • JNI on Android, how to pass int from c to java

    - by Joaquin
    I have a C function, I simply returns an integer, as follows: JNIEXPORT jint JNICALL Java_org_project_ScreenPosition(JNIEnv* env, jobject thiz){ int i=1; return i; } I call this function in the way of an Activity onCreateContextMenu Android, as follows: public void onCreateContextMenu(ContextMenu menu, View v, ContextMenuInfo menuInfo){ menu.setHeaderTitle("TryMenu"); int a=ScreenPosition(); return; } But all crash

    Read the article

  • A* algorithm works OK, but not perfectly. What's wrong?

    - by Bart van Heukelom
    This is my grid of nodes: I'm moving an object around on it using the A* pathfinding algorithm. It generally works OK, but it sometimes acts wrongly: When moving from 3 to 1, it correctly goes via 2. When going from 1 to 3 however, it goes via 4. When moving between 3 and 5, it goes via 4 in either direction instead of the shorter way via 6 What can be wrong? Here's my code (AS3): public static function getPath(from:Point, to:Point, grid:NodeGrid):PointLine { // get target node var target:NodeGridNode = grid.getClosestNodeObj(to.x, to.y); var backtrace:Map = new Map(); var openList:LinkedSet = new LinkedSet(); var closedList:LinkedSet = new LinkedSet(); // begin with first node openList.add(grid.getClosestNodeObj(from.x, from.y)); // start A* var curNode:NodeGridNode; while (openList.size != 0) { // pick a new current node if (openList.size == 1) { curNode = NodeGridNode(openList.first); } else { // find cheapest node in open list var minScore:Number = Number.MAX_VALUE; var minNext:NodeGridNode; openList.iterate(function(next:NodeGridNode, i:int):int { var score:Number = curNode.distanceTo(next) + next.distanceTo(target); if (score < minScore) { minScore = score; minNext = next; return LinkedSet.BREAK; } return 0; }); curNode = minNext; } // have not reached if (curNode == target) break; else { // move to closed openList.remove(curNode); closedList.add(curNode); // put connected nodes on open list for each (var adjNode:NodeGridNode in curNode.connects) { if (!openList.contains(adjNode) && !closedList.contains(adjNode)) { openList.add(adjNode); backtrace.put(adjNode, curNode); } } } } // make path var pathPoints:Vector.<Point> = new Vector.<Point>(); pathPoints.push(to); while(curNode != null) { pathPoints.unshift(curNode.location); curNode = backtrace.read(curNode); } pathPoints.unshift(from); return new PointLine(pathPoints); } NodeGridNode::distanceTo() public function distanceTo(o:NodeGridNode):Number { var dx:Number = location.x - o.location.x; var dy:Number = location.y - o.location.y; return Math.sqrt(dx*dx + dy*dy); }

    Read the article

  • Using MembershipCreateStatus in MVC

    - by Jemes
    How can I use the MembershipCreateStatus in my controller below to identify errors? My controller below creates a new user but I would like to catch any errors from CreateStatus and add the error to my modelstate. [HttpPost] public ActionResult CreateUser(user UserToCreate) { if (ModelState.IsValid) { // TODO: If the UserToCreate object is Valid we'll //Eventually want to save it in a database Membership.CreateUser(UserToCreate.Username, UserToCreate.Password, UserToCreate.Email); return Redirect("/"); } //Invalid - redisplay form with errors return View(UserToCreate); }

    Read the article

  • Python datetime to Unix timestamp

    - by Off Rhoden
    I have to create an "Expires" value 5 minutes in the future, but I have to supply it in UNIX Timestamp format. I have this so far, but it seems like a hack. def expires(): '''return a UNIX style timestamp representing 5 minutes from now''' epoch = datetime.datetime(1970, 1, 1) seconds_in_a_day = 60 * 60 * 24 five_minutes = datetime.timedelta(seconds=5*60) five_minutes_from_now = datetime.datetime.now() + five_minutes since_epoch = five_minutes_from_now - epoch return since_epoch.days * seconds_in_a_day + since_epoch.seconds Is there a module or function that does the timestamp conversion for me?

