Search Results

Search found 17501 results on 701 pages for 'stored functions'.

Page 270/701 | < Previous Page | 266 267 268 269 270 271 272 273 274 275 276 277  | Next Page >

  • C# Image HttpHandler: Disable cookies in handler (YSlow / Google PageSpeed)

    - by user319111
    Hi. I have a HttpHandler for resizing images, round corners, reflection etc etc. This i working OK. The problem i have is, that some data is stored in cookies, and the cookies are send to images, when they are shown. Is there any way to disable this globally (cookie-free requests) in web.config, or even in the HttpHandler itself? Example page: http://test.roob.dk/dk/product/ray-ban-rb3359-polarized-16/ Thanks in advance CP // Denmark

    Read the article

  • Get sum of two columns in one LINQ query

    - by Axarydax
    Hi, let's say that I have a table called Items (ID int, Done int, Total int) I can do it by two queries: int total = m.Items.Sum(p=>p.Total) int done = m.Items.Sum(p=>p.Done) But I'd like to do it in one query, something like this: var x = from p in m.Items select new { Sum(p.Total), Sum(p.Done)}; Surely there is a way to call aggregate functions from LINQ syntax...?

    Read the article

  • Retrieve data using Dynamic Query and Linq to SQL

    - by GigaPr
    Hi I have a really complicated dynamic query that i want to use to retrieve data from the database I am working in .net 3.5 sql server 2008 i created a stored procedure that accepts a varchar(max) as input parameter and does execute (@SqlQuery) it executes but does not return anything I really would like to use LINQ as all my project is implemented using linq Any Idea how to do it what is the problem?

    Read the article

  • How to add entity object to adequate entity set with object context in EF?

    - by Levelbit
    I have a problem when I add an entity object with ObjectContext.AddObject method because I can't retrieve that object with LINQ querying my ObjectContext.Person entities. I know that this new added object is stored somewhere, because it is used to update database after SaveChanges method. That's bothers me because I want to update my datagrid DataContext without saving changes unless I really want to do it. It doesn't help if I add the same object to DataContext list myself directly.

    Read the article

  • Regex Query to get string value

    - by Alex
    Hi all, I am looking for a regex query that would allow me to retrieve a value from a string here are examples of my string: home.aspx?StudyID=0020101&aa=72 randompage.aspx?studyid=3023603&aa=40 myconfig.aspx?studyid=0021600&aa=40 I need to get the numerical value of the 'studyid' variable, please note that the name of the page will change so simply doing the substring and counting char spaces didn't work I unfortunately cannot use request.querystring method as this string is stored in the database and a select statement will be used for running this regex query Thanks

    Read the article

  • What's a good library for parsing mathematical expressions in java?

    - by CSharperWithJava
    I'm an Android Developer and as part of my next app I will need to evaluate a large variety of user created mathematical expressions and equations. I am looking for a good java library that is lightweight and can evaluate mathematical expressions using user defined variables and constants, trig and exponential functions, etc. I've looked around and Jep seems to be popular, but I would like to hear more suggestions, especially from people who have used these libraries before.

    Read the article

  • Gridview - Is it necessary to grab data from database every time a filter, sort, or paging event occ

    - by hamlin11
    Regarding gridviews that are not bound to a Data Source Control: In most GridView tutorials that I have seen, when just about any GridView event occurs, the end of the event handler will include BindDataGrid(). In some form, these BindDataGrid() functions 1) Grab data from the database 2) Assign any Filter or Sort expressions to the data, and 3) Bind the gridview to that data source (usually a DataView or DataTable. Is there a better way to provide filterable & sortable data to a GridView without having to hit the database so often? Thanks

    Read the article

  • How does a hash table work?

    - by Arec Barrwin
    I'm looking for an explanation of how a hashtable works - in plain English for a simpleton like me! For example I know it takes the key, calculates the hash (how?) and then performs some kind of modulo to work out where it lies in the array that the value is stored, but that's where my knowledge stops. Could anyone clarify the process. Edit: I'm not looking specifically about how hashcodes are calculated, but a general overview of how a hashtable works.

