Search Results

Search found 42625 results on 1705 pages for 'function points'.

Page 277/1705 | < Previous Page | 273 274 275 276 277 278 279 280 281 282 283 284  | Next Page >

  • Which of these URL scenarios is best for big link menus? [seo /user friendly urls]

    - by Sam
    Hi folks, a question about urls... me and a good friend of mine are exploring the possibilities of either of the three scenarios for a website where each webpage has a menusystem with about 130 links.: SCENARIO 1 the pages menu system has SHORT non-descriptive hyperlinks as well as a SHORT canonical: <a href:"design">dutch design</a> the pages canonical url points to e.g.: "design" OR SCENARIO 2 the pages menu system has SHORT non-descriptive hyperlinks wwith LONG canonical urls: <a href="design">dutch design</a> the pages canonical url points to: dutch-design-crazy-yes-but-always-honest OR SCENARIO 3 the pages menu system has LONG descriptive hyperlinks with LONG canonical urls: <a href="dutch-design-crazy-yes-but-always-honest">dutch design</a> the pages canonical url points to: dutch-design-crazy-yes-but-always-honest Currently we have scenario 2... should we progress to scenario 3? All three work fine and point via RewriteMod to the same page which is fetched underwater. Now, my question is which of these is better in terms of: userfriendlyness (page loading times, full url visible in url bar or not) seo friendlyness (proper indexing due to the urls containing descriptive relevant tags) other concerns we forgot like possible penalties for so many words in link hrefs?? Thanks very much for your suggestions: much appreciated!

    Read the article

  • Moving 2d camera in the y direction

    - by Alex
    I'm developing a simple game for the iphone and am struggling to work out the best way for the camera to follow the main character. The following picture hightlights the three main components: There are 3 components to this: Circle - the main character Green line - terrain Black background The terrain is simply made from an array of points (approx 20 points per screen width). The terrain is moved in the x direction relative to the black background in order to keep the circle in its position shown. The distance to move the terrain is simply: movex = circle.position.x - terrain.position.x with a constant to fix the circle at some distance from the left of the screen. I am struggling to determine the best way to position the terrain in the y plane keep the focus in the character. I want to move the terrain in the y direction smoothly and not fix it to the position of the circle, so the circle can move in the y plane. If I take the same approach as the x positioning, the character is fixed at a point on the screen and the terrain moves. I could sample some terrain points either side of the character and produce an average, but in my implementation this was not smooth. I thought another approach might be to create a camera 'line' that is a smooth version of the terrain line and make the camerea follow this, but I'm not sure if this is the optimum solution. Any advice is much appreciated!

    Read the article

  • Characteristics, what's the inverse of (x*(x+1))/2? [closed]

    - by Valmond
    In my game you can spend points to upgrade characteristics. Each characteristic has a formula like: A) out = in : for one point spent, one pont gained (you spend 1 point on Force so your force goes from 5 to 6) B) out = last level (starting at 1) : so the first point spent earns you 1 point, the next point spent earns you an additional 2 and so on (+3,+4,+5...) C) The inverse of B) : You need to spend 1 point to earn one, then you need to spend 2 to earn another one and so on. I have already found the formula for calculating the actual level of B when points spent = x : charac = (x*(x+1))/2 But I'd like to know what the "reverse" version of B) (usable for C) is, ie. if I have spent x points, how many have I earned if 1 spent gives 1, 1+2=3 gives 2, 1+2+3=6 gives 3 and so on. I know I can just calculate the numbers but I'd like to have the formula because its neater and so that I can stick it in an excel sheet for example... Thanks! ps. I think I have nailed it down to something like charac = sqrt( x*m +k) but then I'm stuck doing number guessing for k and m and I feel I might be wrong anyway as I get close but never hits the spot.

    Read the article

  • Using Optical Flow in EmguCV

    - by Meko
    HI. I am trying to create simple touch game using EmguCV.Should I use optical flow to determine for interaction between images on screen and with my hand ,if changes of points somewhere on screen more than 100 where the image, it means my hand is over image? But how can I track this new points? I can draw on screen here the previous points and new points but It shows on my head more points then my hand and I can not track my hands movements. void Optical_Flow_Worker(object sender, EventArgs e) { { Input_Capture.SetCaptureProperty(Emgu.CV.CvEnum.CAP_PROP.CV_CAP_PROP_POS_FRAMES, ActualFrameNumber); ActualFrame = Input_Capture.QueryFrame(); ActualGrayFrame = ActualFrame.Convert<Gray, Byte>(); NextFrame = Input_Capture.QueryFrame(); NextGrayFrame = NextFrame.Convert<Gray, Byte>(); ActualFeature = ActualGrayFrame.GoodFeaturesToTrack(500, 0.01d, 0.01, 5); ActualGrayFrame.FindCornerSubPix(ActualFeature, new System.Drawing.Size(10, 10), new System.Drawing.Size(-1, -1), new MCvTermCriteria(20, 0.3d)); OpticalFlow.PyrLK(ActualGrayFrame, NextGrayFrame, ActualFeature[0], new System.Drawing.Size(10, 10), 3, new MCvTermCriteria(20, 0.03d), out NextFeature, out Status, out TrackError); OpticalFlowFrame = new Image<Bgr, Byte>(ActualFrame.Width, ActualFrame.Height); OpticalFlowFrame = NextFrame.Copy(); for (int i = 0; i < ActualFeature[0].Length; i++) DrawFlowVectors(i); ActualFrameNumber++; pictureBox1.Image = ActualFrame.Resize(320, 400).ToBitmap() ; pictureBox3.Image = OpticalFlowFrame.Resize(320, 400).ToBitmap(); } } private void DrawFlowVectors(int i) { System.Drawing.Point p = new Point(); System.Drawing.Point q = new Point(); p.X = (int)ActualFeature[0][i].X; p.Y = (int)ActualFeature[0][i].Y; q.X = (int)NextFeature[i].X; q.Y = (int)NextFeature[i].Y; p.X = (int)(q.X + 6 * Math.Cos(angle + Math.PI / 4)); p.Y = (int)(q.Y + 6 * Math.Sin(angle + Math.PI / 4)); p.X = (int)(q.X + 6 * Math.Cos(angle - Math.PI / 4)); p.Y = (int)(q.Y + 6 * Math.Sin(angle - Math.PI / 4)); OpticalFlowFrame.Draw(new Rectangle(q.X,q.Y,1,1), new Bgr(Color.Red), 1); OpticalFlowFrame.Draw(new Rectangle(p.X, p.Y, 1, 1), new Bgr(Color.Blue), 1); }

    Read the article

  • Neural Networks in C# using NeuronDotNet

    - by kingrichard2005
    Hello, I'm testing the NeuronDotNet library for a class assignment using C#. I have a very simple console application that I'm using to test some of the code snippets provided in the manual fro the library, the goal of the assignment is to teach the program how to distinguish between random points in a square which may or may not be within a circle that is also inside the square. So basically, which points inside the square are also inside the circle. Here is what I have so far: namespace _469_A7 { class Program { static void Main(string[] args) { //Initlaize the backpropogation network LinearLayer inputLayer = new LinearLayer(2); SigmoidLayer hiddenLayer = new SigmoidLayer(8); SigmoidLayer outputLayer = new SigmoidLayer(2); new BackpropagationConnector(inputLayer, hiddenLayer); new BackpropagationConnector(hiddenLayer, outputLayer); BackpropagationNetwork network = new BackpropagationNetwork(inputLayer, outputLayer); //Generate a training set for the ANN TrainingSet trainingSet = new TrainingSet(2, 2); //TEST: Generate random set of points and add to training set, //for testing purposes start with 10 samples; Point p; Program program = new Program(); //Used to access randdouble function Random rand = new Random(); for(int i = 0; i < 10; i++) { //These points will be within the circle radius Type A if(rand.NextDouble() > 0.5) { p = new Point(rand.NextDouble(), rand.NextDouble()); trainingSet.Add(new TrainingSample(new double[2] { p.getX(), p.getY() }, new double[2] { 1, 0 })); continue; } //These points will either be on the border or outside the circle Type B p = new Point(program.randdouble(1.0, 4.0), program.randdouble(1.0, 4.0)); trainingSet.Add(new TrainingSample(new double[2] { p.getX(), p.getY() }, new double[2] { 0, 1 })); } //Start network learning network.Learn(trainingSet, 100); //Stop network learning //network.StopLearning(); } //generates a psuedo-random double between min and max public double randdouble(double min, double max) { Random rand = new Random(); if (min > max) { return rand.NextDouble() * (min - max) + max; } else { return rand.NextDouble() * (max - min) + min; } } } //Class defines a point in X/Y coordinates public class Point { private double X; private double Y; public Point(double xVal, double yVal) { this.X = xVal; this.Y = yVal; } public double getX() { return X; } public double getY() { return Y; } } } This is basically all that I need, the only question I have is how to handle output?? More specifically, I need to output the value of the "step size" and the momentum, although it would be nice to output other information as well. Anyone with experience using NeuronDotNet, your input is appreciated.

    Read the article

  • Vector math, finding coördinates on a planar between 2 vectors

    - by Will Kru
    I am trying to generate a 3d tube along a spline. I have the coördinates of the spline (x1,y1,z1 - x2,y2,z2 - etc) which you can see in the illustration in yellow. At those points I need to generate circles, whose vertices are to be connected at a later stadium. The circles need to be perpendicular to the 'corners' of two line segments of the spline to form a correct tube. Note that the segments are kept low for illustration purpose. [apparently I'm not allowed to post images so please view the image at this link] http://img191.imageshack.us/img191/6863/18720019.jpg I am as far as being able to calculate the vertices of each ring at each point of the spline, but they are all on the same planar ie same angled. I need them to be rotated according to their 'legs' (which A & B are to C for instance). I've been thinking this over and thought of the following: two line segments can be seen as 2 vectors (in illustration A & B) the corner (in illustraton C) is where a ring of vertices need to be calculated I need to find the planar on which all of the vertices will reside I then can use this planar (=vector?) to calculate new vectors from the center point, which is C and find their x,y,z using radius * sin and cos However, I'm really confused on the math part of this. I read about the dot product but that returns a scalar which I don't know how to apply in this case. Can someone point me into the right direction? [edit] To give a bit more info on the situation: I need to construct a buffer of floats, which -in groups of 3- describe vertex positions and will be connected by OpenGL ES, given another buffer with indices to form polygons. To give shape to the tube, I first created an array of floats, which -in groups of 3- describe control points in 3d space. Then along with a variable for segment density, I pass these control points to a function that uses these control points to create a CatmullRom spline and returns this in the form of another array of floats which -again in groups of 3- describe vertices of the catmull rom spline. On each of these vertices, I want to create a ring of vertices which also can differ in density (amount of smoothness / vertices per ring). All former vertices (control points and those that describe the catmull rom spline) are discarded. Only the vertices that form the tube rings will be passed to OpenGL, which in turn will connect those to form the final tube. I am as far as being able to create the catmullrom spline, and create rings at the position of its vertices, however, they are all on a planars that are in the same angle, instead of following the splines path. [/edit] Thanks!

