Search Results

Search found 17501 results on 701 pages for 'stored functions'.

Page 270/701 | < Previous Page | 266 267 268 269 270 271 272 273 274 275 276 277  | Next Page >

  • Function pointers with default parameters in C++

    - by user308926
    How does C++ handle function pointers in relation to functions with defaulted parameters? If I have: void foo(int i, float f = 0.0f); void bar(int i, float f); void (*func_ptr1)(int); void (*func_ptr2)(int, float); void (*func_ptr3)(int, float = 10.0f); Which function pointers can I use in relation to which function?

    Read the article

  • PHP CSV upload files

    - by Anand
    hi, I have asked a question regarding updating a csv file's contents to the db @Question Now I want to add this functionality, like my db will contain url to images that are stored on a prespecified folder on the server. The csv files will contain the urls as to where these images reside on the client side. Now when I click an upload the following should happen My file must read the location of image on the client side Must copy the image from the client to the server's prespecified folder update the corresponding field in the db table with the url of the image

    Read the article

  • C#: What is the best collection class to store very similar string items for efficient serialization

    - by Gregor
    Hi, I would like to store a list of entityIDs of outlook emails to a file. The entityIDs are strings like: "000000005F776F08B736B442BCF7B6A7060B509A64002000" "000000005F776F08B736B442BCF7B6A7060B509A84002000" "000000005F776F08B736B442BCF7B6A7060B509AA4002000" as you can notice, the strings are very similar. I would like to save these strings in a collection class that would be stored as efficiently as possible when I serialize it to a file. Do you know of any collection class that could be used for this? Thank you in advance for any information... Gregor

    Read the article

  • How do I subvert computer idle detection on Windows?

    - by sharptooth
    In order to detect user absence GetLastInputInfo() can be used. I want to make GetLastInputInfo() return that I've just used keyboard/mouse all the time - as I've been actively using the computer so that whoever relies on GetLastInputInfo() thinks I'm actively using the computer. Can I use any Windows API functions to achieve that?

    Read the article

  • missing .cs files in precompiled website with c# in asp.net

    - by Greg
    Hi, I need to change the code of some asp.net application but the application is missing its .cs files, there are only .aspx files. As I read in google, I understand that the application is a precompiled website. I am not too familiar with it so the question is, can I somehow retrieve the code-behind .cs files of this application because I need to change some functions there. Surely there is a way I can access them or retrieve them somehow? Thanks in advance, Greg

    Read the article

  • GCD function in matlab

    - by SalemFayad
    hi, i am looking for a way to implement the "gcd" function used in matlab in another language but i really cant understand the way it functions. it says in http://www.mathworks.com/access/helpdesk/help/techdoc/ref/gcd.html that: "[G,C,D] = gcd(A,B) returns both the greatest common divisor array G, and the arrays C and D, which satisfy the equation: A(i).*C(i) + B(i).*D(i) = G(i)." but it says nothing about how it calculates C and D. i would be grateful if someone has a clearer idea about this subject! thanks:)

    Read the article

  • Error using `loess.smooth` but not `loess` or `lowess`

    - by Sandy
    I need to smooth some simulated data, but occasionally run into problems when the simulated ordinates to be smoothed are mostly the same value. Here is a small reproducible example of the simplest case. > x <- 0:50 > y <- rep(0,51) > loess.smooth(x,y) Error in simpleLoess(y, x, w, span, degree, FALSE, FALSE, normalize = FALSE, : NA/NaN/Inf in foreign function call (arg 1) loess(y~x), lowess(x,y), and their analogue in MATLAB produce the expected results without error on this example. I am using loess.smooth here because I need the estimates evaluated at a set number of points. According to the documentation, I believe loess.smooth and loess are using the same estimation functions, but the former is an "auxiliary function" to handle the evaluation points. The error seems to come from a C function: > traceback() 3: .C(R_loess_raw, as.double(pseudovalues), as.double(x), as.double(weights), as.double(weights), as.integer(D), as.integer(N), as.double(span), as.integer(degree), as.integer(nonparametric), as.integer(order.drop.sqr), as.integer(sum.drop.sqr), as.double(span * cell), as.character(surf.stat), temp = double(N), parameter = integer(7), a = integer(max.kd), xi = double(max.kd), vert = double(2 * D), vval = double((D + 1) * max.kd), diagonal = double(N), trL = double(1), delta1 = double(1), delta2 = double(1), as.integer(0L)) 2: simpleLoess(y, x, w, span, degree, FALSE, FALSE, normalize = FALSE, "none", "interpolate", control$cell, iterations, control$trace.hat) 1: loess.smooth(x, y) loess also calls simpleLoess, but with what appears to be different arguments. Of course, if you vary enough of the y values to be nonzero, loess.smooth runs without error, but I need the program to run in even the most extreme case. Hopefully, someone can help me with one and/or all of the following: Understand why only loess.smooth, and not the other functions, produces this error and find a solution for this problem. Find a work-around using loess but still evaluating the estimate at a specified number of points that can differ from the vector x. For example, I might want to use only x <- seq(0,50,10) in the smoothing, but evaluate the estimate at x <- 0:50. As far as I know, using predict with a new data frame will not properly handle this situation, but please let me know if I am missing something there. Handle the error in a way that doesn't stop the program from moving onto the next simulated data set. Thanks in advance for any help on this problem.