    Read the article

  • Basic social network functionality

    - by Dimitar Vouldjeff
    Hi, I'm going to develop a social like network using Ruby on Rails. For this app I need basic social functionality like friends, activities, authentication, user profile, facebook connect, comments. I searched for rails plugins with social functions and i found - tog and community engine. So which is better and more easier to extend? Thanks

    Read the article

  • How To Automatically Script SQL Server: 'Generate Scripts' for SQL Database

    - by skimania
    I want to run scheduled nightly exports of my database code into my SVN source. It's easy to schedule automated check-in's into svn from a folder, but scheduling the export from SQL in SQL Management Studio is Right click target database, choose Tasks Generate Scripts. Follow the wizard and presto you've got scripts in a folder. Is it possible to extract a single script that the wizard generates, and stuff that into a stored proc which I can run nightly? Ideas?

    Read the article

  • Compiling linux sources in Windows enviroment

    - by Betamoo
    I got a source for console program written in c++ for linux I have got no experience with linux, and have no intend to install it. Is there a (automated) way to compile this source to run in windows? and what about linux functions and libraries called in this file? Thanks

    Read the article

  • How to start on programming?

    - by Stustu
    At an old age I decided to start programming. I'm fascinated with graphics and web development. I understand general concepts of programming, like loops, functions etc. Which is the language to learn? How to start?

    Read the article

  • loading multiple line query in one row

    - by bharath
    Hi, How to load a multiple line query in one row using mysql.The data is stored in a text file. For example: "GGAGTTGTGGGAGTGGAGGAGGAAGAGGCGGTGGGGAGTACGGGGGCTGGTCCCAGAAGATGGCGGAGGC GGGGGATTTCTGGTAGGTCCTACTTTAGGACAAGATGTGGTGGTACTGTTGAAGCGTCAGTCTTTGATTC" Thanks in advance.

    Read the article

  • Error using `loess.smooth` but not `loess` or `lowess`

    - by Sandy
    I need to smooth some simulated data, but occasionally run into problems when the simulated ordinates to be smoothed are mostly the same value. Here is a small reproducible example of the simplest case. > x <- 0:50 > y <- rep(0,51) > loess.smooth(x,y) Error in simpleLoess(y, x, w, span, degree, FALSE, FALSE, normalize = FALSE, : NA/NaN/Inf in foreign function call (arg 1) loess(y~x), lowess(x,y), and their analogue in MATLAB produce the expected results without error on this example. I am using loess.smooth here because I need the estimates evaluated at a set number of points. According to the documentation, I believe loess.smooth and loess are using the same estimation functions, but the former is an "auxiliary function" to handle the evaluation points. The error seems to come from a C function: > traceback() 3: .C(R_loess_raw, as.double(pseudovalues), as.double(x), as.double(weights), as.double(weights), as.integer(D), as.integer(N), as.double(span), as.integer(degree), as.integer(nonparametric), as.integer(order.drop.sqr), as.integer(sum.drop.sqr), as.double(span * cell), as.character(surf.stat), temp = double(N), parameter = integer(7), a = integer(max.kd), xi = double(max.kd), vert = double(2 * D), vval = double((D + 1) * max.kd), diagonal = double(N), trL = double(1), delta1 = double(1), delta2 = double(1), as.integer(0L)) 2: simpleLoess(y, x, w, span, degree, FALSE, FALSE, normalize = FALSE, "none", "interpolate", control$cell, iterations, control$trace.hat) 1: loess.smooth(x, y) loess also calls simpleLoess, but with what appears to be different arguments. Of course, if you vary enough of the y values to be nonzero, loess.smooth runs without error, but I need the program to run in even the most extreme case. Hopefully, someone can help me with one and/or all of the following: Understand why only loess.smooth, and not the other functions, produces this error and find a solution for this problem. Find a work-around using loess but still evaluating the estimate at a specified number of points that can differ from the vector x. For example, I might want to use only x <- seq(0,50,10) in the smoothing, but evaluate the estimate at x <- 0:50. As far as I know, using predict with a new data frame will not properly handle this situation, but please let me know if I am missing something there. Handle the error in a way that doesn't stop the program from moving onto the next simulated data set. Thanks in advance for any help on this problem.