    Read the article

  • ruby regex, parsing html

    - by danwoods
    Hello all, I'm trying to parse some returned html to look for currently playing movies. The pattern I'm trying to match looks like: <span dir=ltr>Clash of the Titans</span> Of which there are several in the returned html. (the html is huge, I've posted a sample at the bottom) I'm trying get an array of the movie titles with the following command: titles = listings_html.split(/(<span dir=ltr>).*(<\/span>)/) But I'm not getting the results I'm expecting. Can anyone see a problem with my approach or regex? Returned html (I believe the 'markdown'formating will render the some of the html, but this is just an example): <script>window.gbar={};(function(){function h(a,b,d){var c="on"+b;if(a.addEventListener)a.addEventListener(b,d,false);else if(a.attachEvent)a.attachEvent(c,d);else{var f=a[c];a[c]=function(){var e=f.apply(this,arguments),g=d.apply(this,arguments);return e==undefined?g:g==undefined?e:g&&e}}};var i=window.gbar,k,l,m;function n(a){var b=window.encodeURIComponent&&(document.forms[0].q||"").value;if(b)a.href=a.href.replace(/([?&])q=[^&]*|$/,function(d,c){return(c||"&")+"q="+encodeURIComponent(b)})}i.qs=n;function o(a,b,d,c,f,e){var g=document.getElementById(a);if(g){var j=g.style;j.left=c?"auto":b+"px";j.right=c?b+"px":"auto";j.top=d+"px";j.visibility=l?"hidden":"visible";if(f&&e){j.width=f+"px";j.height=e+"px"}else{o(k,b,d,c,g.offsetWidth,g.offsetHeight);l=l?"":a}}}i.tg=function(a){a=a||window.event;var b,d=a.target||a.srcElement;a.cancelBubble=true;if(k!=null)p(d);else{b=document.createElement(Array.every||window.createPopup?"iframe":"div");b.frameBorder="0";k=b.id="gbs";b.src="javascript:''";d.parentNode.appendChild(b);h(document,"click",i.close);p(d);i.alld&&i.alld(function(){var c=document.getElementById("gbli");if(c){var f=c.parentNode;q(f,c);var e=c.prevSibling;f.removeChild(c);i.removeExtraDelimiters(f,e);b.style.height=f.offsetHeight+"px"}})}};function r(a){var b,d=document.defaultView;if(d&&d.getComputedStyle){if(a=d.getComputedStyle(a,""))b=a.direction}else b=a.currentStyle?a.currentStyle.direction:a.style.direction;return b=="rtl"}function p(a){var b=0;if(a.className!="gb3")a=a.parentNode;var d=a.getAttribute("aria-owns")||"gbi",c=a.offsetWidth,f=a.offsetTop>20?46:24,e=false;do b+=a.offsetLeft||0;while(a=a.offsetParent);a=(document.documentElement.clientWidth||document.body.clientWidth)-b-c;c=r(document.body);if(d=="gbi"){var g=document.getElementById("gbi");q(g,document.getElementById("gbli")||g.firstChild);if(c){b=a;e=true}}else if(!c){b=a;e=true}l!=d&&i.close();o(d,b,f,e)}i.close=function(){l&&o(l,0,0)};function s(a,b,d){if(!m){m="gb2";if(i.alld){var c=i.findClassName(a);if(c)m=c}}a.insertBefore(b,d).className=m}function q(a,b){for(var d,c=window.navExtra;c&&(d=c.pop());)s(a,d,b)}i.addLink=function(a,b,d){if((b=document.getElementById(b))&&a){a.className="gb4";var c=document.createElement("span");c.appendChild(a);c.appendChild(document.createTextNode(" | "));c.id=d;b.appendChild(c)}}})();if(!window.google)window.google={};if(!window.google.movies)window.google.movies={};window.google.movies.registerFixdir=function(){var c="[\u0000- !-@[-{-\u00bf\u00d7\u00f7\u02b9-\u02ff\u2000-\u2bff]",g=new RegExp("^"+c+"([0-9]"+c+"$|[A-Za-z\u00c0-\u00d6\u00d8-\u00f6\u00f8-\u02b8\u0300-\u0590\u0800-\u1fff\u2c00-\ufb1c\ufdfe-\ufe6f\ufefd-\uffff])"),h=new RegExp("^"+c+"$");function e(d,a){if(!a)a=d&&d.target?d.target:window.event.srcElement;a.dir=g.test(a.value)?"ltr":(h.test(a.value)?"":"rtl")} var i=[document.getElementsByName("q")[0],document.getElementById("mtq")];for(var f=0,b;b=i[f];f++)if(b){b.onkeyup=e;e(null,b)}}; Movie Showtimes - Google Search.fl:link{}a:link,.w,a.w:link,.w a:link{color:#00c}a:visited{color:#551a8b}a:active{color:red}.t a:link,.t a:active,.t a:visited,.t{color:#000}.left{width:12em}.box{background:#fff}.nopadding{padding:0}.k{background:#36c}.z{display:none}.x{width:3em}.y{width:23em}.b{color:#00c;font-size:12pt;font-weight:bold}.i,.i:link{color:#a90a08}.n a{color:#000;font-size:10pt}.n .b a{color:#00c}.n .i{font-size:10pt;font-weight:bold}.h{cursor:pointer}body{background:#fff;font:82% Arial,Helvetica,sans-serif;margin:3px 0 0;padding:0}table{border-collapse:collapse;border-spacing:0}img{border:0}td,th{vertical-align:top}h1,h2{font-size:100%;margin:0}a{color:#00c}/ CSS for page */#title_bar{background:#f0f7f9;border-top:1px solid #6b90da;padding-bottom:4px;padding-left:8px;padding-top:4px}#google_bar{margin:3px 10px}#search_form{margin:3px 10px}#left_nav{border-right:1px solid #c9d7f1;margin-top:11px;position:absolute;left:9px;width:13.4em}#left_nav .section{margin-bottom:1.2em}.hidden{visibility:hidden}#results{height:auto !important;height:350px;margin-left:15em;min-height:350px;min-width:800px;width:expression(document.body.clientWidth<1000?"800px":"99.9%")}.name{font-size:124%;margin:0}.times{clear:both;margin:0}.address{margin:0}#movie_results{overflow:auto}.movie_results{margin-top:11px}.movie{clear:both;margin-bottom:40px}.movie .header{padding-left:8px}.movie .img{border:1px solid #ccc;float:left;margin-bottom:10px}.movie .desc{margin-bottom:15px;max-width:42em}.movie h2{font-size:124%;margin-bottom:2px}.movie .info{margin-bottom:10px}.movie .syn{margin-bottom:10px}.movie .section_title{background:#f0f7f9;clear:both;font-size:108%;margin-bottom:11px;margin-top:11px;padding-bottom:4px;padding-left:8px;padding-top:5px}.movie .showtimes{margin-bottom:8px;padding-left:8px}.movie .show_left{width:49%}.movie .show_right{width:49%}.movie .theater{padding-bottom:15px}.theater{clear:both;padding-bottom:1px}.theater_after_icon{padding-left:25px}.theater .show_left{width:49%}.theater .show_right{width:49%}.theater h2{font-size:124%;margin-bottom:2px}.theater .icon{float:left;height:3em;margin-right:5px}.theater .closure{font-size:100%}.theater .info{font-size:100%;padding-bottom:5px;padding-top:5px}.theater .movie{margin-bottom:8px;margin-right:8px;max-width:42em}.theater .movie .desc{margin-bottom:5px;margin-left:0}.theater .movie .info{margin-top:0}.theater .showtimes{margin-bottom:40px;margin-top:8px}#theater_map{right:0;left:0;position:relative;top:0}#theater_static_map{border:1px solid #c9d7f1;margin:10px}.map_marker .name{margin-top:10px}.photo{border:1px solid #ccc;margin-bottom:20px;margin-left:8px}.show_left{float:left;margin:0;width:49.999%}.show_right{float:right;margin:0;width:50%}.show_more{clear:both;font-size:124%;margin:0}.show_more a{color:#77c}.reviews{margin-bottom:8px;padding-left:8px}.review{margin-bottom:5px}.review .publisher{color:green}.review .date{color:#6f6f6f}.trailer{margin-bottom:8px;padding-left:8px}.clear{clear:both}.iconA{background:url(http://maps.gstatic.com/mapfiles/red_icons_A_J.png) repeat 0 0}.iconB{background:url(http://maps.gstatic.com/mapfiles/red_icons_A_J.png) repeat 0 -38px}.iconC{background:url(http://maps.gstatic.com/mapfiles/red_icons_A_J.png) repeat 0 -76px}.iconD{background:url(http://maps.gstatic.com/mapfiles/red_icons_A_J.png) repeat 0 -114px}.iconE{background:url(http://maps.gstatic.com/mapfiles/red_icons_A_J.png) repeat 0 -152px}.iconF{background:url(http://maps.gstatic.com/mapfiles/red_icons_A_J.png) repeat 0 -190px}.iconG{background:url(http://maps.gstatic.com/mapfiles/red_icons_A_J.png) repeat 0 -228px}.iconH{background:url(http://maps.gstatic.com/mapfiles/red_icons_A_J.png) repeat 0 -266px}.iconI{background:url(http://maps.gstatic.com/mapfiles/red_icons_A_J.png) repeat 0 -304px}.iconJ{background:url(http://maps.gstatic.com/mapfiles/red_icons_A_J.png) repeat 0 -342px}.iconK{background:url(http://maps.gstatic.com/mapfiles/red_icons_K_Z.png) repeat 0 0}.iconL{background:url(http://maps.gstatic.com/mapfiles/red_icons_K_Z.png) repeat 0 -38px}.iconM{background:url(http://maps.gstatic.com/mapfiles/red_icons_K_Z.png) repeat 0 -76px}.iconN{background:url(http://maps.gstatic.com/mapfiles/red_icons_K_Z.png) repeat 0 -114px}.iconO{background:url(http://maps.gstatic.com/mapfiles/red_icons_K_Z.png) repeat 0 -152px}.iconP{background:url(http://maps.gstatic.com/mapfiles/red_icons_K_Z.png) repeat 0 -190px}.iconQ{background:url(http://maps.gstatic.com/mapfiles/red_icons_K_Z.png) repeat 0 -228px}.iconR{background:url(http://maps.gstatic.com/mapfiles/red_icons_K_Z.png) repeat 0 -266px}.iconS{background:url(http://maps.gstatic.com/mapfiles/red_icons_K_Z.png) repeat 0 -304px}.iconT{background:url(http://maps.gstatic.com/mapfiles/red_icons_K_Z.png) repeat 0 -342px}.iconU{background:url(http://maps.gstatic.com/mapfiles/red_icons_K_Z.png) repeat 0 -380px}.iconV{background:url(http://maps.gstatic.com/mapfiles/red_icons_K_Z.png) repeat 0 -418px}.iconW{background:url(http://maps.gstatic.com/mapfiles/red_icons_K_Z.png) repeat 0 -456px}.iconX{background:url(http://maps.gstatic.com/mapfiles/red_icons_K_Z.png) repeat 0 -494px}.iconY{background:url(http://maps.gstatic.com/mapfiles/red_icons_K_Z.png) repeat 0 -532px}.iconZ{background:url(http://maps.gstatic.com/mapfiles/red_icons_K_Z.png) repeat 0 -570px}#gbar,#guser{font-size:13px;padding-top:1px !important}#gbar{float:left;height:22px}#guser{padding-bottom:7px !important;text-align:right}.gbh,.gbd{border-top:1px solid #c9d7f1;font-size:1px}.gbh{height:0;position:absolute;top:24px;width:100%}#gbs,.gbm{background:#fff;left:0;position:absolute;text-align:left;visibility:hidden;z-index:1000}.gbm{border:1px solid;border-color:#c9d7f1 #36c #36c #a2bae7;z-index:1001}.gb1{margin-right:.5em}.gb1,.gb3{zoom:1}.gb2{display:block;padding:.2em .5em;}.gb2,.gb3{text-decoration:none;border-bottom:none}a.gb1,a.gb2,a.gb3,a.gb4{color:#00c !important}.gbi .gb3,.gbi .gb2,.gbi .gb4{color:#dd8e27 !important}.gbf .gb3,.gbf .gb2,.gbf .gb4{color:#900 !important}a.gb2:hover{background:#36c;color:#fff !important}Web Images Videos Maps News Shopping Gmail more ▼Books Finance Translate Scholar Blogs YouTube Calendar Photos Documents Reader Sites Groups even more » [email protected] | Google Account settings | Sign out     Advanced Search  PreferencesShowtimes for Murfreesboro, TN 37130Change Location› Today › Tomorrow › Monday › Tuesday› Theaters › Movies› Show list view › Show map viewPremiere 6 Theater810 Northwest Broad Street, Murfreesboro, TN - (615) 896-4100Clash of the Titans? - 1hr 50min?? - Rated PG-13?? - Action/Adventure? - Trailer - IMDb2:10  4:15  6:15  8:20  10:25pmDiary of a Wimpy Kid? - 1hr 33min?? - Rated PG?? - Comedy/Drama? - Trailer - IMDb2:00  3:50  6:00  7:50  9:40pmHow to Train Your Dragon?1hr 38min?? - Rated PG?? - Family/Animation? - IMDb2:00  3:55  6:00  7:55  9:50pmThe Bounty Hunter? - 1hr 46min?? - Rated PG-13?? - Action/Adventure/Comedy/Romance? - Trailer - IMDb2:15  4:15  6:25  8:25  10:30pmThe Last Song? - 1hr 47min?? - Rated PG?? - Drama? - Trailer - IMDb2:20  4:15  6:30  8:35  10:35pmTyler Perry's Why Did I Get Married Too?2hr 1min?? - Rated PG-13?? - Comedy?2:20  4:35  7:30  9:45pmContinental Cinema 5450 US Highway 231 N, Troy, AL - (334) 808-4225Clash of the Titans 3D? - 1hr 50min?? - Rated PG-13?? - Action/Adventure? - IMDb1:00  4:00  7:00  9:30pmHow to Train Your Dragon 3D? - 1hr 38min?? - Rated PG?? - Family/Animation? - IMDb1:05  4:05  7:05  9:25pmThe Bounty Hunter? - 1hr 46min?? - Rated PG-13?? - Action/Adventure/Comedy/Romance? - Trailer - IMDb1:00  4:00  7:00  9:30pmThe Last Song? - 1hr 47min?? - Rated PG?? - Drama? - Trailer - IMDb1:05  4:05  7:05  9:25pmTyler Perry's Why Did I Get Married Too?2hr 1min?? - Rated PG-13?? - Comedy?12:55  3:55  6:55  9:35pmMall Cinema - Hartford KYUS Hwy 231 South 62 East, Hartford, KY - (270) 298-3315Clash of the Titans? - 1hr 50min?? - Rated PG-13?? - Action/Adventure? - Trailer - IMDb5:00  7:00  9:00pmHow to Train Your Dragon?1hr 38min?? - Rated PG?? - Family/Animation? - IMDb5:00  7:00  9:00pmCarmike Wynnsong 16 - Murfreesboro2626 Cason Square Boulevard, Murfreesboro, TN - (615) 893-2253The Last Song? - 1hr 47min?? - Rated PG?? - Drama? - Trailer - IMDb12:15  1:00  2:45  4:00  5:15  7:00  7:45 

    Read the article

  • Rotation Matrix calculates by column not by row

    - by pinnacler
    I have a class called forest and a property called fixedPositions that stores 100 points (x,y) and they are stored 250x2 (rows x columns) in MatLab. When I select 'fixedPositions', I can click scatter and it will plot the points. Now, I want to rotate the plotted points and I have a rotation matrix that will allow me to do that. The below code should work: theta = obj.heading * pi/180; apparent = [cos(theta) -sin(theta) ; sin(theta) cos(theta)] * obj.fixedPositions; But it wont. I get this error. ??? Error using == mtimes Inner matrix dimensions must agree. Error in == landmarkslandmarks.get.apparentPositions at 22 apparent = [cos(theta) -sin(theta) ; sin(theta) cos(theta)] * obj.fixedPositions; When I alter forest.fixedPositions to store the variables 2x250 instead of 250x2, the above code will work, but it wont plot. I'm going to be plotting fixedPositions constantly in a simulation, so I'd prefer to leave it as it, and make the rotation work instead. Any ideas? Also, fixed positions, is the position of the xy points as if you were looking straight ahead. i.e. heading = 0. heading is set to 45, meaning I want to rotate points clockwise 45 degrees. Here is my code: classdef landmarks properties fixedPositions %# positions in a fixed coordinate system. [x, y] heading = 45; %# direction in which the robot is facing end properties (Dependent) apparentPositions end methods function obj = landmarks(numberOfTrees) %# randomly generates numberOfTrees amount of x,y coordinates and set %the array or matrix (not sure which) to fixedPositions obj.fixedPositions = 100 * rand([numberOfTrees,2]) .* sign(rand([numberOfTrees,2]) - 0.5); end function obj = set.apparentPositions(obj,~) theta = obj.heading * pi/180; [cos(theta) -sin(theta) ; sin(theta) cos(theta)] * obj.fixedPositions; end function apparent = get.apparentPositions(obj) %# rotate obj.positions using obj.facing to generate the output theta = obj.heading * pi/180; apparent = [cos(theta) -sin(theta) ; sin(theta) cos(theta)] * obj.fixedPositions; end end end P.S. If you change one line to this: obj.fixedPositions = 100 * rand([2,numberOfTrees]) .* sign(rand([2,numberOfTrees]) - 0.5); Everything will work fine... it just wont plot.