    Read the article

  • How to match multiple substrings in jQuery combobox autocomplete

    - by John R
    I found more than a couple examples of this with a plain jquery autocomplete but not in a way that will work with the autocomplete included in the combobox code from the demo because the structure of the code is structured so differently. I want to match every item that has all of the search tokens anywhere in any word. I don't need to match the start of any word, any part of it is fine. I don't care if the search strings are highlighted in the autocomplete list if that makes things too complicated. Desired search/result combos: (please excuse the spacing) "fi th" "fi rst second th ird" "rs on" "fi rs t sec on d third" "ec rd" "first s ec ond thi rd" but not limited to any max/min length or number of tokens. EDIT I figured part of it out using the code structure from the other autocorrect I had working. source: function( requestObj, responseFunc ) { var matchArry = $("select > option").map(function(){return this.innerHTML;}).get(); var srchTerms = $.trim(requestObj.term).split(/\s+/); // For each search term, remove non-matches $.each (srchTerms, function (J, term) { var regX = new RegExp (term, "i"); matchArry = $.map (matchArry, function (item) { if( regX.test(item) ){ return{ label: item, value: item, option: HTMLOptionElement } ? item :null; } } ); }); // Return the match results responseFunc (matchArry); }, and select: function( event, ui ) { ui.item.option.selected = true; self._trigger( "selected", event, { item: ui.item.option }); $("destination").val(ui.item.value); // I added this line }, but I can't get both multiple words AND being able to click to select working at the same time. If I remove the } ? item :null; on the return in the map function I can click to select an item. If I leave it I can type multiple words, but I can't click any of the items... Is that the problem or the option: this? I've tried replacing it with HTMLOptionElement and null and I'm stuck. I am able to set the value of another field with ui.item.value within the select label but that doesn't put the value in the search box or close the dropdown menu. Fiddle of current code: http://jsfiddle.net/eY3hM/

    Read the article

  • wcf message size causing permission issue

    - by Ferrell Carr
    silverlight 3.0 client wcf 3.0 VS.Net 2005 Web Site Win 2003 Server 50 column observable collection. return observable collection select top 975 * ... no problem return observable collection select * .... Issue On SL client after proxy.Get 50 col OC logon screen from win 2003 server pops up Mever makes it to the completed event.

    Read the article

  • Error in Print Function in Bubble Sort MIPS?