    Read the article

  • store SID in a variable

    - by user361191
    Hi, I need a way to store the current user's SID in a variable, I tried a lot of variants of: setlocal enableextensions for /f "tokens=*" %%a in ( '"wmic path win32_useraccount where name='%UserName%' get sid"' ) do ( if not "%%a"=="" set myvar=%%a echo/%%myvar%%=%myvar% pause endlocal None are working wmic path win32_useraccount where name='%UserName%' get sid should be returning 3 lines, i need the second one stored in a variabel Can someone fix my script? edit btw; I am using a .cmd file

    Read the article

  • Securing S3 via your own application

    - by Neil Middleton
    Imagine the following use case: You have a basecamp style application hosting files with S3. Accounts all have their own files, but stored on S3. How, therefore, would a developer go about securing files so users of account 1, couldn't somehow get to files of account 2? We're talking Rails if that's a help.

    Read the article

  • outputting html in runtime in asp.net

    - by madness800
    Hi all, I'm building a website at the moment, I've some html fragment that is being stored into the database, I've been reading around that inserting HTML at runtime poses security risks by using the InnerHTML property of any html tag with runat server on it. So, my question is there any alternative way to safely display the html code and won't pose security risks and is it best to assume any textboxes on any given page is dangerous and process the text in the textboxes with Server.HtmlEncode before I store it to database? Cheers