    Read the article

  • open layers LineString not working

    - by AlexS
    Sorry to bother you guys, but I'm stuck with his problem for half a day. I want to draw poly line in OpenLayers using LineString object, so I've copied the example from documentation. It runs ok but i can't see the line on the screen Code looks like this <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0 Transitional//EN"> var map; var lineLayer ; var points; var style; var polygonFeature function test() { lineLayer = new OpenLayers.Layer.Vector("Line Layer"); style = { strokeColor: '#0000ff', strokeOpacity: 1, strokeWidth: 10 }; map.addLayer(lineLayer); points = new Array(); points[0] =new OpenLayers.LonLat(-2.460181,27.333984 ).transform(new OpenLayers.Projection("EPSG:4326"), map.getProjectionObject());; points[1] = new OpenLayers.LonLat(-3.864255,-22.5 ).transform(new OpenLayers.Projection("EPSG:4326"), map.getProjectionObject());; var linear_ring = new OpenLayers.Geometry.LinearRing(points); polygonFeature = new OpenLayers.Feature.Vector( new OpenLayers.Geometry.Polygon([linear_ring]), null, style); lineLayer.addFeatures([polygonFeature]); alert("1"); } function initialize() { map = new OpenLayers.Map ("map_canvas", { controls:[ new OpenLayers.Control.Navigation(), new OpenLayers.Control.PanZoomBar(), new OpenLayers.Control.LayerSwitcher(), new OpenLayers.Control.Attribution()], maxExtent: new OpenLayers.Bounds(-20037508.34,-20037508.34,20037508.34,20037508.34), maxResolution: 156543.0399, numZoomLevels: 19, units: 'm', projection: new OpenLayers.Projection("EPSG:900913"), displayProjection: new OpenLayers.Projection("EPSG:4326") }); // Define the map layer // Here we use a predefined layer that will be kept up to date with URL changes layerMapnik = new OpenLayers.Layer.OSM.Mapnik("Mapnik"); map.addLayer(layerMapnik); var lonLat = new OpenLayers.LonLat(0, 0).transform(new OpenLayers.Projection("EPSG:4326"), map.getProjectionObject()); map.zoomTo(3); map.setCenter(lonLat, 19); test(); } </head> <body onload="initialize()" > <div id="map_canvas" style="width: 828px; height: 698px"></div> I'm sure I'm missing some parameter in creation of map or something but I really can't figure which one.

    Read the article

  • Can this PHP version of SPICE be improved?

    - by Noctis Skytower
    I do not know much about PHP's standard library of functions and was wondering if the following code can be improved in any way. The implementation should yield the same results, the API should remain as it is, but ways to make is more PHP-ish would be greatly appreciated. This is a custom encryption library. Code <?php /*************************************** Create random major and minor SPICE key. ***************************************/ function crypt_major() { $all = range("\x00", "\xFF"); shuffle($all); $major_key = implode("", $all); return $major_key; } function crypt_minor() { $sample = array(); do { array_push($sample, 0, 1, 2, 3); } while (count($sample) != 256); shuffle($sample); $list = array(); for ($index = 0; $index < 64; $index++) { $b12 = $sample[$index * 4] << 6; $b34 = $sample[$index * 4 + 1] << 4; $b56 = $sample[$index * 4 + 2] << 2; $b78 = $sample[$index * 4 + 3]; array_push($list, $b12 + $b34 + $b56 + $b78); } $minor_key = implode("", array_map("chr", $list)); return $minor_key; } /*************************************** Create the SPICE key via the given name. ***************************************/ function named_major($name) { srand(crc32($name)); return crypt_major(); } function named_minor($name) { srand(crc32($name)); return crypt_minor(); } /*************************************** Check validity for major and minor keys. ***************************************/ function _check_major($key) { if (is_string($key) && strlen($key) == 256) { foreach (range("\x00", "\xFF") as $char) { if (substr_count($key, $char) == 0) { return FALSE; } } return TRUE; } return FALSE; } function _check_minor($key) { if (is_string($key) && strlen($key) == 64) { $indexs = array(); foreach (array_map("ord", str_split($key)) as $byte) { foreach (range(6, 0, 2) as $shift) { array_push($indexs, ($byte >> $shift) & 3); } } $dict = array_count_values($indexs); foreach (range(0, 3) as $index) { if ($dict[$index] != 64) { return FALSE; } } return TRUE; } return FALSE; } /*************************************** Create encode maps for encode functions. ***************************************/ function _encode_map_1($major) { return array_map("ord", str_split($major)); } function _encode_map_2($minor) { $map_2 = array(array(), array(), array(), array()); $list = array(); foreach (array_map("ord", str_split($minor)) as $byte) { foreach (range(6, 0, 2) as $shift) { array_push($list, ($byte >> $shift) & 3); } } for ($byte = 0; $byte < 256; $byte++) { array_push($map_2[$list[$byte]], chr($byte)); } return $map_2; } /*************************************** Create decode maps for decode functions. ***************************************/ function _decode_map_1($minor) { $map_1 = array(); foreach (array_map("ord", str_split($minor)) as $byte) { foreach (range(6, 0, 2) as $shift) { array_push($map_1, ($byte >> $shift) & 3); } } return $map_1; }function _decode_map_2($major) { $map_2 = array(); $temp = array_map("ord", str_split($major)); for ($byte = 0; $byte < 256; $byte++) { $map_2[$temp[$byte]] = chr($byte); } return $map_2; } /*************************************** Encrypt or decrypt the string with maps. ***************************************/ function _encode($string, $map_1, $map_2) { $cache = ""; foreach (str_split($string) as $char) { $byte = $map_1[ord($char)]; foreach (range(6, 0, 2) as $shift) { $cache .= $map_2[($byte >> $shift) & 3][mt_rand(0, 63)]; } } return $cache; } function _decode($string, $map_1, $map_2) { $cache = ""; $temp = str_split($string); for ($iter = 0; $iter < strlen($string) / 4; $iter++) { $b12 = $map_1[ord($temp[$iter * 4])] << 6; $b34 = $map_1[ord($temp[$iter * 4 + 1])] << 4; $b56 = $map_1[ord($temp[$iter * 4 + 2])] << 2; $b78 = $map_1[ord($temp[$iter * 4 + 3])]; $cache .= $map_2[$b12 + $b34 + $b56 + $b78]; } return $cache; } /*************************************** This is the public interface for coding. ***************************************/ function encode_string($string, $major, $minor) { if (is_string($string)) { if (_check_major($major) && _check_minor($minor)) { $map_1 = _encode_map_1($major); $map_2 = _encode_map_2($minor); return _encode($string, $map_1, $map_2); } } return FALSE; } function decode_string($string, $major, $minor) { if (is_string($string) && strlen($string) % 4 == 0) { if (_check_major($major) && _check_minor($minor)) { $map_1 = _decode_map_1($minor); $map_2 = _decode_map_2($major); return _decode($string, $map_1, $map_2); } } return FALSE; } ?> This is a sample showing how the code is being used. Hex editors may be of help with the input / output. Example <?php # get and process all of the form data @ $input = htmlspecialchars($_POST["input"]); @ $majorname = htmlspecialchars($_POST["majorname"]); @ $minorname = htmlspecialchars($_POST["minorname"]); @ $majorkey = htmlspecialchars($_POST["majorkey"]); @ $minorkey = htmlspecialchars($_POST["minorkey"]); @ $output = htmlspecialchars($_POST["output"]); # process the submissions by operation # CREATE @ $operation = $_POST["operation"]; if ($operation == "Create") { if (strlen($_POST["majorname"]) == 0) { $majorkey = bin2hex(crypt_major()); } if (strlen($_POST["minorname"]) == 0) { $minorkey = bin2hex(crypt_minor()); } if (strlen($_POST["majorname"]) != 0) { $majorkey = bin2hex(named_major($_POST["majorname"])); } if (strlen($_POST["minorname"]) != 0) { $minorkey = bin2hex(named_minor($_POST["minorname"])); } } # ENCRYPT or DECRYPT function is_hex($char) { if ($char == "0"): return TRUE; elseif ($char == "1"): return TRUE; elseif ($char == "2"): return TRUE; elseif ($char == "3"): return TRUE; elseif ($char == "4"): return TRUE; elseif ($char == "5"): return TRUE; elseif ($char == "6"): return TRUE; elseif ($char == "7"): return TRUE; elseif ($char == "8"): return TRUE; elseif ($char == "9"): return TRUE; elseif ($char == "a"): return TRUE; elseif ($char == "b"): return TRUE; elseif ($char == "c"): return TRUE; elseif ($char == "d"): return TRUE; elseif ($char == "e"): return TRUE; elseif ($char == "f"): return TRUE; else: return FALSE; endif; } function hex2bin($str) { if (strlen($str) % 2 == 0): $string = strtolower($str); else: $string = strtolower("0" . $str); endif; $cache = ""; $temp = str_split($str); for ($index = 0; $index < count($temp) / 2; $index++) { $h1 = $temp[$index * 2]; if (is_hex($h1)) { $h2 = $temp[$index * 2 + 1]; if (is_hex($h2)) { $cache .= chr(hexdec($h1 . $h2)); } else { return FALSE; } } else { return FALSE; } } return $cache; } if ($operation == "Encrypt" || $operation == "Decrypt") { # CHECK FOR ANY ERROR $errors = array(); if (strlen($_POST["input"]) == 0) { $output = ""; } $binmajor = hex2bin($_POST["majorkey"]); if (strlen($_POST["majorkey"]) == 0) { array_push($errors, "There must be a major key."); } elseif ($binmajor == FALSE) { array_push($errors, "The major key must be in hex."); } elseif (_check_major($binmajor) == FALSE) { array_push($errors, "The major key is corrupt."); } $binminor = hex2bin($_POST["minorkey"]); if (strlen($_POST["minorkey"]) == 0) { array_push($errors, "There must be a minor key."); } elseif ($binminor == FALSE) { array_push($errors, "The minor key must be in hex."); } elseif (_check_minor($binminor) == FALSE) { array_push($errors, "The minor key is corrupt."); } if ($_POST["operation"] == "Decrypt") { $bininput = hex2bin(str_replace("\r", "", str_replace("\n", "", $_POST["input"]))); if ($bininput == FALSE) { if (strlen($_POST["input"]) != 0) { array_push($errors, "The input data must be in hex."); } } elseif (strlen($bininput) % 4 != 0) { array_push($errors, "The input data is corrupt."); } } if (count($errors) != 0) { # ERRORS ARE FOUND $output = "ERROR:"; foreach ($errors as $error) { $output .= "\n" . $error; } } elseif (strlen($_POST["input"]) != 0) { # CONTINUE WORKING if ($_POST["operation"] == "Encrypt") { # ENCRYPT $output = substr(chunk_split(bin2hex(encode_string($_POST["input"], $binmajor, $binminor)), 58), 0, -2); } else { # DECRYPT $output = htmlspecialchars(decode_string($bininput, $binmajor, $binminor)); } } } # echo the form with the values filled echo "<P><TEXTAREA class=maintextarea name=input rows=25 cols=25>" . $input . "</TEXTAREA></P>\n"; echo "<P>Major Name:</P>\n"; echo "<P><INPUT id=textbox1 name=majorname value=\"" . $majorname . "\"></P>\n"; echo "<P>Minor Name:</P>\n"; echo "<P><INPUT id=textbox1 name=minorname value=\"" . $minorname . "\"></P>\n"; echo "<DIV style=\"TEXT-ALIGN: center\"><INPUT class=submit type=submit value=Create name=operation>\n"; echo "</DIV>\n"; echo "<P>Major Key:</P>\n"; echo "<P><INPUT id=textbox1 name=majorkey value=\"" . $majorkey . "\"></P>\n"; echo "<P>Minor Key:</P>\n"; echo "<P><INPUT id=textbox1 name=minorkey value=\"" . $minorkey . "\"></P>\n"; echo "<DIV style=\"TEXT-ALIGN: center\"><INPUT class=submit type=submit value=Encrypt name=operation> \n"; echo "<INPUT class=submit type=submit value=Decrypt name=operation> </DIV>\n"; echo "<P>Result:</P>\n"; echo "<P><TEXTAREA class=maintextarea name=output rows=25 readOnly cols=25>" . $output . "</TEXTAREA></P></DIV></FORM>\n"; ?>

    Read the article

  • How can this PHP code be improved? What should be changed?