    - by m00nbeam360
    Sorry that this is such a long block of code, but do you see any obvious syntax errors in this? I feel like the problem is that the code isn't printing correctly since the sort and swap methods were from my textbook. Please help if you can! .data save: .word 1,2,4,2,5,6 size: .word 6 .text swap: sll $t1, $a1, 2 #shift bits by 2 add $t1, $a1, $t1 #set $t1 address to v[k] lw $t0, 0($t1) #load v[k] into t1 lw $t2, 4($t1) #load v[k+1] into t1 sw $t2, 0($t1) #swap addresses sw $t0, 4($t1) #swap addresses jr $ra #return sort: addi $sp, $sp, -20 #make enough room on the stack for five registers sw $ra, 16($sp) #save the return address on the stack sw $s3, 12($sp) #save $s3 on the stack sw $s2, 8($sp) #save Ss2 on the stack sw $s1, 4($sp) #save $s1 on the stack sw $s0, 0($sp) #save $s0 on the stack move $s2, $a0 #copy the parameter $a0 into $s2 (save $a0) move $s3, $a1 #copy the parameter $a1 into $s3 (save $a1) move $s0, $zero #start of for loop, i = 0 for1tst: slt $t0, $s0, $s3 #$t0 = 0 if $s0 S $s3 (i S n) beq $t0, $zero, exit1 #go to exit1 if $s0 S $s3 (i S n) addi $s1, $s0, -1 #j - i - 1 for2tst: slti $t0, $s1, 0 #$t0 = 1 if $s1 < 0 (j < 0) bne $t0, $zero, exit2 #$t0 = 1 if $s1 < 0 (j < 0) sll $t1, $s1, 2 #$t1 = j * 4 (shift by 2 bits) add $t2, $s2, $t1 #$t2 = v + (j*4) lw $t3, 0($t2) #$t3 = v[j] lw $t4, 4($t2) #$t4 = v[j+1] slt $t0, $t4, $t3 #$t0 = 0 if $t4 S $t3 beq $t0, $zero, exit2 #go to exit2 if $t4 S $t3 move $a0, $s2 #1st parameter of swap is v(old $a0) move $a1, $s1 #2nd parameter of swap is j jal swap #swap addi $s1, $s1, -1 j for2tst #jump to test of inner loop j print exit2: addi $s0, $s0, 1 #i = i + 1 j for1tst #jump to test of outer loop exit1: lw $s0, 0($sp) #restore $s0 from stack lw $s1, 4($sp) #resture $s1 from stack lw $s2, 8($sp) #restore $s2 from stack lw $s3, 12($sp) #restore $s3 from stack lw $ra, 16($sp) #restore $ra from stack addi $sp, $sp, 20 #restore stack pointer jr $ra #return to calling routine .data space:.asciiz " " # space to insert between numbers head: .asciiz "The sorted numbers are:\n" .text print:add $t0, $zero, $a0 # starting address of array add $t1, $zero, $a1 # initialize loop counter to array size la $a0, head # load address of print heading li $v0, 4 # specify Print String service syscall # print heading out: lw $a0, 0($t0) # load fibonacci number for syscall li $v0, 1 # specify Print Integer service syscall # print fibonacci number la $a0, space # load address of spacer for syscall li $v0, 4 # specify Print String service syscall # output string addi $t0, $t0, 4 # increment address addi $t1, $t1, -1 # decrement loop counter bgtz $t1, out # repeat if not finished jr $ra # return

    Read the article

  • javascript add prototype method to all functions?

    - by salmane
    Is there a way to add a method to all javascript functions without using the prototype library? something along the lines of : Function.prototype.methodName = function(){ return dowhateverto(this) }; this is what i tried so far but it didnt work. Perhaps it is a bad idea also if so could you please tell me why? if so can I add it to a set of functions i choose something like : MyFunctions.prototype.methodName = function(){ return dowhateverto(this) }; where MyFunctions is an array of function names thank you

    Read the article

  • asp.net mvc How to test controllers correctly

    - by Simon G
    Hi, I'm having difficulty testing controllers. Original my controller for testing looked something like this: SomethingController CreateSomethingController() { var somethingData = FakeSomethingData.CreateFakeData(); var fakeRepository = FakeRepository.Create(); var controller = new SomethingController(fakeRepository); return controller; } This works fine for the majority of testing until I got the Request.IsAjaxRequest() part of code. So then I had to mock up the HttpContext and HttpRequestBase. So my code then changed to look like: public class FakeHttpContext : HttpContextBase { bool _isAjaxRequest; public FakeHttpContext( bool isAjaxRequest = false ) { _isAjaxRequest = isAjaxRequest; } public override HttpRequestBase Request { get { string ajaxRequestHeader = ""; if ( _isAjaxRequest ) ajaxRequestHeader = "XMLHttpRequest"; var request = new Mock<HttpRequestBase>(); request.SetupGet( x => x.Headers ).Returns( new WebHeaderCollection { {"X-Requested-With", ajaxRequestHeader} } ); request.SetupGet( x => x["X-Requested-With"] ).Returns( ajaxRequestHeader ); return request.Object; } } private IPrincipal _user; public override IPrincipal User { get { if ( _user == null ) { _user = new FakePrincipal(); } return _user; } set { _user = value; } } } SomethingController CreateSomethingController() { var somethingData = FakeSomethingData.CreateFakeData(); var fakeRepository = FakeRepository.Create(); var controller = new SomethingController(fakeRepository); ControllerContext controllerContext = new ControllerContext( new FakeHttpContext( isAjaxRequest ), new RouteData(), controller ); controller.ControllerContext = controllerContext; return controller; } Now its got to that stage in my controller where I call Url.Route and Url is null. So it looks like I need to start mocking up routes for my controller. I seem to be spending more time googling on how to fake/mock objects and then debugging to make sure my fakes are correct than actual writing the test code. Is there an easier way in to test a controller? I've looked at the TestControllerBuilder from MvcContrib which helps with some of the issues but doesn't seem to do everything. Is there anything else available that will do the job and will let me concentrate on writing the tests rather than writing mocks? Thanks