    Read the article

  • Mysql - help me optimize this query

    - by sandeepan-nath
    About the system: -The system has a total of 8 tables - Users - Tutor_Details (Tutors are a type of User,Tutor_Details table is linked to Users) - learning_packs, (stores packs created by tutors) - learning_packs_tag_relations, (holds tag relations meant for search) - tutors_tag_relations and tags and orders (containing purchase details of tutor's packs), order_details linked to orders and tutor_details. For a more clear idea about the tables involved please check the The tables section in the end. -A tags based search approach is being followed.Tag relations are created when new tutors register and when tutors create packs (this makes tutors and packs searcheable). For details please check the section How tags work in this system? below. Following is a simpler representation (not the actual) of the more complex query which I am trying to optimize:- I have used statements like explanation of parts in the query select SUM(DISTINCT( t.tag LIKE "%Dictatorship%" )) as key_1_total_matches, SUM(DISTINCT( t.tag LIKE "%democracy%" )) as key_2_total_matches, td., u., count(distinct(od.id_od)), if (lp.id_lp > 0) then some conditional logic on lp fields else 0 as tutor_popularity from Tutor_Details AS td JOIN Users as u on u.id_user = td.id_user LEFT JOIN Learning_Packs_Tag_Relations AS lptagrels ON td.id_tutor = lptagrels.id_tutor LEFT JOIN Learning_Packs AS lp ON lptagrels.id_lp = lp.id_lp LEFT JOIN `some other tables on lp.id_lp - let's call learning pack tables set (including Learning_Packs table)` LEFT JOIN Order_Details as od on td.id_tutor = od.id_author LEFT JOIN Orders as o on od.id_order = o.id_order LEFT JOIN Tutors_Tag_Relations as ttagrels ON td.id_tutor = ttagrels.id_tutor JOIN Tags as t on (t.id_tag = ttagrels.id_tag) OR (t.id_tag = lptagrels.id_tag) where some condition on Users table's fields AND CASE WHEN ((t.id_tag = lptagrels.id_tag) AND (lp.id_lp 0)) THEN `some conditions on learning pack tables set` ELSE 1 END AND CASE WHEN ((t.id_tag = wtagrels.id_tag) AND (wc.id_wc 0)) THEN `some conditions on webclasses tables set` ELSE 1 END AND CASE WHEN (od.id_od0) THEN od.id_author = td.id_tutor and some conditions on Orders table's fields ELSE 1 END AND ( t.tag LIKE "%Dictatorship%" OR t.tag LIKE "%democracy%") group by td.id_tutor HAVING key_1_total_matches = 1 AND key_2_total_matches = 1 order by tutor_popularity desc, u.surname asc, u.name asc limit 0,20 ===================================================================== What does the above query do? Does AND logic search on the search keywords (2 in this example - "Democracy" and "Dictatorship"). Returns only those tutors for which both the keywords are present in the union of the two sets - tutors details and details of all the packs created by a tutor. To make things clear - Suppose a Tutor name "Sandeepan Nath" has created a pack "My first pack", then:- Searching "Sandeepan Nath" returns Sandeepan Nath. Searching "Sandeepan first" returns Sandeepan Nath. Searching "Sandeepan second" does not return Sandeepan Nath. ====================================================================================== The problem The results returned by the above query are correct (AND logic working as per expectation), but the time taken by the query on heavily loaded databases is like 25 seconds as against normal query timings of the order of 0.005 - 0.0002 seconds, which makes it totally unusable. It is possible that some of the delay is being caused because all the possible fields have not yet been indexed, but I would appreciate a better query as a solution, optimized as much as possible, displaying the same results ========================================================================================== How tags work in this system? When a tutor registers, tags are entered and tag relations are created with respect to tutor's details like name, surname etc. When a Tutors create packs, again tags are entered and tag relations are created with respect to pack's details like pack name, description etc. tag relations for tutors stored in tutors_tag_relations and those for packs stored in learning_packs_tag_relations. All individual tags are stored in tags table. ==================================================================== The tables Most of the following tables contain many other fields which I have omitted here. CREATE TABLE IF NOT EXISTS users ( id_user int(10) unsigned NOT NULL AUTO_INCREMENT, name varchar(100) NOT NULL DEFAULT '', surname varchar(155) NOT NULL DEFAULT '', PRIMARY KEY (id_user) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 AUTO_INCREMENT=636 ; CREATE TABLE IF NOT EXISTS tutor_details ( id_tutor int(10) NOT NULL AUTO_INCREMENT, id_user int(10) NOT NULL DEFAULT '0', PRIMARY KEY (id_tutor), KEY Users_FKIndex1 (id_user) ) ENGINE=InnoDB DEFAULT CHARSET=latin1 AUTO_INCREMENT=51 ; CREATE TABLE IF NOT