    - by Noctis Skytower
    This is a custom encryption library. I do not know much about PHP's standard library of functions and was wondering if the following code can be improved in any way. The implementation should yield the same results, the API should remain as it is, but ways to make is more PHP-ish would be greatly appreciated. Code <?php /*************************************** Create random major and minor SPICE key. ***************************************/ function crypt_major() { $all = range("\x00", "\xFF"); shuffle($all); $major_key = implode("", $all); return $major_key; } function crypt_minor() { $sample = array(); do { array_push($sample, 0, 1, 2, 3); } while (count($sample) != 256); shuffle($sample); $list = array(); for ($index = 0; $index < 64; $index++) { $b12 = $sample[$index * 4] << 6; $b34 = $sample[$index * 4 + 1] << 4; $b56 = $sample[$index * 4 + 2] << 2; $b78 = $sample[$index * 4 + 3]; array_push($list, $b12 + $b34 + $b56 + $b78); } $minor_key = implode("", array_map("chr", $list)); return $minor_key; } /*************************************** Create the SPICE key via the given name. ***************************************/ function named_major($name) { srand(crc32($name)); return crypt_major(); } function named_minor($name) { srand(crc32($name)); return crypt_minor(); } /*************************************** Check validity for major and minor keys. ***************************************/ function _check_major($key) { if (is_string($key) && strlen($key) == 256) { foreach (range("\x00", "\xFF") as $char) { if (substr_count($key, $char) == 0) { return FALSE; } } return TRUE; } return FALSE; } function _check_minor($key) { if (is_string($key) && strlen($key) == 64) { $indexs = array(); foreach (array_map("ord", str_split($key)) as $byte) { foreach (range(6, 0, 2) as $shift) { array_push($indexs, ($byte >> $shift) & 3); } } $dict = array_count_values($indexs); foreach (range(0, 3) as $index) { if ($dict[$index] != 64) { return FALSE; } } return TRUE; } return FALSE; } /*************************************** Create encode maps for encode functions. ***************************************/ function _encode_map_1($major) { return array_map("ord", str_split($major)); } function _encode_map_2($minor) { $map_2 = array(array(), array(), array(), array()); $list = array(); foreach (array_map("ord", str_split($minor)) as $byte) { foreach (range(6, 0, 2) as $shift) { array_push($list, ($byte >> $shift) & 3); } } for ($byte = 0; $byte < 256; $byte++) { array_push($map_2[$list[$byte]], chr($byte)); } return $map_2; } /*************************************** Create decode maps for decode functions. ***************************************/ function _decode_map_1($minor) { $map_1 = array(); foreach (array_map("ord", str_split($minor)) as $byte) { foreach (range(6, 0, 2) as $shift) { array_push($map_1, ($byte >> $shift) & 3); } } return $map_1; }function _decode_map_2($major) { $map_2 = array(); $temp = array_map("ord", str_split($major)); for ($byte = 0; $byte < 256; $byte++) { $map_2[$temp[$byte]] = chr($byte); } return $map_2; } /*************************************** Encrypt or decrypt the string with maps. ***************************************/ function _encode($string, $map_1, $map_2) { $cache = ""; foreach (str_split($string) as $char) { $byte = $map_1[ord($char)]; foreach (range(6, 0, 2) as $shift) { $cache .= $map_2[($byte >> $shift) & 3][mt_rand(0, 63)]; } } return $cache; } function _decode($string, $map_1, $map_2) { $cache = ""; $temp = str_split($string); for ($iter = 0; $iter < strlen($string) / 4; $iter++) { $b12 = $map_1[ord($temp[$iter * 4])] << 6; $b34 = $map_1[ord($temp[$iter * 4 + 1])] << 4; $b56 = $map_1[ord($temp[$iter * 4 + 2])] << 2; $b78 = $map_1[ord($temp[$iter * 4 + 3])]; $cache .= $map_2[$b12 + $b34 + $b56 + $b78]; } return $cache; } /*************************************** This is the public interface for coding. ***************************************/ function encode_string($string, $major, $minor) { if (is_string($string)) { if (_check_major($major) && _check_minor($minor)) { $map_1 = _encode_map_1($major); $map_2 = _encode_map_2($minor); return _encode($string, $map_1, $map_2); } } return FALSE; } function decode_string($string, $major, $minor) { if (is_string($string) && strlen($string) % 4 == 0) { if (_check_major($major) && _check_minor($minor)) { $map_1 = _decode_map_1($minor); $map_2 = _decode_map_2($major); return _decode($string, $map_1, $map_2); } } return FALSE; } ?> This is a sample showing how the code is being used. Hex editors may be of help with the input / output. Example <?php # get and process all of the form data @ $input = htmlspecialchars($_POST["input"]); @ $majorname = htmlspecialchars($_POST["majorname"]); @ $minorname = htmlspecialchars($_POST["minorname"]); @ $majorkey = htmlspecialchars($_POST["majorkey"]); @ $minorkey = htmlspecialchars($_POST["minorkey"]); @ $output = htmlspecialchars($_POST["output"]); # process the submissions by operation # CREATE @ $operation = $_POST["operation"]; if ($operation == "Create") { if (strlen($_POST["majorname"]) == 0) { $majorkey = bin2hex(crypt_major()); } if (strlen($_POST["minorname"]) == 0) { $minorkey = bin2hex(crypt_minor()); } if (strlen($_POST["majorname"]) != 0) { $majorkey = bin2hex(named_major($_POST["majorname"])); } if (strlen($_POST["minorname"]) != 0) { $minorkey = bin2hex(named_minor($_POST["minorname"])); } } # ENCRYPT or DECRYPT function is_hex($char) { if ($char == "0"): return TRUE; elseif ($char == "1"): return TRUE; elseif ($char == "2"): return TRUE; elseif ($char == "3"): return TRUE; elseif ($char == "4"): return TRUE; elseif ($char == "5"): return TRUE; elseif ($char == "6"): return TRUE; elseif ($char == "7"): return TRUE; elseif ($char == "8"): return TRUE; elseif ($char == "9"): return TRUE; elseif ($char == "a"): return TRUE; elseif ($char == "b"): return TRUE; elseif ($char == "c"): return TRUE; elseif ($char == "d"): return TRUE; elseif ($char == "e"): return TRUE; elseif ($char == "f"): return TRUE; else: return FALSE; endif; } function hex2bin($str) { if (strlen($str) % 2 == 0): $string = strtolower($str); else: $string = strtolower("0" . $str); endif; $cache = ""; $temp = str_split($str); for ($index = 0; $index < count($temp) / 2; $index++) { $h1 = $temp[$index * 2]; if (is_hex($h1)) { $h2 = $temp[$index * 2 + 1]; if (is_hex($h2)) { $cache .= chr(hexdec($h1 . $h2)); } else { return FALSE; } } else { return FALSE; } } return $cache; } if ($operation == "Encrypt" || $operation == "Decrypt") { # CHECK FOR ANY ERROR $errors = array(); if (strlen($_POST["input"]) == 0) { $output = ""; } $binmajor = hex2bin($_POST["majorkey"]); if (strlen($_POST["majorkey"]) == 0) { array_push($errors, "There must be a major key."); } elseif ($binmajor == FALSE) { array_push($errors, "The major key must be in hex."); } elseif (_check_major($binmajor) == FALSE) { array_push($errors, "The major key is corrupt."); } $binminor = hex2bin($_POST["minorkey"]); if (strlen($_POST["minorkey"]) == 0) { array_push($errors, "There must be a minor key."); } elseif ($binminor == FALSE) { array_push($errors, "The minor key must be in hex."); } elseif (_check_minor($binminor) == FALSE) { array_push($errors, "The minor key is corrupt."); } if ($_POST["operation"] == "Decrypt") { $bininput = hex2bin(str_replace("\r", "", str_replace("\n", "", $_POST["input"]))); if ($bininput == FALSE) { if (strlen($_POST["input"]) != 0) { array_push($errors, "The input data must be in hex."); } } elseif (strlen($bininput) % 4 != 0) { array_push($errors, "The input data is corrupt."); } } if (count($errors) != 0) { # ERRORS ARE FOUND $output = "ERROR:"; foreach ($errors as $error) { $output .= "\n" . $error; } } elseif (strlen($_POST["input"]) != 0) { # CONTINUE WORKING if ($_POST["operation"] == "Encrypt") { # ENCRYPT $output = substr(chunk_split(bin2hex(encode_string($_POST["input"], $binmajor, $binminor)), 58), 0, -2); } else { # DECRYPT $output = htmlspecialchars(decode_string($bininput, $binmajor, $binminor)); } } } # echo the form with the values filled echo "<P><TEXTAREA class=maintextarea name=input rows=25 cols=25>" . $input . "</TEXTAREA></P>\n"; echo "<P>Major Name:</P>\n"; echo "<P><INPUT id=textbox1 name=majorname value=\"" . $majorname . "\"></P>\n"; echo "<P>Minor Name:</P>\n"; echo "<P><INPUT id=textbox1 name=minorname value=\"" . $minorname . "\"></P>\n"; echo "<DIV style=\"TEXT-ALIGN: center\"><INPUT class=submit type=submit value=Create name=operation>\n"; echo "</DIV>\n"; echo "<P>Major Key:</P>\n"; echo "<P><INPUT id=textbox1 name=majorkey value=\"" . $majorkey . "\"></P>\n"; echo "<P>Minor Key:</P>\n"; echo "<P><INPUT id=textbox1 name=minorkey value=\"" . $minorkey . "\"></P>\n"; echo "<DIV style=\"TEXT-ALIGN: center\"><INPUT class=submit type=submit value=Encrypt name=operation> \n"; echo "<INPUT class=submit type=submit value=Decrypt name=operation> </DIV>\n"; echo "<P>Result:</P>\n"; echo "<P><TEXTAREA class=maintextarea name=output rows=25 readOnly cols=25>" . $output . "</TEXTAREA></P></DIV></FORM>\n"; ?> What should be editted for better memory efficiency or faster execution?

    Read the article

  • How can this PHP code be improved? What should change?