    Read the article

  • Why download popup window in browser not showing up when using JAX-RS v.s. standard servlet?

    - by masato-san
    When I try using standard servlet approach, in my browser the popup window shows up asking me whether to open .xls file or save it. I tried the exactly same code via JAX-RS and the browser popup won't show up somehow. Has anyone encounter this mystery? Standard servlet that works: package local.test.servlet; import java.io.IOException; import java.net.URL; import java.net.URLDecoder; import javax.servlet.ServletException; import javax.servlet.annotation.WebServlet; import javax.servlet.http.HttpServlet; import javax.servlet.http.HttpServletRequest; import javax.servlet.http.HttpServletResponse; import local.test.jaxrs.ExcellaTestResource; import org.apache.poi.ss.usermodel.Workbook; import org.bbreak.excella.core.BookData; import org.bbreak.excella.core.exception.ExportException; import org.bbreak.excella.reports.exporter.ExcelExporter; import org.bbreak.excella.reports.exporter.ReportBookExporter; import org.bbreak.excella.reports.model.ConvertConfiguration; import org.bbreak.excella.reports.model.ReportBook; import org.bbreak.excella.reports.model.ReportSheet; import org.bbreak.excella.reports.processor.ReportProcessor; @WebServlet(name="ExcelServlet", urlPatterns={"/ExcelServlet"}) public class ExcelServlet extends HttpServlet { @Override protected void doGet(HttpServletRequest request, HttpServletResponse response) throws ServletException, IOException { try { //C:\Users\m-takayashiki\.netbeans\6.9\config\GF3\domain1 // ================== ?????? ======================= URL templateFileUrl = ExcellaTestResource.class.getResource("?????????.xls"); // /C:/Users/m-takayashiki/Documents/NetBeansProjects/KogaAlpha/build/web/WEB-INF/classes/local/test/jaxrs/?????????.xls System.out.println(templateFileUrl.getPath()); String templateFilePath = URLDecoder.decode(templateFileUrl.getPath(), "UTF-8"); String outputFileDir = "MasatoExcelHorizontalOutput"; ReportProcessor reportProcessor = new ReportProcessor(); ReportBook outputBook = new ReportBook(templateFilePath, outputFileDir, ExcelExporter.FORMAT_TYPE); ReportSheet outputSheet = new ReportSheet("??????"); outputBook.addReportSheet(outputSheet); // ======================================================== // --------------- ?????? ------------------------- reportProcessor.addReportBookExporter(new OutputStreamExporter(response)); System.out.println("wtf???"); reportProcessor.process(outputBook); System.out.println("done!!"); } catch(Exception e) { System.out.println(e); } } //end doGet() @Override protected void doPost(HttpServletRequest request, HttpServletResponse response) throws ServletException, IOException { } }//end class class OutputStreamExporter extends ReportBookExporter { private HttpServletResponse response; public OutputStreamExporter(HttpServletResponse response) { this.response = response; } @Override public String getExtention() { return null; } @Override public String getFormatType() { return ExcelExporter.FORMAT_TYPE; } @Override public void output(Workbook book, BookData bookdata, ConvertConfiguration configuration) throws ExportException { System.out.println(book.getFirstVisibleTab()); System.out.println(book.getSheetName(0)); //TODO write to stream try { response.setContentType("application/vnd.ms-excel"); response.setHeader("Content-Disposition", "attachment; filename=masatoExample.xls"); book.write(response.getOutputStream()); response.getOutputStream().close(); System.out.println("booya!!"); } catch(Exception e) { System.out.println(e); } } }//end class JAX-RS way that won't display popup: package local.test.jaxrs; import java.net.URL; import java.net.URLDecoder; import javax.servlet.ServletOutputStream; import javax.servlet.http.HttpServletRequest; import javax.servlet.http.HttpServletResponse; import javax.ws.rs.core.Context; import javax.ws.rs.core.UriInfo; import javax.ws.rs.Path; import javax.ws.rs.GET; import javax.ws.rs.Produces; import org.apache.poi.ss.usermodel.Workbook; import org.bbreak.excella.core.BookData; import org.bbreak.excella.core.exception.ExportException; import org.bbreak.excella.reports.exporter.ExcelExporter; import org.bbreak.excella.reports.exporter.ReportBookExporter; import org.bbreak.excella.reports.model.ConvertConfiguration; import org.bbreak.excella.reports.model.ReportBook; import org.bbreak.excella.reports.model.ReportSheet; import org.bbreak.excella.reports.processor.ReportProcessor; @Path("excellaTest") public class ExcellaTestResource { @Context private UriInfo context; @Context private HttpServletResponse response; @Context private HttpServletRequest request; public ExcellaTestResource() { } @Path("horizontalProcess") @GET //@Produces("application/vnd.ms-excel") @Produces("application/vnd.ms-excel") public void getProcessHorizontally() { try { //C:\Users\m-takayashiki\.netbeans\6.9\config\GF3\domain1 // ================== ?????? ======================= URL templateFileUrl = this.getClass().getResource("?????????.xls"); // /C:/Users/m-takayashiki/Documents/NetBeansProjects/KogaAlpha/build/web/WEB-INF/classes/local/test/jaxrs/?????????.xls System.out.println(templateFileUrl.getPath()); String templateFilePath = URLDecoder.decode(templateFileUrl.getPath(), "UTF-8"); String outputFileDir = "MasatoExcelHorizontalOutput"; ReportProcessor reportProcessor = new ReportProcessor(); ReportBook outputBook = new ReportBook(templateFilePath, outputFileDir, ExcelExporter.FORMAT_TYPE); ReportSheet outputSheet = new ReportSheet("??????"); outputBook.addReportSheet(outputSheet); // ======================================================== // --------------- ?????? ------------------------- reportProcessor.addReportBookExporter(new OutputStreamExporter(response)); System.out.println("wtf???"); reportProcessor.process(outputBook); System.out.println("done!!"); } catch(Exception e) { System.out.println(e); } //return response; return; } }//end class class OutputStreamExporter extends ReportBookExporter { private HttpServletResponse response; public OutputStreamExporter(HttpServletResponse response) { this.response = response; } @Override public String getExtention() { return null; } @Override public String getFormatType() { return ExcelExporter.FORMAT_TYPE; } @Override public void output(Workbook book, BookData bookdata, ConvertConfiguration configuration) throws ExportException { //TODO write to stream try { response.setContentType("application/vnd.ms-excel"); response.setHeader("Content-Disposition", "attachment; filename=masatoExample.xls"); book.write(response.getOutputStream()); response.getOutputStream().close(); System.out.println("booya!!"); } catch(Exception e) { System.out.println(e); } } }//end class