EXISTS orders ( id_order int(10) unsigned NOT NULL AUTO_INCREMENT, PRIMARY KEY (id_order), KEY Orders_FKIndex1 (id_user), ) ENGINE=InnoDB DEFAULT CHARSET=utf8 AUTO_INCREMENT=275 ; ALTER TABLE orders ADD CONSTRAINT Orders_ibfk_1 FOREIGN KEY (id_user) REFERENCES users (id_user) ON DELETE NO ACTION ON UPDATE NO ACTION; CREATE TABLE IF NOT EXISTS order_details ( id_od int(10) unsigned NOT NULL AUTO_INCREMENT, id_order int(10) unsigned NOT NULL DEFAULT '0', id_author int(10) NOT NULL DEFAULT '0', PRIMARY KEY (id_od), KEY Order_Details_FKIndex1 (id_order) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 AUTO_INCREMENT=284 ; ALTER TABLE order_details ADD CONSTRAINT Order_Details_ibfk_1 FOREIGN KEY (id_order) REFERENCES orders (id_order) ON DELETE NO ACTION ON UPDATE NO ACTION; CREATE TABLE IF NOT EXISTS learning_packs ( id_lp int(10) unsigned NOT NULL AUTO_INCREMENT, id_author int(10) unsigned NOT NULL DEFAULT '0', PRIMARY KEY (id_lp), KEY Learning_Packs_FKIndex2 (id_author), KEY id_lp (id_lp) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 AUTO_INCREMENT=23 ; CREATE TABLE IF NOT EXISTS tags ( id_tag int(10) unsigned NOT NULL AUTO_INCREMENT, tag varchar(255) DEFAULT NULL, PRIMARY KEY (id_tag), UNIQUE KEY tag (tag), KEY id_tag (id_tag), KEY tag_2 (tag), KEY tag_3 (tag) ) ENGINE=InnoDB DEFAULT CHARSET=latin1 AUTO_INCREMENT=3419 ; CREATE TABLE IF NOT EXISTS tutors_tag_relations ( id_tag int(10) unsigned NOT NULL DEFAULT '0', id_tutor int(10) DEFAULT NULL, KEY Tutors_Tag_Relations (id_tag), KEY id_tutor (id_tutor), KEY id_tag (id_tag) ) ENGINE=InnoDB DEFAULT CHARSET=latin1; ALTER TABLE tutors_tag_relations ADD CONSTRAINT Tutors_Tag_Relations_ibfk_1 FOREIGN KEY (id_tag) REFERENCES tags (id_tag) ON DELETE NO ACTION ON UPDATE NO ACTION; CREATE TABLE IF NOT EXISTS learning_packs_tag_relations ( id_tag int(10) unsigned NOT NULL DEFAULT '0', id_tutor int(10) DEFAULT NULL, id_lp int(10) unsigned DEFAULT NULL, KEY Learning_Packs_Tag_Relations_FKIndex1 (id_tag), KEY id_lp (id_lp), KEY id_tag (id_tag) ) ENGINE=InnoDB DEFAULT CHARSET=latin1; ALTER TABLE learning_packs_tag_relations ADD CONSTRAINT Learning_Packs_Tag_Relations_ibfk_1 FOREIGN KEY (id_tag) REFERENCES tags (id_tag) ON DELETE NO ACTION ON UPDATE NO ACTION; =================================================================================== Following is the exact query (this includes classes also - tutors can create classes and search terms are matched with classes created by tutors):- select count(distinct(od.id_od)) as tutor_popularity, CASE WHEN (IF((wc.id_wc 0), ( wc.wc_api_status = 1 AND wc.wc_type = 0 AND wc.class_date '2010-06-01 22:00:56' AND wccp.status = 1 AND (wccp.country_code='IE' or wccp.country_code IN ('INT'))), 0)) THEN 1 ELSE 0 END as 'classes_published', CASE WHEN (IF((lp.id_lp 0), (lp.id_status = 1 AND lp.published = 1 AND lpcp.status = 1 AND (lpcp.country_code='IE' or lpcp.country_code IN ('INT'))),0)) THEN 1 ELSE 0 END as 'packs_published', td . * , u . * from Tutor_Details AS td JOIN Users as u on u.id_user = td.id_user LEFT JOIN Learning_Packs_Tag_Relations AS lptagrels ON td.id_tutor = lptagrels.id_tutor LEFT JOIN Learning_Packs AS lp ON lptagrels.id_lp = lp.id_lp LEFT JOIN Learning_Packs_Categories AS lpc ON lpc.id_lp_cat = lp.id_lp_cat LEFT JOIN Learning_Packs_Categories AS lpcp ON lpcp.id_lp_cat = lpc.id_parent LEFT JOIN Learning_Pack_Content as lpct on (lp.id_lp = lpct.id_lp) LEFT JOIN Webclasses_Tag_Relations AS wtagrels ON td.id_tutor = wtagrels.id_tutor LEFT JOIN WebClasses AS wc ON wtagrels.id_wc = wc.id_wc LEFT JOIN Learning_Packs_Categories AS wcc ON wcc.id_lp_cat = wc.id_wp_cat LEFT JOIN Learning_Packs_Categories AS wccp ON wccp.id_lp_cat = wcc.id_parent LEFT JOIN Order_Details as od on td.id_tutor = od.id_author LEFT JOIN Orders as o on od.id_order = o.id_order LEFT JOIN Tutors_Tag_Relations as ttagrels ON td.id_tutor = ttagrels.id_tutor JOIN Tags as t on (t.id_tag = ttagrels.id_tag) OR (t.id_tag = lptagrels.id_tag) OR (t.id_tag = wtagrels.id_tag) where (u.country='IE' or u.country IN ('INT')) AND CASE WHEN ((t.id_tag = lptagrels.id_tag) AND (lp.id_lp 0)) THEN lp.id_status = 1 AND lp.published = 1 AND lpcp.status = 1 AND (lpcp.country_code='IE' or lpcp.country_code IN ('INT')) ELSE 1 END AND CASE WHEN ((t.id_tag = wtagrels.id_tag) AND (wc.id_wc 0)) THEN wc.wc_api_status = 1 AND wc.wc_type = 0 AND wc.class_date '2010-06-01 22:00:56' AND wccp.status = 1 AND (wccp.country_code='IE' or wccp.country_code IN ('INT')) ELSE 1 END AND CASE WHEN (od.id_od0) THEN od.id_author = td.id_tutor and o.order_status = 'paid' and CASE WHEN (od.id_wc 0) THEN od.can_attend_class=1 ELSE 1 END ELSE 1 END AND 1 group by td.id_tutor order by tutor_popularity desc, u.surname asc, u.name asc limit 0,20 Please note - The provided database structure does not show all the fields and tables as in this query

    Read the article

< Previous Page | 266 267 268 269 270 271 272 273 274 275 276 277  | Next Page >