    - by Noctis Skytower
    This is a custom encryption library. I do not know much about PHP's standard library of functions and was wondering if the following code can be improved in any way. The implementation should yield the same results, the API should remain as it is, but ways to make is more PHP-ish would be greatly appreciated. Code <?php /*************************************** Create random major and minor SPICE key. ***************************************/ function crypt_major() { $all = range("\x00", "\xFF"); shuffle($all); $major_key = implode("", $all); return $major_key; } function crypt_minor() { $sample = array(); do { array_push($sample, 0, 1, 2, 3); } while (count($sample) != 256); shuffle($sample); $list = array(); for ($index = 0; $index < 64; $index++) { $b12 = $sample[$index * 4] << 6; $b34 = $sample[$index * 4 + 1] << 4; $b56 = $sample[$index * 4 + 2] << 2; $b78 = $sample[$index * 4 + 3]; array_push($list, $b12 + $b34 + $b56 + $b78); } $minor_key = implode("", array_map("chr", $list)); return $minor_key; } /*************************************** Create the SPICE key via the given name. ***************************************/ function named_major($name) { srand(crc32($name)); return crypt_major(); } function named_minor($name) { srand(crc32($name)); return crypt_minor(); } /*************************************** Check validity for major and minor keys. ***************************************/ function _check_major($key) { if (is_string($key) && strlen($key) == 256) { foreach (range("\x00", "\xFF") as $char) { if (substr_count($key, $char) == 0) { return FALSE; } } return TRUE; } return FALSE; } function _check_minor($key) { if (is_string($key) && strlen($key) == 64) { $indexs = array(); foreach (array_map("ord", str_split($key)) as $byte) { foreach (range(6, 0, 2) as $shift) { array_push($indexs, ($byte >> $shift) & 3); } } $dict = array_count_values($indexs); foreach (range(0, 3) as $index) { if ($dict[$index] != 64) { return FALSE; } } return TRUE; } return FALSE; } /*************************************** Create encode maps for encode functions. ***************************************/ function _encode_map_1($major) { return array_map("ord", str_split($major)); } function _encode_map_2($minor) { $map_2 = array(array(), array(), array(), array()); $list = array(); foreach (array_map("ord", str_split($minor)) as $byte) { foreach (range(6, 0, 2) as $shift) { array_push($list, ($byte >> $shift) & 3); } } for ($byte = 0; $byte < 256; $byte++) { array_push($map_2[$list[$byte]], chr($byte)); } return $map_2; } /*************************************** Create decode maps for decode functions. ***************************************/ function _decode_map_1($minor) { $map_1 = array(); foreach (array_map("ord", str_split($minor)) as $byte) { foreach (range(6, 0, 2) as $shift) { array_push($map_1, ($byte >> $shift) & 3); } } return $map_1; }function _decode_map_2($major) { $map_2 = array(); $temp = array_map("ord", str_split($major)); for ($byte = 0; $byte < 256; $byte++) { $map_2[$temp[$byte]] = chr($byte); } return $map_2; } /*************************************** Encrypt or decrypt the string with maps. ***************************************/ function _encode($string, $map_1, $map_2) { $cache = ""; foreach (str_split($string) as $char) { $byte = $map_1[ord($char)]; foreach (range(6, 0, 2) as $shift) { $cache .= $map_2[($byte >> $shift) & 3][mt_rand(0, 63)]; } } return $cache; } function _decode($string, $map_1, $map_2) { $cache = ""; $temp = str_split($string); for ($iter = 0; $iter < strlen($string) / 4; $iter++) { $b12 = $map_1[ord($temp[$iter * 4])] << 6; $b34 = $map_1[ord($temp[$iter * 4 + 1])] << 4; $b56 = $map_1[ord($temp[$iter * 4 + 2])] << 2; $b78 = $map_1[ord($temp[$iter * 4 + 3])]; $cache .= $map_2[$b12 + $b34 + $b56 + $b78]; } return $cache; } /*************************************** This is the public interface for coding. ***************************************/ function encode_string($string, $major, $minor) { if (is_string($string)) { if (_check_major($major) && _check_minor($minor)) { $map_1 = _encode_map_1($major); $map_2 = _encode_map_2($minor); return _encode($string, $map_1, $map_2); } } return FALSE; } function decode_string($string, $major, $minor) { if (is_string($string) && strlen($string) % 4 == 0) { if (_check_major($major) && _check_minor($minor)) { $map_1 = _decode_map_1($minor); $map_2 = _decode_map_2($major); return _decode($string, $map_1, $map_2); } } return FALSE; } ?> This is a sample showing how the code is being used. Hex editors may be of help with the input / output. Example <?php # get and process all of the form data @ $input = htmlspecialchars($_POST["input"]); @ $majorname = htmlspecialchars($_POST["majorname"]); @ $minorname = htmlspecialchars($_POST["minorname"]); @ $majorkey = htmlspecialchars($_POST["majorkey"]); @ $minorkey = htmlspecialchars($_POST["minorkey"]); @ $output = htmlspecialchars($_POST["output"]); # process the submissions by operation # CREATE @ $operation = $_POST["operation"]; if ($operation == "Create") { if (strlen($_POST["majorname"]) == 0) { $majorkey = bin2hex(crypt_major()); } if (strlen($_POST["minorname"]) == 0) { $minorkey = bin2hex(crypt_minor()); } if (strlen($_POST["majorname"]) != 0) { $majorkey = bin2hex(named_major($_POST["majorname"])); } if (strlen($_POST["minorname"]) != 0) { $minorkey = bin2hex(named_minor($_POST["minorname"])); } } # ENCRYPT or DECRYPT function is_hex($char) { if ($char == "0"): return TRUE; elseif ($char == "1"): return TRUE; elseif ($char == "2"): return TRUE; elseif ($char == "3"): return TRUE; elseif ($char == "4"): return TRUE; elseif ($char == "5"): return TRUE; elseif ($char == "6"): return TRUE; elseif ($char == "7"): return TRUE; elseif ($char == "8"): return TRUE; elseif ($char == "9"): return TRUE; elseif ($char == "a"): return TRUE; elseif ($char == "b"): return TRUE; elseif ($char == "c"): return TRUE; elseif ($char == "d"): return TRUE; elseif ($char == "e"): return TRUE; elseif ($char == "f"): return TRUE; else: return FALSE; endif; } function hex2bin($str) { if (strlen($str) % 2 == 0): $string = strtolower($str); else: $string = strtolower("0" . $str); endif; $cache = ""; $temp = str_split($str); for ($index = 0; $index < count($temp) / 2; $index++) { $h1 = $temp[$index * 2]; if (is_hex($h1)) { $h2 = $temp[$index * 2 + 1]; if (is_hex($h2)) { $cache .= chr(hexdec($h1 . $h2)); } else { return FALSE; } } else { return FALSE; } } return $cache; } if ($operation == "Encrypt" || $operation == "Decrypt") { # CHECK FOR ANY ERROR $errors = array(); if (strlen($_POST["input"]) == 0) { $output = ""; } $binmajor = hex2bin($_POST["majorkey"]); if (strlen($_POST["majorkey"]) == 0) { array_push($errors, "There must be a major key."); } elseif ($binmajor == FALSE) { array_push($errors, "The major key must be in hex."); } elseif (_check_major($binmajor) == FALSE) { array_push($errors, "The major key is corrupt."); } $binminor = hex2bin($_POST["minorkey"]); if (strlen($_POST["minorkey"]) == 0) { array_push($errors, "There must be a minor key."); } elseif ($binminor == FALSE) { array_push($errors, "The minor key must be in hex."); } elseif (_check_minor($binminor) == FALSE) { array_push($errors, "The minor key is corrupt."); } if ($_POST["operation"] == "Decrypt") { $bininput = hex2bin(str_replace("\r", "", str_replace("\n", "", $_POST["input"]))); if ($bininput == FALSE) { if (strlen($_POST["input"]) != 0) { array_push($errors, "The input data must be in hex."); } } elseif (strlen($bininput) % 4 != 0) { array_push($errors, "The input data is corrupt."); } } if (count($errors) != 0) { # ERRORS ARE FOUND $output = "ERROR:"; foreach ($errors as $error) { $output .= "\n" . $error; } } elseif (strlen($_POST["input"]) != 0) { # CONTINUE WORKING if ($_POST["operation"] == "Encrypt") { # ENCRYPT $output = substr(chunk_split(bin2hex(encode_string($_POST["input"], $binmajor, $binminor)), 58), 0, -2); } else { # DECRYPT $output = htmlspecialchars(decode_string($bininput, $binmajor, $binminor)); } } } # echo the form with the values filled echo "<P><TEXTAREA class=maintextarea name=input rows=25 cols=25>" . $input . "</TEXTAREA></P>\n"; echo "<P>Major Name:</P>\n"; echo "<P><INPUT id=textbox1 name=majorname value=\"" . $majorname . "\"></P>\n"; echo "<P>Minor Name:</P>\n"; echo "<P><INPUT id=textbox1 name=minorname value=\"" . $minorname . "\"></P>\n"; echo "<DIV style=\"TEXT-ALIGN: center\"><INPUT class=submit type=submit value=Create name=operation>\n"; echo "</DIV>\n"; echo "<P>Major Key:</P>\n"; echo "<P><INPUT id=textbox1 name=majorkey value=\"" . $majorkey . "\"></P>\n"; echo "<P>Minor Key:</P>\n"; echo "<P><INPUT id=textbox1 name=minorkey value=\"" . $minorkey . "\"></P>\n"; echo "<DIV style=\"TEXT-ALIGN: center\"><INPUT class=submit type=submit value=Encrypt name=operation> \n"; echo "<INPUT class=submit type=submit value=Decrypt name=operation> </DIV>\n"; echo "<P>Result:</P>\n"; echo "<P><TEXTAREA class=maintextarea name=output rows=25 readOnly cols=25>" . $output . "</TEXTAREA></P></DIV></FORM>\n"; ?> What should be editted for better memory efficiency or faster execution?

    Read the article

  • What can be improved in this PHP code?

    - by Noctis Skytower
    This is a custom encryption library. I do not know much about PHP's standard library of functions and was wondering if the following code can be improved in any way. The implementation should yield the same results, the API should remain as it is, but ways to make is more PHP-ish would be greatly appreciated. Code <?php /*************************************** Create random major and minor SPICE key. ***************************************/ function crypt_major() { $all = range("\x00", "\xFF"); shuffle($all); $major_key = implode("", $all); return $major_key; } function crypt_minor() { $sample = array(); do { array_push($sample, 0, 1, 2, 3); } while (count($sample) != 256); shuffle($sample); $list = array(); for ($index = 0; $index < 64; $index++) { $b12 = $sample[$index * 4] << 6; $b34 = $sample[$index * 4 + 1] << 4; $b56 = $sample[$index * 4 + 2] << 2; $b78 = $sample[$index * 4 + 3]; array_push($list, $b12 + $b34 + $b56 + $b78); } $minor_key = implode("", array_map("chr", $list)); return $minor_key; } /*************************************** Create the SPICE key via the given name. ***************************************/ function named_major($name) { srand(crc32($name)); return crypt_major(); } function named_minor($name) { srand(crc32($name)); return crypt_minor(); } /*************************************** Check validity for major and minor keys. ***************************************/ function _check_major($key) { if (is_string($key) && strlen($key) == 256) { foreach (range("\x00", "\xFF") as $char) { if (substr_count($key, $char) == 0) { return FALSE; } } return TRUE; } return FALSE; } function _check_minor($key) { if (is_string($key) && strlen($key) == 64) { $indexs = array(); foreach (array_map("ord", str_split($key)) as $byte) { foreach (range(6, 0, 2) as $shift) { array_push($indexs, ($byte >> $shift) & 3); } } $dict = array_count_values($indexs); foreach (range(0, 3) as $index) { if ($dict[$index] != 64) { return FALSE; } } return TRUE; } return FALSE; } /*************************************** Create encode maps for encode functions. ***************************************/ function _encode_map_1($major) { return array_map("ord", str_split($major)); } function _encode_map_2($minor) { $map_2 = array(array(), array(), array(), array()); $list = array(); foreach (array_map("ord", str_split($minor)) as $byte) { foreach (range(6, 0, 2) as $shift) { array_push($list, ($byte >> $shift) & 3); } } for ($byte = 0; $byte < 256; $byte++) { array_push($map_2[$list[$byte]], chr($byte)); } return $map_2; } /*************************************** Create decode maps for decode functions. ***************************************/ function _decode_map_1($minor) { $map_1 = array(); foreach (array_map("ord", str_split($minor)) as $byte) { foreach (range(6, 0, 2) as $shift) { array_push($map_1, ($byte >> $shift) & 3); } } return $map_1; }function _decode_map_2($major) { $map_2 = array(); $temp = array_map("ord", str_split($major)); for ($byte = 0; $byte < 256; $byte++) { $map_2[$temp[$byte]] = chr($byte); } return $map_2; } /*************************************** Encrypt or decrypt the string with maps. ***************************************/ function _encode($string, $map_1, $map_2) { $cache = ""; foreach (str_split($string) as $char) { $byte = $map_1[ord($char)]; foreach (range(6, 0, 2) as $shift) { $cache .= $map_2[($byte >> $shift) & 3][mt_rand(0, 63)]; } } return $cache; } function _decode($string, $map_1, $map_2) { $cache = ""; $temp = str_split($string); for ($iter = 0; $iter < strlen($string) / 4; $iter++) { $b12 = $map_1[ord($temp[$iter * 4])] << 6; $b34 = $map_1[ord($temp[$iter * 4 + 1])] << 4; $b56 = $map_1[ord($temp[$iter * 4 + 2])] << 2; $b78 = $map_1[ord($temp[$iter * 4 + 3])]; $cache .= $map_2[$b12 + $b34 + $b56 + $b78]; } return $cache; } /*************************************** This is the public interface for coding. ***************************************/ function encode_string($string, $major, $minor) { if (is_string($string)) { if (_check_major($major) && _check_minor($minor)) { $map_1 = _encode_map_1($major); $map_2 = _encode_map_2($minor); return _encode($string, $map_1, $map_2); } } return FALSE; } function decode_string($string, $major, $minor) { if (is_string($string) && strlen($string) % 4 == 0) { if (_check_major($major) && _check_minor($minor)) { $map_1 = _decode_map_1($minor); $map_2 = _decode_map_2($major); return _decode($string, $map_1, $map_2); } } return FALSE; } ?> This is a sample showing how the code is being used. Hex editors may be of help with the input / output. Example <?php # get and process all of the form data @ $input = htmlspecialchars($_POST["input"]); @ $majorname = htmlspecialchars($_POST["majorname"]); @ $minorname = htmlspecialchars($_POST["minorname"]); @ $majorkey = htmlspecialchars($_POST["majorkey"]); @ $minorkey = htmlspecialchars($_POST["minorkey"]); @ $output = htmlspecialchars($_POST["output"]); # process the submissions by operation # CREATE @ $operation = $_POST["operation"]; if ($operation == "Create") { if (strlen($_POST["majorname"]) == 0) { $majorkey = bin2hex(crypt_major()); } if (strlen($_POST["minorname"]) == 0) { $minorkey = bin2hex(crypt_minor()); } if (strlen($_POST["majorname"]) != 0) { $majorkey = bin2hex(named_major($_POST["majorname"])); } if (strlen($_POST["minorname"]) != 0) { $minorkey = bin2hex(named_minor($_POST["minorname"])); } } # ENCRYPT or DECRYPT function is_hex($char) { if ($char == "0"): return TRUE; elseif ($char == "1"): return TRUE; elseif ($char == "2"): return TRUE; elseif ($char == "3"): return TRUE; elseif ($char == "4"): return TRUE; elseif ($char == "5"): return TRUE; elseif ($char == "6"): return TRUE; elseif ($char == "7"): return TRUE; elseif ($char == "8"): return TRUE; elseif ($char == "9"): return TRUE; elseif ($char == "a"): return TRUE; elseif ($char == "b"): return TRUE; elseif ($char == "c"): return TRUE; elseif ($char == "d"): return TRUE; elseif ($char == "e"): return TRUE; elseif ($char == "f"): return TRUE; else: return FALSE; endif; } function hex2bin($str) { if (strlen($str) % 2 == 0): $string = strtolower($str); else: $string = strtolower("0" . $str); endif; $cache = ""; $temp = str_split($str); for ($index = 0; $index < count($temp) / 2; $index++) { $h1 = $temp[$index * 2]; if (is_hex($h1)) { $h2 = $temp[$index * 2 + 1]; if (is_hex($h2)) { $cache .= chr(hexdec($h1 . $h2)); } else { return FALSE; } } else { return FALSE; } } return $cache; } if ($operation == "Encrypt" || $operation == "Decrypt") { # CHECK FOR ANY ERROR $errors = array(); if (strlen($_POST["input"]) == 0) { $output = ""; } $binmajor = hex2bin($_POST["majorkey"]); if (strlen($_POST["majorkey"]) == 0) { array_push($errors, "There must be a major key."); } elseif ($binmajor == FALSE) { array_push($errors, "The major key must be in hex."); } elseif (_check_major($binmajor) == FALSE) { array_push($errors, "The major key is corrupt."); } $binminor = hex2bin($_POST["minorkey"]); if (strlen($_POST["minorkey"]) == 0) { array_push($errors, "There must be a minor key."); } elseif ($binminor == FALSE) { array_push($errors, "The minor key must be in hex."); } elseif (_check_minor($binminor) == FALSE) { array_push($errors, "The minor key is corrupt."); } if ($_POST["operation"] == "Decrypt") { $bininput = hex2bin(str_replace("\r", "", str_replace("\n", "", $_POST["input"]))); if ($bininput == FALSE) { if (strlen($_POST["input"]) != 0) { array_push($errors, "The input data must be in hex."); } } elseif (strlen($bininput) % 4 != 0) { array_push($errors, "The input data is corrupt."); } } if (count($errors) != 0) { # ERRORS ARE FOUND $output = "ERROR:"; foreach ($errors as $error) { $output .= "\n" . $error; } } elseif (strlen($_POST["input"]) != 0) { # CONTINUE WORKING if ($_POST["operation"] == "Encrypt") { # ENCRYPT $output = substr(chunk_split(bin2hex(encode_string($_POST["input"], $binmajor, $binminor)), 58), 0, -2); } else { # DECRYPT $output = htmlspecialchars(decode_string($bininput, $binmajor, $binminor)); } } } # echo the form with the values filled echo "<P><TEXTAREA class=maintextarea name=input rows=25 cols=25>" . $input . "</TEXTAREA></P>\n"; echo "<P>Major Name:</P>\n"; echo "<P><INPUT id=textbox1 name=majorname value=\"" . $majorname . "\"></P>\n"; echo "<P>Minor Name:</P>\n"; echo "<P><INPUT id=textbox1 name=minorname value=\"" . $minorname . "\"></P>\n"; echo "<DIV style=\"TEXT-ALIGN: center\"><INPUT class=submit type=submit value=Create name=operation>\n"; echo "</DIV>\n"; echo "<P>Major Key:</P>\n"; echo "<P><INPUT id=textbox1 name=majorkey value=\"" . $majorkey . "\"></P>\n"; echo "<P>Minor Key:</P>\n"; echo "<P><INPUT id=textbox1 name=minorkey value=\"" . $minorkey . "\"></P>\n"; echo "<DIV style=\"TEXT-ALIGN: center\"><INPUT class=submit type=submit value=Encrypt name=operation> \n"; echo "<INPUT class=submit type=submit value=Decrypt name=operation> </DIV>\n"; echo "<P>Result:</P>\n"; echo "<P><TEXTAREA class=maintextarea name=output rows=25 readOnly cols=25>" . $output . "</TEXTAREA></P></DIV></FORM>\n"; ?> What should be editted for better memory efficiency or faster execution?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • How and where to implement basic authentication in Kibana 3