    Read the article

  • Cannot get xmlhttprequest.responseText from JQuery

    - by Felix Guerrero
    Hi. I got this function function verify_at_bd(){ var u = "foo"; var p = "bar"; return $.post('auth.php', { name: u, password: p, mobile: '' }, function(result){ return result; },'json'); } If I do a console.log(verify_at_bd()) I'm getting an xmlhttprequest but cannot access to responseText property. I'm using header("Content-Type: application/json") into my PHP. I'm using firefox 3.6 on OS X.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • how to make my method running on the template of google-app-engine..

    - by zjm1126
    the model is : class someModel(db.Model): name = db.StringProperty() def name_is_sss(self): return self.name=='sss' the view is : a=someModel() a.name='sss' path = os.path.join(os.path.dirname(__file__), os.path.join('templates', 'blog/a.html')) self.response.out.write(template.render(path, {'a':a})) and the html is : {{ a.name_is_sss }} the page shows : True so i want to make it more useful, and like this: the model: class someModel(db.Model): name = db.StringProperty() def name_is_x(self,x): return self.name==x the html is : {% a.name_is_x 'www'%} or {{ a.name_is_x 'www'}} but the error is : TemplateSyntaxError: Invalid block tag: 'a.name_is_x' or TemplateSyntaxError: Could not parse the remainder: 'www' so how to make my method running thanks

    Read the article

  • How to stop looking in a database after X rows are found?

    - by morningface
    I have a query to a database that returns a number X of results. I am looking to return a maximum of 10 results. Is there a way to do this without using LIMIT 0,9? I'll use LIMIT if I have to, but I'd rather use something else that will literally stop the searching, rather than look at all rows and then only return the top 10.

    Read the article

  • Set primary key with two integers

    - by user299196
    I have a table with primary key (ColumnA, ColumnB). I want to make a function or procedure that when passed two integers will insert a row into the table but make sure the largest integer always goes into ColumnA and the smaller one into ColumnB. So if we have SetKeysWithTheseNumbers(17, 19) would return |-----------------| |ColumnA | ColumnB| |-----------------| |19 | 17 | |-----------------| SetKeysWithTheseNumbers(19, 17) would return the same thing |-----------------| |ColumnA | ColumnB| |-----------------| |19 | 17 | |-----------------|

    Read the article

  • Autofac wiring question - beginner

    - by user645788
    Beginners question: Given two classes: Myclass5 and Myclass6 how can one wire up following factory method (returned as Func) such that myclass5 and myclass6 instances and IMyClass that they depend on are all retrieved via autofac (assuming that these three instances are registered). public static MyClass4 FactoryMethod(int nu) { if (nu == 1) return new MyClass5(....); if (nu == 4) return new MyClass6(....); throw new NotImplementedException(); } public abstract class MyClass4 { } public class MyClass5 : MyClass4 { public MyClass5(int nu, IMyClass a) { } } public class MyClass6 : MyClass4 { public MyClass6(int nu, IMyClass a) { } }

    Read the article

  • WPF Reusing Xaml Effectively

    - by Steve
    Hi, I've recently been working on a project using WPF to produce a diagram. In this I must show text alongside symbols that illustrate information associated with the text. To draw the symbols I initially used some png images I had produced. Within my diagram these images appeared blurry and only looked worse when zoomed in on. To improve on this I decided I would use a vector rather than a rastor image format. Below is the method I used to get the rastor image from a file path: protected Image GetSymbolImage(string symbolPath, int symbolHeight) { Image symbol = new Image(); symbol.Height = symbolHeight; BitmapImage bitmapImage = new BitmapImage(); bitmapImage.BeginInit(); bitmapImage.UriSource = new Uri(symbolPath); bitmapImage.DecodePixelHeight = symbolHeight; bitmapImage.EndInit(); symbol.Source = bitmapImage; return symbol; } Unfortunately this does not recognise vector image formats. So instead I used a method like the following, where "path" is the file path to a vector image of the format .xaml: public static Canvas LoadXamlCanvas(string path) { //if a file exists at the specified path if (File.Exists(path)) { //store the text in the file string text = File.ReadAllText(path); //produce a canvas from the text StringReader stringReader = new StringReader(text); XmlReader xmlReader = XmlReader.Create(stringReader); Canvas c = (Canvas)XamlReader.Load(xmlReader); //return the canvas return c; } return null; } This worked but drastically killed performance when called repeatedly. I found the logic necessary for text to canvas conversion (see above) was the main cause of the performance problem therefore embedding the .xaml images would not alone resolve the performance issue. I tried using this method only on the initial load of my application and storing the resulting canvases in a dictionary that could later be accessed much quicker but I later realised when using the canvases within the dictionary I would have to make copies of them. All the logic I found online associated with making copies used a XamlWriter and XamlReader which would again just introduce a performance problem. The solution I used was to copy the contents of each .xaml image into its own user control and then make use of these user controls where appropriate. This means I now display vector graphics and performance is much better. However this solution to me seems pretty clumsy. I'm new to WPF and wonder if there is some built in way of storing and reusing xaml throughout an application? Apologies for the length of this question. I thought having a record of my attempts might help someone with any similar problem. Thanks.