    Read the article

  • C# Image HttpHandler: Disable cookies in handler (YSlow / Google PageSpeed)

    - by user319111
    Hi. I have a HttpHandler for resizing images, round corners, reflection etc etc. This i working OK. The problem i have is, that some data is stored in cookies, and the cookies are send to images, when they are shown. Is there any way to disable this globally (cookie-free requests) in web.config, or even in the HttpHandler itself? Example page: http://test.roob.dk/dk/product/ray-ban-rb3359-polarized-16/ Thanks in advance CP // Denmark

    Read the article

  • Get sum of two columns in one LINQ query

    - by Axarydax
    Hi, let's say that I have a table called Items (ID int, Done int, Total int) I can do it by two queries: int total = m.Items.Sum(p=>p.Total) int done = m.Items.Sum(p=>p.Done) But I'd like to do it in one query, something like this: var x = from p in m.Items select new { Sum(p.Total), Sum(p.Done)}; Surely there is a way to call aggregate functions from LINQ syntax...?

    Read the article

  • What's a good library for parsing mathematical expressions in java?

    - by CSharperWithJava
    I'm an Android Developer and as part of my next app I will need to evaluate a large variety of user created mathematical expressions and equations. I am looking for a good java library that is lightweight and can evaluate mathematical expressions using user defined variables and constants, trig and exponential functions, etc. I've looked around and Jep seems to be popular, but I would like to hear more suggestions, especially from people who have used these libraries before.

    Read the article

  • How does a hash table work?

    - by Arec Barrwin
    I'm looking for an explanation of how a hashtable works - in plain English for a simpleton like me! For example I know it takes the key, calculates the hash (how?) and then performs some kind of modulo to work out where it lies in the array that the value is stored, but that's where my knowledge stops. Could anyone clarify the process. Edit: I'm not looking specifically about how hashcodes are calculated, but a general overview of how a hashtable works.

    Read the article

  • Gridview - Is it necessary to grab data from database every time a filter, sort, or paging event occ

    - by hamlin11
    Regarding gridviews that are not bound to a Data Source Control: In most GridView tutorials that I have seen, when just about any GridView event occurs, the end of the event handler will include BindDataGrid(). In some form, these BindDataGrid() functions 1) Grab data from the database 2) Assign any Filter or Sort expressions to the data, and 3) Bind the gridview to that data source (usually a DataView or DataTable. Is there a better way to provide filterable & sortable data to a GridView without having to hit the database so often? Thanks

    Read the article

  • How to start on programming?

    - by Stustu
    At an old age I decided to start programming. I'm fascinated with graphics and web development. I understand general concepts of programming, like loops, functions etc. Which is the language to learn? How to start?

    Read the article

  • Compiling linux sources in Windows enviroment

    - by Betamoo
    I got a source for console program written in c++ for linux I have got no experience with linux, and have no intend to install it. Is there a (automated) way to compile this source to run in windows? and what about linux functions and libraries called in this file? Thanks

    Read the article

  • Reading Resource Files from my own APK in Android Native Environment

    - by Kyle
    I'm porting to Android. My existing project has a ton of resource files that I'm porting into my Android project. I have them all in /res/raw/, and I would like to access those resources in my native library with functions such as fopen() and such. Can this be done, or do I have to go through JNI for this as well? I would really prefer not to, for ease of porting and possible speed and memory reasons.

    Read the article

  • loading multiple line query in one row

    - by bharath
    Hi, How to load a multiple line query in one row using mysql.The data is stored in a text file. For example: "GGAGTTGTGGGAGTGGAGGAGGAAGAGGCGGTGGGGAGTACGGGGGCTGGTCCCAGAAGATGGCGGAGGC GGGGGATTTCTGGTAGGTCCTACTTTAGGACAAGATGTGGTGGTACTGTTGAAGCGTCAGTCTTTGATTC" Thanks in advance.

    Read the article

  • Securing S3 via your own application

    - by Neil Middleton
    Imagine the following use case: You have a basecamp style application hosting files with S3. Accounts all have their own files, but stored on S3. How, therefore, would a developer go about securing files so users of account 1, couldn't somehow get to files of account 2? We're talking Rails if that's a help.

    Read the article

  • Basic social network functionality

    - by Dimitar Vouldjeff
    Hi, I'm going to develop a social like network using Ruby on Rails. For this app I need basic social functionality like friends, activities, authentication, user profile, facebook connect, comments. I searched for rails plugins with social functions and i found - tog and community engine. So which is better and more easier to extend? Thanks

    Read the article

  • jquery getting post action url

    - by bandhunt
    I'm trying to access the post target action in a jquery function. example: <form action="/page/users" id="signup" method="post"> I'd like to access the "action" part - "/page/users" in this case. $('#signup').live("submit", function(event) { // get this submitted action } Seems like I'm missing something very simple. I see the value in the dom but don't know where it's stored in jquery. Thanks!

    Read the article

  • Python - How to pickle yourself?

    - by Mark
    I want my class to implement Save and Load functions which simply do a pickle of the class. But apparently you cannot use 'self' in the fashion below. How can you do this? self = cPickle.load(f) cPickle.dump(self,f,2)

    Read the article

< Previous Page | 266 267 268 269 270 271 272 273 274 275 276 277  | Next Page >