    - by Jabb
    I have put my elasticsearch server behind a Apache reverse proxy that provides basic authentication. Authenticating to Apache directly from the browser works fine. However, when I use Kibana 3 to access the server, I receive authentication errors. Obviously because no auth headers are sent along with Kibana's Ajax calls. I added the below to elastic-angular-client.js in the Kibana vendor directory to implement authentication quick and dirty. But for some reason it does not work. $http.defaults.headers.common.Authorization = 'Basic ' + Base64Encode('user:Password'); What is the best approach and place to implement basic authentication in Kibana? /*! elastic.js - v1.1.1 - 2013-05-24 * https://github.com/fullscale/elastic.js * Copyright (c) 2013 FullScale Labs, LLC; Licensed MIT */ /*jshint browser:true */ /*global angular:true */ 'use strict'; /* Angular.js service wrapping the elastic.js API. This module can simply be injected into your angular controllers. */ angular.module('elasticjs.service', []) .factory('ejsResource', ['$http', function ($http) { return function (config) { var // use existing ejs object if it exists ejs = window.ejs || {}, /* results are returned as a promise */ promiseThen = function (httpPromise, successcb, errorcb) { return httpPromise.then(function (response) { (successcb || angular.noop)(response.data); return response.data; }, function (response) { (errorcb || angular.noop)(response.data); return response.data; }); }; // check if we have a config object // if not, we have the server url so // we convert it to a config object if (config !== Object(config)) { config = {server: config}; } // set url to empty string if it was not specified if (config.server == null) { config.server = ''; } /* implement the elastic.js client interface for angular */ ejs.client = { server: function (s) { if (s == null) { return config.server; } config.server = s; return this; }, post: function (path, data, successcb, errorcb) { $http.defaults.headers.common.Authorization = 'Basic ' + Base64Encode('user:Password'); console.log($http.defaults.headers); path = config.server + path; var reqConfig = {url: path, data: data, method: 'POST'}; return promiseThen($http(angular.extend(reqConfig, config)), successcb, errorcb); }, get: function (path, data, successcb, errorcb) { $http.defaults.headers.common.Authorization = 'Basic ' + Base64Encode('user:Password'); path = config.server + path; // no body on get request, data will be request params var reqConfig = {url: path, params: data, method: 'GET'}; return promiseThen($http(angular.extend(reqConfig, config)), successcb, errorcb); }, put: function (path, data, successcb, errorcb) { $http.defaults.headers.common.Authorization = 'Basic ' + Base64Encode('user:Password'); path = config.server + path; var reqConfig = {url: path, data: data, method: 'PUT'}; return promiseThen($http(angular.extend(reqConfig, config)), successcb, errorcb); }, del: function (path, data, successcb, errorcb) { $http.defaults.headers.common.Authorization = 'Basic ' + Base64Encode('user:Password'); path = config.server + path; var reqConfig = {url: path, data: data, method: 'DELETE'}; return promiseThen($http(angular.extend(reqConfig, config)), successcb, errorcb); }, head: function (path, data, successcb, errorcb) { $http.defaults.headers.common.Authorization = 'Basic ' + Base64Encode('user:Password'); path = config.server + path; // no body on HEAD request, data will be request params var reqConfig = {url: path, params: data, method: 'HEAD'}; return $http(angular.extend(reqConfig, config)) .then(function (response) { (successcb || angular.noop)(response.headers()); return response.headers(); }, function (response) { (errorcb || angular.noop)(undefined); return undefined; }); } }; return ejs; }; }]); UPDATE 1: I implemented Matts suggestion. However, the server returns a weird response. It seems that the authorization header is not working. Could it have to do with the fact, that I am running Kibana on port 81 and elasticsearch on 8181? OPTIONS /solar_vendor/_search HTTP/1.1 Host: 46.252.46.173:8181 User-Agent: Mozilla/5.0 (Windows NT 6.1; WOW64; rv:25.0) Gecko/20100101 Firefox/25.0 Accept: text/html,application/xhtml+xml,application/xml;q=0.9,*/*;q=0.8 Accept-Language: de-de,de;q=0.8,en-us;q=0.5,en;q=0.3 Accept-Encoding: gzip, deflate Origin: http://46.252.46.173:81 Access-Control-Request-Method: POST Access-Control-Request-Headers: authorization,content-type Connection: keep-alive Pragma: no-cache Cache-Control: no-cache This is the response HTTP/1.1 401 Authorization Required Date: Fri, 08 Nov 2013 23:47:02 GMT WWW-Authenticate: Basic realm="Username/Password" Vary: Accept-Encoding Content-Encoding: gzip Content-Length: 346 Connection: close Content-Type: text/html; charset=iso-8859-1 UPDATE 2: Updated all instances with the modified headers in these Kibana files root@localhost:/var/www/kibana# grep -r 'ejsResource(' . ./src/app/controllers/dash.js: $scope.ejs = ejsResource({server: config.elasticsearch, headers: {'Access-Control-Request-Headers': 'Accept, Origin, Authorization', 'Authorization': 'Basic XXXXXXXXXXXXXXXXXXXXXXXXXXXXX=='}}); ./src/app/services/querySrv.js: var ejs = ejsResource({server: config.elasticsearch, headers: {'Access-Control-Request-Headers': 'Accept, Origin, Authorization', 'Authorization': 'Basic XXXXXXXXXXXXXXXXXXXXXXXXXXXXX=='}}); ./src/app/services/filterSrv.js: var ejs = ejsResource({server: config.elasticsearch, headers: {'Access-Control-Request-Headers': 'Accept, Origin, Authorization', 'Authorization': 'Basic XXXXXXXXXXXXXXXXXXXXXXXXXXXXX=='}}); ./src/app/services/dashboard.js: var ejs = ejsResource({server: config.elasticsearch, headers: {'Access-Control-Request-Headers': 'Accept, Origin, Authorization', 'Authorization': 'Basic XXXXXXXXXXXXXXXXXXXXXXXXXXXXX=='}}); And modified my vhost conf for the reverse proxy like this <VirtualHost *:8181> ProxyRequests Off ProxyPass / http://127.0.0.1:9200/ ProxyPassReverse / https://127.0.0.1:9200/ <Location /> Order deny,allow Allow from all AuthType Basic AuthName “Username/Password” AuthUserFile /var/www/cake2.2.4/.htpasswd Require valid-user Header always set Access-Control-Allow-Methods "GET, POST, DELETE, OPTIONS, PUT" Header always set Access-Control-Allow-Headers "Content-Type, X-Requested-With, X-HTTP-Method-Override, Origin, Accept, Authorization" Header always set Access-Control-Allow-Credentials "true" Header always set Cache-Control "max-age=0" Header always set Access-Control-Allow-Origin * </Location> ErrorLog ${APACHE_LOG_DIR}/error.log </VirtualHost> Apache sends back the new response headers but the request header still seems to be wrong somewhere. Authentication just doesn't work. Request Headers OPTIONS /solar_vendor/_search HTTP/1.1 Host: 46.252.26.173:8181 User-Agent: Mozilla/5.0 (Windows NT 6.1; WOW64; rv:25.0) Gecko/20100101 Firefox/25.0 Accept: text/html,application/xhtml+xml,application/xml;q=0.9,*/*;q=0.8 Accept-Language: de-de,de;q=0.8,en-us;q=0.5,en;q=0.3 Accept-Encoding: gzip, deflate Origin: http://46.252.26.173:81 Access-Control-Request-Method: POST Access-Control-Request-Headers: authorization,content-type Connection: keep-alive Pragma: no-cache Cache-Control: no-cache Response Headers HTTP/1.1 401 Authorization Required Date: Sat, 09 Nov 2013 08:48:48 GMT Access-Control-Allow-Methods: GET, POST, DELETE, OPTIONS, PUT Access-Control-Allow-Headers: Content-Type, X-Requested-With, X-HTTP-Method-Override, Origin, Accept, Authorization Access-Control-Allow-Credentials: true Cache-Control: max-age=0 Access-Control-Allow-Origin: * WWW-Authenticate: Basic realm="Username/Password" Vary: Accept-Encoding Content-Encoding: gzip Content-Length: 346 Connection: close Content-Type: text/html; charset=iso-8859-1 SOLUTION: After doing some more research, I found out that this is definitely a configuration issue with regard to CORS. There are quite a few posts available regarding that topic but it appears that in order to solve my problem, it would be necessary to to make some very granular configurations on apache and also make sure that the right stuff is sent from the browser. So I reconsidered the strategy and found a much simpler solution. Just modify the vhost reverse proxy config to move the elastisearch server AND kibana on the same http port. This also adds even better security to Kibana. This is what I did: <VirtualHost *:8181> ProxyRequests Off ProxyPass /bigdatadesk/ http://127.0.0.1:81/bigdatadesk/src/ ProxyPassReverse /bigdatadesk/ http://127.0.0.1:81/bigdatadesk/src/ ProxyPass / http://127.0.0.1:9200/ ProxyPassReverse / https://127.0.0.1:9200/ <Location /> Order deny,allow Allow from all AuthType Basic AuthName “Username/Password” AuthUserFile /var/www/.htpasswd Require valid-user </Location> ErrorLog ${APACHE_LOG_DIR}/error.log </VirtualHost>