    Read the article

  • Performing non-blocking requests? - Django

    - by RadiantHex
    Hi folks, I have been playing with other frameworks, such as NodeJS, lately. I love the possibility to return a response, and still being able to do further operations. e.g. def view(request): do_something() return HttpResponse() do_more_stuff() #not possible!!! Maybe Django already offers a way to perform operations after returning a request, if that is the case that would be great. Help would be very much appreciated! =D

    Read the article

  • Locating file path from a <InMemoryUploadedFile> Djnago object

    - by PirosB3
    Hi all I have a Django app which, submitting a package, should return values that are inside it.. Submitted the form to a view called "insert": request.FILES['file'] returns the file objects, but it is of kind < InMemoryUploadedFile. What i need is a way to get the absolute path of the uploaded file, so that i can feed it to a method that will return the values needed Anyone know how i can accomplish this? Thanks

    Read the article

  • Memory management with Objective-C Distributed Objects: my temporary instances live forever!

    - by jkp
    I'm playing with Objective-C Distributed Objects and I'm having some problems understanding how memory management works under the system. The example given below illustrates my problem: Protocol.h #import <Foundation/Foundation.h> @protocol DOServer - (byref id)createTarget; @end Server.m #import <Foundation/Foundation.h> #import "Protocol.h" @interface DOTarget : NSObject @end @interface DOServer : NSObject < DOServer > @end @implementation DOTarget - (id)init { if ((self = [super init])) { NSLog(@"Target created"); } return self; } - (void)dealloc { NSLog(@"Target destroyed"); [super dealloc]; } @end @implementation DOServer - (byref id)createTarget { return [[[DOTarget alloc] init] autorelease]; } @end int main() { NSAutoreleasePool *pool = [[NSAutoreleasePool alloc] init]; DOServer *server = [[DOServer alloc] init]; NSConnection *connection = [[NSConnection new] autorelease]; [connection setRootObject:server]; if ([connection registerName:@"test-server"] == NO) { NSLog(@"Failed to vend server object"); } else [[NSRunLoop currentRunLoop] run]; [pool drain]; return 0; } Client.m #import <Foundation/Foundation.h> #import "Protocol.h" int main() { unsigned i = 0; for (; i < 3; i ++) { NSAutoreleasePool *pool = [[NSAutoreleasePool alloc] init]; id server = [NSConnection rootProxyForConnectionWithRegisteredName:@"test-server" host:nil]; [server setProtocolForProxy:@protocol(DOServer)]; NSLog(@"Created target: %@", [server createTarget]); [[NSRunLoop currentRunLoop] runUntilDate:[NSDate dateWithTimeIntervalSinceNow:1.0]]; [pool drain]; } return 0; } The issue is that any remote objects created by the root proxy are not released when their proxy counterparts in the client go out of scope. According to the documentation: When an object’s remote proxy is deallocated, a message is sent back to the receiver to notify it that the local object is no longer shared over the connection. I would therefore expect that as each DOTarget goes out of scope (each time around the loop) it's remote counterpart would be dellocated, since there is no other reference to it being held on the remote side of the connection. In reality this does not happen: the temporary objects are only deallocate when the client application quits, or more accurately, when the connection is invalidated. I can force the temporary objects on the remote side to be deallocated by explicitly invalidating the NSConnection object I'm using each time around the loop and creating a new one but somehow this just feels wrong. Is this the correct behaviour from DO? Should all temporary objects live as long as the connection that created them? Are connections therefore to be treated as temporary objects which should be opened and closed with each series of requests against the server? Any insights would be appreciated.

    Read the article

< Previous Page | 263 264 265 266 267 268 269 270 271 272 273 274  | Next Page >