Search Results

Search found 17610 results on 705 pages for 'specific'.

Page 274/705 | < Previous Page | 270 271 272 273 274 275 276 277 278 279 280 281  | Next Page >

  • How can I monitor the rendering time in a browser?

    - by adpd
    I work on an internal corporate system that has a web front-end as one of its interfaces. The web front-end is served up using Tomcat. How can I monitor the rendering time of specific pages in a browser (IE6)? I would like to be able to record the results in a log file (separate log file or the Tomcat access log).

    Read the article

  • How do I generate a custom SID?

    - by Max Schmeling
    I need to generate custom SIDs for users in my web application for use with Microsoft AzMan. What is the best way to do this? What do I need to know before doing this? This is what I'm thinking, but I'm not sure if I'm missing something: S-1-9-1234-{user_id + 1000} S-{first revision}-{resource manager authority}-{domain (unique number for the specific app)}-{unique id for user} UPDATE: Changed to resource manager authority because of David Crawford's blog entry: http://blogs.msdn.com/dc995/archive/2006/08/23/715021.aspx

    Read the article

  • what is best way to store long term data in iphone Core Data or SQLLite?

    - by AmitSri
    Hi all, I am working on i-Phone app targeting 3.1.3 and later SDK. I want to know the best way to store user's long term data on i-phone without losing performance, consistency and security. I know, that i can use Core Data, PList and SQL-Lite for storing user specific data in custom formats.But, want to know which one is good to use without compromising app performance and scalability in near future. Thanks

    Read the article

  • IE6 and IE7 Input padding CSS

    - by Podlsk
    I have input boxes with a height of 25 pixels. In Firefox, Safari and IE8 automatically vertically align the text of it in the middle correctly. However in IE6 and IE7 the text is aligned to the top. How may I resolve this? Adding padding-top increased the total height of the input as I have explicitly declared its height. I don't wish to use browser specific CSS. Thanks.

    Read the article

  • JMS Topic message size

    - by jjoshi
    Our application uses a topic to push message to a small set of subscribers. what sort of things should i look for when modeling a jms message with respect to the size of the actual message to be pushed. Are there any known limits or is application server specific? Any best practices or suggestions on this topic (pun unintended)?

    Read the article

  • Specifying Language for a grammar

    - by darkie15
    Hi All, Is there any specific methodology followed to specify a language for given grammar ?? i.e. Is it necessary to run all the production rules given in a grammar to determine the language it represents? I don't have an example as such since the one I am working on is a homework question. Regards, darkie15

    Read the article

  • Android Screen Density Compatibility on 1.5

    - by fordays
    Hi, I'm getting ready to release my first application the marketplace. It's being written for devices running Android 1.5 and above, however there aren't any specific folders for the three different screen densities (I think those came around in 1.6). Should I make these folders myself? Where should I put image resources for the different densities and what should I put in my Manifest??

    Read the article

  • Running Maven Goals in CLI.

    - by Jeeyoung Kim
    Hello, I have a maven pom.xml file with multiple instances of a same goal defined (inside with different s). I'm wondering how I can run a specific goal via maven command line. I've tried mvn --help, but I couldn't find an entry regarding this.

    Read the article

  • How to programmatically cut/copy/get files to/from Windows clipboard in a systam standard compliand

    - by Ivan
    How to put a cut/copy reference to specific files and/or folders into Windows clipboard so that when I open standard Windows Explorer window, go to somewhere and press Ctrl+V - the files are pasted? If I copy or cut some files/folders in Windows Explorer, how do I get this info (full names and whether they were cut or copied) in my Program? I program in C#4, but other languages ways are also interesting to know.

    Read the article

  • django deployment apache

    - by Uszy Wieloryba
    I would like to create a python script, which will: Create a django project in the current directory. Fix settings.py, urls.py. Do syncdb Install new apache instance listening on specific port (command line argument), with WSGI configured to serve my project. I can't figure out how to do point 3. EDIT: Peter Rowell: I need the solution for both Linux and Windows I have root access This is a dedicated host Apache only

    Read the article

  • adjustment of footer in website

    - by Mayur
    Hi All, I m web designer and getting problem in adjustment of footer. I need footer should be fixed at specific height and it will get down if content incresed otherwise it will be at same position please help me .... Thanks Mayur

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Deploying patches and new versions.

    - by 0plus1
    I'm deveoping a big project, I have the dev folder (connected to a specific subdomain) then the "real" folder, the live one. When I'm ready to push patches or whole new versions I'm currently copying the files individually, is there a program that can help me do this task? Keep in mind that some files (the config one and the htacess) must never change in the live version. Thank you

    Read the article

  • Can this django query be improved?

    - by Hobhouse
    Given a model structure like this: class Book(models.Model): user = models.ForeignKey(User) class Readingdate(models.Model): book = models.ForeignKey(Book) date = models.DateField() One book may have several readingdates. How do I list books having at least one readingdate within a specific year? I can do this: from_date = datetime.date(2010,1,1) to_date = datetime.date(2010,12,31) book_ids = Readingdate.objects\ .filter(date__range=(from_date,to_date))\ .values_list('book_id', flat=True) books_read_2010 = Book.objects.filter(id__in=book_ids) Is it possible to do this with one queryset, or is this the best way?

    Read the article

< Previous Page | 270 271 272 273 274 275 276 277 278 279 280 281  | Next Page >