    Read the article

  • Trying to randomise a jQuery content slider

    - by alecrust
    Hi everyone, I'm using a very nice jQuery content slider called Easy Slider on my site that I downloaded from Css Globe. The script is excellent and does just what I want - except I can't make it randomise the list, it always scrolls from left to right or right to left! I'm far from good with JavaScript, so my attempts at solving this have been feeble. Although I'm sure it must be an easy fix! If anyone wouldn't mind taking a glance over the script to see if they can spot what I need to change to make it random it would be greatly appreciated! I've tried contacting the original plugin developer but have had no response yet. The comments on the Easy Slider page didn't bear much fruit either unfortunately. I've pasted the script I'm using on my site below: /* * Easy Slider 1.7 - jQuery plugin * written by Alen Grakalic * http://cssglobe.com/post/4004/easy-slider-15-the-easiest-jquery-plugin-for-sliding * * Copyright (c) 2009 Alen Grakalic (http://cssglobe.com) * Dual licensed under the MIT (MIT-LICENSE.txt) * and GPL (GPL-LICENSE.txt) licenses. * * Built for jQuery library * http://jquery.com * */ (function($) { $.fn.easySlider = function(options){ // default configuration properties var defaults = { prevId: 'prevBtn', prevText: 'Previous', nextId: 'nextBtn', nextText: 'Next', controlsShow: true, controlsBefore: '', controlsAfter: '', controlsFade: true, firstId: 'firstBtn', firstText: 'First', firstShow: false, lastId: 'lastBtn', lastText: 'Last', lastShow: false, vertical: false, speed: 800, auto: false, pause: 7000, continuous: false, numeric: false, numericId: 'controls' }; var options = $.extend(defaults, options); this.each(function() { var obj = $(this); var s = $("li", obj).length; var w = $("li", obj).width(); var h = $("li", obj).height(); var clickable = true; obj.width(w); obj.height(h); obj.css("overflow","hidden"); var ts = s-1; var t = 0; $("ul", obj).css('width',s*w); if(options.continuous){ $("ul", obj).prepend($("ul li:last-child", obj).clone().css("margin-left","-"+ w +"px")); $("ul", obj).append($("ul li:nth-child(2)", obj).clone()); $("ul", obj).css('width',(s+1)*w); }; if(!options.vertical) $("li", obj).css('float','left'); if(options.controlsShow){ var html = options.controlsBefore; if(options.numeric){ html += '<ol id="'+ options.numericId +'"></ol>'; } else { if(options.firstShow) html += '<span id="'+ options.firstId +'"><a href=\"javascript:void(0);\">'+ options.firstText +'</a></span>'; html += ' <span id="'+ options.prevId +'"><a href=\"javascript:void(0);\">'+ options.prevText +'</a></span>'; html += ' <span id="'+ options.nextId +'"><a href=\"javascript:void(0);\">'+ options.nextText +'</a></span>'; if(options.lastShow) html += ' <span id="'+ options.lastId +'"><a href=\"javascript:void(0);\">'+ options.lastText +'</a></span>'; }; html += options.controlsAfter; $(obj).after(html); }; if(options.numeric){ for(var i=0;i<s;i++){ $(document.createElement("li")) .attr('id',options.numericId + (i+1)) .html('<a rel='+ i +' href=\"javascript:void(0);\">'+ (i+1) +'</a>') .appendTo($("#"+ options.numericId)) .click(function(){ animate($("a",$(this)).attr('rel'),true); }); }; } else { $("a","#"+options.nextId).click(function(){ animate("next",true); }); $("a","#"+options.prevId).click(function(){ animate("prev",true); }); $("a","#"+options.firstId).click(function(){ animate("first",true); }); $("a","#"+options.lastId).click(function(){ animate("last",true); }); }; function setCurrent(i){ i = parseInt(i)+1; $("li", "#" + options.numericId).removeClass("current"); $("li#" + options.numericId + i).addClass("current"); }; function adjust(){ if(t>ts) t=0; if(t<0) t=ts; if(!options.vertical) { $("ul",obj).css("margin-left",(t*w*-1)); } else { $("ul",obj).css("margin-left",(t*h*-1)); } clickable = true; if(options.numeric) setCurrent(t); }; function animate(dir,clicked){ if (clickable){ clickable = false; var ot = t; switch(dir){ case "next": t = (ot>=ts) ? (options.continuous ? t+1 : ts) : t+1; break; case "prev": t = (t<=0) ? (options.continuous ? t-1 : 0) : t-1; break; case "first": t = 0; break; case "last": t = ts; break; default: t = dir; break; }; var diff = Math.abs(ot-t); var speed = diff*options.speed; if(!options.vertical) { p = (t*w*-1); $("ul",obj).animate( { marginLeft: p }, { queue:false, duration:speed, complete:adjust } ); } else { p = (t*h*-1); $("ul",obj).animate( { marginTop: p }, { queue:false, duration:speed, complete:adjust } ); }; if(!options.continuous && options.controlsFade){ if(t==ts){ $("a","#"+options.nextId).hide(); $("a","#"+options.lastId).hide(); } else { $("a","#"+options.nextId).show(); $("a","#"+options.lastId).show(); }; if(t==0){ $("a","#"+options.prevId).hide(); $("a","#"+options.firstId).hide(); } else { $("a","#"+options.prevId).show(); $("a","#"+options.firstId).show(); }; }; if(clicked) clearTimeout(timeout); if(options.auto && dir=="next" && !clicked){; timeout = setTimeout(function(){ animate("next",false); },diff*options.speed+options.pause); }; }; }; // init var timeout; if(options.auto){; timeout = setTimeout(function(){ animate("next",false); },options.pause); }; if(options.numeric) setCurrent(0); if(!options.continuous && options.controlsFade){ $("a","#"+options.prevId).hide(); $("a","#"+options.firstId).hide(); }; }); }; })(jQuery); Many thanks again! Alec

    Read the article

  • Help modify a javascript code to perform a div scroll

    - by Jamex
    Hi, The code below uses javascript to smoothly scroll content in a div. I don't need the smooth scrolling action, and only need the onclick action for the buttons. I would like to use this code so that if a scroll up/down button is pressed, the scroll would instantaneously jump up/down to a position, just like if you were to press the reset button (see demo link). If the down button is pressed, it would jump down the position of the content div (say 300px) and show the text instantaneously without showing how the scrolling text. I am not familiar with JS, so it you know a shorter way, please suggest. TIA the demo link is HERE The code is > this.easyscroll = function(){ // id of the container element var > id = "myContent"; // navigation > buttons text var nav = ["Scroll Up", > "Scroll Down", "Reset"]; // id for > each navigation button (OPTIONAL) var > navId = ["btnUp", "btnDown", > "btnReset"]; > > // movement speed var speed = 5; > // desired height of the container > element (in pixels) var height = 200; > // // END CONFIG // do not edit > below this line (unless you want to of > course :) ) // > > var obj = > document.getElementById(id); obj.up > = false; obj.down = false; obj.fast = false; > > var container = > document.createElement("div"); var > parent = obj.parentNode; > container.id="easyscroll"; > parent.insertBefore(container,obj); > parent.removeChild(obj); > container.style.position = > "relative"; container.style.height = > height + "px"; > container.style.overflow = "hidden"; > obj.style.position = "absolute"; > obj.style.top = "0"; obj.style.left > = "0"; container.appendChild(obj); var btns = new Array(); var ul = > document.createElement("ul"); > ul.id="easyscrollnav"; for (var > i=0;i<nav.length;i++){ var li = > document.createElement("li"); > li.innerHTML = nav[i]; li.id = > navId[i]; btns.push(li); > ul.appendChild(li); }; > parent.insertBefore(ul,container); > btns[0].onmouseover = function(){ > obj.up = true; this.className = > "over"; }; btns[0].onmouseout = > function(){ obj.up = false; > this.className = ""; }; > btns[1].onmouseover = function(){ > obj.down = true; this.className = > "over"; }; btns[1].onmouseout = > function(){ obj.down = false; > this.className = ""; }; > btns[0].onmousedown = > btns[1].onmousedown = function(){ > obj.fast = true; }; > btns[0].onmouseup = btns[1].onmouseup > = function(){ obj.fast = false; }; btns[2].onmouseover = > function(){ this.className = > "over"; }; btns[2].onmouseout = > function(){ this.className = ""; > }; btns[2].onclick = function(){ > obj.style.top = "0px"; }; > this.start = function(){ var newTop; var objHeight = > obj.offsetHeight; var top = > obj.offsetTop; var fast = (obj.fast) > ? 2 : 1; if(obj.down){ newTop > = ((objHeight+top) > height) ? top-(speed*fast) : top; > obj.style.top = newTop + "px"; > }; if(obj.up){ newTop = > (top < 0) ? top+(speed*fast) : top; > obj.style.top = newTop + "px"; }; > }; obj.interval = > setInterval("start()",50); }; > > > this.addEvent = function(obj,type,fn){ > if(obj.attachEvent){ > obj['e'+type+fn] = fn; > obj[type+fn] = > function(){obj['e'+type+fn](window.event > );} obj.attachEvent('on'+type, > obj[type+fn]); } else { > obj.addEventListener(type,fn,false); > }; }; > addEvent(window,"load",easyscroll);

    Read the article

  • Remove accents from String .NET

    - by developerit
    Private Const ACCENT As String = “ÀÁÂÃÄÅàáâãäåÒÓÔÕÖØòóôõöøÈÉÊËèéêëÌÍÎÏìíîïÙÚÛÜùúûüÿÑñÇç” Private Const SANSACCENT As String = “AAAAAAaaaaaaOOOOOOooooooEEEEeeeeIIIIiiiiUUUUuuuuyNnCc” Public Shared Function FormatForUrl(ByVal uriBase As String) As String If String.IsNullOrEmpty(uriBase) Then Return uriBase End If ‘// Declaration de variables Dim chaine As String = uriBase.Trim.Replace(” “, “-”) chaine = chaine.Replace(” “c, “-”c) chaine = chaine.Replace(“–”, “-”) chaine = chaine.Replace(“‘”c, String.Empty) chaine = chaine.Replace(“?”c, String.Empty) chaine = chaine.Replace(“#”c, String.Empty) chaine = chaine.Replace(“:”c, String.Empty) chaine = chaine.Replace(“;”c, String.Empty) ‘// Conversion des chaines en tableaux de caractŠres Dim tableauSansAccent As Char() = SANSACCENT.ToCharArray Dim tableauAccent As Char() = ACCENT.ToCharArray ‘// Pour chaque accent For i As Integer = 0 To ACCENT.Length – 1 ‘ // Remplacement de l’accent par son ‚quivalent sans accent dans la chaŒne de caractŠres chaine = chaine.Replace(tableauAccent(i).ToString(), tableauSansAccent(i).ToString()) Next ‘// Retour du resultat Return chaine End Function

    Read the article

  • Microsoft and jQuery

    - by Rick Strahl
    The jQuery JavaScript library has been steadily getting more popular and with recent developments from Microsoft, jQuery is also getting ever more exposure on the ASP.NET platform including now directly from Microsoft. jQuery is a light weight, open source DOM manipulation library for JavaScript that has changed how many developers think about JavaScript. You can download it and find more information on jQuery on www.jquery.com. For me jQuery has had a huge impact on how I develop Web applications and was probably the main reason I went from dreading to do JavaScript development to actually looking forward to implementing client side JavaScript functionality. It has also had a profound impact on my JavaScript skill level for me by seeing how the library accomplishes things (and often reviewing the terse but excellent source code). jQuery made an uncomfortable development platform (JavaScript + DOM) a joy to work on. Although jQuery is by no means the only JavaScript library out there, its ease of use, small size, huge community of plug-ins and pure usefulness has made it easily the most popular JavaScript library available today. As a long time jQuery user, I’ve been excited to see the developments from Microsoft that are bringing jQuery to more ASP.NET developers and providing more integration with jQuery for ASP.NET’s core features rather than relying on the ASP.NET AJAX library. Microsoft and jQuery – making Friends jQuery is an open source project but in the last couple of years Microsoft has really thrown its weight behind supporting this open source library as a supported component on the Microsoft platform. When I say supported I literally mean supported: Microsoft now offers actual tech support for jQuery as part of their Product Support Services (PSS) as jQuery integration has become part of several of the ASP.NET toolkits and ships in several of the default Web project templates in Visual Studio 2010. The ASP.NET MVC 3 framework (still in Beta) also uses jQuery for a variety of client side support features including client side validation and we can look forward toward more integration of client side functionality via jQuery in both MVC and WebForms in the future. In other words jQuery is becoming an optional but included component of the ASP.NET platform. PSS support means that support staff will answer jQuery related support questions as part of any support incidents related to ASP.NET which provides some piece of mind to some corporate development shops that require end to end support from Microsoft. In addition to including jQuery and supporting it, Microsoft has also been getting involved in providing development resources for extending jQuery’s functionality via plug-ins. Microsoft’s last version of the Microsoft Ajax Library – which is the successor to the native ASP.NET AJAX Library – included some really cool functionality for client templates, databinding and localization. As it turns out Microsoft has rebuilt most of that functionality using jQuery as the base API and provided jQuery plug-ins of these components. Very recently these three plug-ins were submitted and have been approved for inclusion in the official jQuery plug-in repository and been taken over by the jQuery team for further improvements and maintenance. Even more surprising: The jQuery-templates component has actually been approved for inclusion in the next major update of the jQuery core in jQuery V1.5, which means it will become a native feature that doesn’t require additional script files to be loaded. Imagine this – an open source contribution from Microsoft that has been accepted into a major open source project for a core feature improvement. Microsoft has come a long way indeed! What the Microsoft Involvement with jQuery means to you For Microsoft jQuery support is a strategic decision that affects their direction in client side development, but nothing stopped you from using jQuery in your applications prior to Microsoft’s official backing and in fact a large chunk of developers did so readily prior to Microsoft’s announcement. Official support from Microsoft brings a few benefits to developers however. jQuery support in Visual Studio 2010 means built-in support for jQuery IntelliSense, automatically added jQuery scripts in many projects types and a common base for client side functionality that actually uses what most developers are already using. If you have already been using jQuery and were worried about straying from the Microsoft line and their internal Microsoft Ajax Library – worry no more. With official support and the change in direction towards jQuery Microsoft is now following along what most in the ASP.NET community had already been doing by using jQuery, which is likely the reason for Microsoft’s shift in direction in the first place. ASP.NET AJAX and the Microsoft AJAX Library weren’t bad technology – there was tons of useful functionality buried in these libraries. However, these libraries never got off the ground, mainly because early incarnations were squarely aimed at control/component developers rather than application developers. For all the functionality that these controls provided for control developers they lacked in useful and easily usable application developer functionality that was easily accessible in day to day client side development. The result was that even though Microsoft shipped support for these tools in the box (in .NET 3.5 and 4.0), other than for the internal support in ASP.NET for things like the UpdatePanel and the ASP.NET AJAX Control Toolkit as well as some third party vendors, the Microsoft client libraries were largely ignored by the developer community opening the door for other client side solutions. Microsoft seems to be acknowledging developer choice in this case: Many more developers were going down the jQuery path rather than using the Microsoft built libraries and there seems to be little sense in continuing development of a technology that largely goes unused by the majority of developers. Kudos for Microsoft for recognizing this and gracefully changing directions. Note that even though there will be no further development in the Microsoft client libraries they will continue to be supported so if you’re using them in your applications there’s no reason to start running for the exit in a panic and start re-writing everything with jQuery. Although that might be a reasonable choice in some cases, jQuery and the Microsoft libraries work well side by side so that you can leave existing solutions untouched even as you enhance them with jQuery. The Microsoft jQuery Plug-ins – Solid Core Features One of the most interesting developments in Microsoft’s embracing of jQuery is that Microsoft has started contributing to jQuery via standard mechanism set for jQuery developers: By submitting plug-ins. Microsoft took some of the nicest new features of the unpublished Microsoft Ajax Client Library and re-wrote these components for jQuery and then submitted them as plug-ins to the jQuery plug-in repository. Accepted plug-ins get taken over by the jQuery team and that’s exactly what happened with the three plug-ins submitted by Microsoft with the templating plug-in even getting slated to be published as part of the jQuery core in the next major release (1.5). The following plug-ins are provided by Microsoft: jQuery Templates – a client side template rendering engine jQuery Data Link – a client side databinder that can synchronize changes without code jQuery Globalization – provides formatting and conversion features for dates and numbers The first two are ports of functionality that was slated for the Microsoft Ajax Library while functionality for the globalization library provides functionality that was already found in the original ASP.NET AJAX library. To me all three plug-ins address a pressing need in client side applications and provide functionality I’ve previously used in other incarnations, but with more complete implementations. Let’s take a close look at these plug-ins. jQuery Templates http://api.jquery.com/category/plugins/templates/ Client side templating is a key component for building rich JavaScript applications in the browser. Templating on the client lets you avoid from manually creating markup by creating DOM nodes and injecting them individually into the document via code. Rather you can create markup templates – similar to the way you create classic ASP server markup – and merge data into these templates to render HTML which you can then inject into the document or replace existing content with. Output from templates are rendered as a jQuery matched set and can then be easily inserted into the document as needed. Templating is key to minimize client side code and reduce repeated code for rendering logic. Instead a single template can be used in many places for updating and adding content to existing pages. Further if you build pure AJAX interfaces that rely entirely on client rendering of the initial page content, templates allow you to a use a single markup template to handle all rendering of each specific HTML section/element. I’ve used a number of different client rendering template engines with jQuery in the past including jTemplates (a PHP style templating engine) and a modified version of John Resig’s MicroTemplating engine which I built into my own set of libraries because it’s such a commonly used feature in my client side applications. jQuery templates adds a much richer templating model that allows for sub-templates and access to the data items. Like John Resig’s original Micro Template engine, the core basics of the templating engine create JavaScript code which means that templates can include JavaScript code. To give you a basic idea of how templates work imagine I have an application that downloads a set of stock quotes based on a symbol list then displays them in the document. To do this you can create an ‘item’ template that describes how each of the quotes is renderd as a template inside of the document: <script id="stockTemplate" type="text/x-jquery-tmpl"> <div id="divStockQuote" class="errordisplay" style="width: 500px;"> <div class="label">Company:</div><div><b>${Company}(${Symbol})</b></div> <div class="label">Last Price:</div><div>${LastPrice}</div> <div class="label">Net Change:</div><div> {{if NetChange > 0}} <b style="color:green" >${NetChange}</b> {{else}} <b style="color:red" >${NetChange}</b> {{/if}} </div> <div class="label">Last Update:</div><div>${LastQuoteTimeString}</div> </div> </script> The ‘template’ is little more than HTML with some markup expressions inside of it that define the template language. Notice the embedded ${} expressions which reference data from the quote objects returned from an AJAX call on the server. You can embed any JavaScript or value expression in these template expressions. There are also a number of structural commands like {{if}} and {{each}} that provide for rudimentary logic inside of your templates as well as commands ({{tmpl}} and {{wrap}}) for nesting templates. You can find more about the full set of markup expressions available in the documentation. To load up this data you can use code like the following: <script type="text/javascript"> //var Proxy = new ServiceProxy("../PageMethods/PageMethodsService.asmx/"); $(document).ready(function () { $("#btnGetQuotes").click(GetQuotes); }); function GetQuotes() { var symbols = $("#txtSymbols").val().split(","); $.ajax({ url: "../PageMethods/PageMethodsService.asmx/GetStockQuotes", data: JSON.stringify({ symbols: symbols }), // parameter map type: "POST", // data has to be POSTed contentType: "application/json", timeout: 10000, dataType: "json", success: function (result) { var quotes = result.d; var jEl = $("#stockTemplate").tmpl(quotes); $("#quoteDisplay").empty().append(jEl); }, error: function (xhr, status) { alert(status + "\r\n" + xhr.responseText); } }); }; </script> In this case an ASMX AJAX service is called to retrieve the stock quotes. The service returns an array of quote objects. The result is returned as an object with the .d property (in Microsoft service style) that returns the actual array of quotes. The template is applied with: var jEl = $("#stockTemplate").tmpl(quotes); which selects the template script tag and uses the .tmpl() function to apply the data to it. The result is a jQuery matched set of elements that can then be appended to the quote display element in the page. The template is merged against an array in this example. When the result is an array the template is automatically applied to each each array item. If you pass a single data item – like say a stock quote – the template works exactly the same way but is applied only once. Templates also have access to a $data item which provides the current data item and information about the tempalte that is currently executing. This makes it possible to keep context within the context of the template itself and also to pass context from a parent template to a child template which is very powerful. Templates can be evaluated by using the template selector and calling the .tmpl() function on the jQuery matched set as shown above or you can use the static $.tmpl() function to provide a template as a string. This allows you to dynamically create templates in code or – more likely – to load templates from the server via AJAX calls. In short there are options The above shows off some of the basics, but there’s much for functionality available in the template engine. Check the documentation link for more information and links to additional examples. The plug-in download also comes with a number of examples that demonstrate functionality. jQuery templates will become a native component in jQuery Core 1.5, so it’s definitely worthwhile checking out the engine today and get familiar with this interface. As much as I’m stoked about templating becoming part of the jQuery core because it’s such an integral part of many applications, there are also a couple shortcomings in the current incarnation: Lack of Error Handling Currently if you embed an expression that is invalid it’s simply not rendered. There’s no error rendered into the template nor do the various  template functions throw errors which leaves finding of bugs as a runtime exercise. I would like some mechanism – optional if possible – to be able to get error info of what is failing in a template when it’s rendered. No String Output Templates are always rendered into a jQuery matched set and there’s no way that I can see to directly render to a string. String output can be useful for debugging as well as opening up templating for creating non-HTML string output. Limited JavaScript Access Unlike John Resig’s original MicroTemplating Engine which was entirely based on JavaScript code generation these templates are limited to a few structured commands that can ‘execute’. There’s no code execution inside of script code which means you’re limited to calling expressions available in global objects or the data item passed in. This may or may not be a big deal depending on the complexity of your template logic. Error handling has been discussed quite a bit and it’s likely there will be some solution to that particualar issue by the time jQuery templates ship. The others are relatively minor issues but something to think about anyway. jQuery Data Link http://api.jquery.com/category/plugins/data-link/ jQuery Data Link provides the ability to do two-way data binding between input controls and an underlying object’s properties. The typical scenario is linking a textbox to a property of an object and have the object updated when the text in the textbox is changed and have the textbox change when the value in the object or the entire object changes. The plug-in also supports converter functions that can be applied to provide the conversion logic from string to some other value typically necessary for mapping things like textbox string input to say a number property and potentially applying additional formatting and calculations. In theory this sounds great, however in reality this plug-in has some serious usability issues. Using the plug-in you can do things like the following to bind data: person = { firstName: "rick", lastName: "strahl"}; $(document).ready( function() { // provide for two-way linking of inputs $("form").link(person); // bind to non-input elements explicitly $("#objFirst").link(person, { firstName: { name: "objFirst", convertBack: function (value, source, target) { $(target).text(value); } } }); $("#objLast").link(person, { lastName: { name: "objLast", convertBack: function (value, source, target) { $(target).text(value); } } }); }); This code hooks up two-way linking between a couple of textboxes on the page and the person object. The first line in the .ready() handler provides mapping of object to form field with the same field names as properties on the object. Note that .link() does NOT bind items into the textboxes when you call .link() – changes are mapped only when values change and you move out of the field. Strike one. The two following commands allow manual binding of values to specific DOM elements which is effectively a one-way bind. You specify the object and a then an explicit mapping where name is an ID in the document. The converter is required to explicitly assign the value to the element. Strike two. You can also detect changes to the underlying object and cause updates to the input elements bound. Unfortunately the syntax to do this is not very natural as you have to rely on the jQuery data object. To update an object’s properties and get change notification looks like this: function updateFirstName() { $(person).data("firstName", person.firstName + " (code updated)"); } This works fine in causing any linked fields to be updated. In the bindings above both the firstName input field and objFirst DOM element gets updated. But the syntax requires you to use a jQuery .data() call for each property change to ensure that the changes are tracked properly. Really? Sure you’re binding through multiple layers of abstraction now but how is that better than just manually assigning values? The code savings (if any) are going to be minimal. As much as I would like to have a WPF/Silverlight/Observable-like binding mechanism in client script, this plug-in doesn’t help much towards that goal in its current incarnation. While you can bind values, the ‘binder’ is too limited to be really useful. If initial values can’t be assigned from the mappings you’re going to end up duplicating work loading the data using some other mechanism. There’s no easy way to re-bind data with a different object altogether since updates trigger only through the .data members. Finally, any non-input elements have to be bound via code that’s fairly verbose and frankly may be more voluminous than what you might write by hand for manual binding and unbinding. Two way binding can be very useful but it has to be easy and most importantly natural. If it’s more work to hook up a binding than writing a couple of lines to do binding/unbinding this sort of thing helps very little in most scenarios. In talking to some of the developers the feature set for Data Link is not complete and they are still soliciting input for features and functionality. If you have ideas on how you want this feature to be more useful get involved and post your recommendations. As it stands, it looks to me like this component needs a lot of love to become useful. For this component to really provide value, bindings need to be able to be refreshed easily and work at the object level, not just the property level. It seems to me we would be much better served by a model binder object that can perform these binding/unbinding tasks in bulk rather than a tool where each link has to be mapped first. I also find the choice of creating a jQuery plug-in questionable – it seems a standalone object – albeit one that relies on the jQuery library – would provide a more intuitive interface than the current forcing of options onto a plug-in style interface. Out of the three Microsoft created components this is by far the least useful and least polished implementation at this point. jQuery Globalization http://github.com/jquery/jquery-global Globalization in JavaScript applications often gets short shrift and part of the reason for this is that natively in JavaScript there’s little support for formatting and parsing of numbers and dates. There are a number of JavaScript libraries out there that provide some support for globalization, but most are limited to a particular portion of globalization. As .NET developers we’re fairly spoiled by the richness of APIs provided in the framework and when dealing with client development one really notices the lack of these features. While you may not necessarily need to localize your application the globalization plug-in also helps with some basic tasks for non-localized applications: Dealing with formatting and parsing of dates and time values. Dates in particular are problematic in JavaScript as there are no formatters whatsoever except the .toString() method which outputs a verbose and next to useless long string. With the globalization plug-in you get a good chunk of the formatting and parsing functionality that the .NET framework provides on the server. You can write code like the following for example to format numbers and dates: var date = new Date(); var output = $.format(date, "MMM. dd, yy") + "\r\n" + $.format(date, "d") + "\r\n" + // 10/25/2010 $.format(1222.32213, "N2") + "\r\n" + $.format(1222.33, "c") + "\r\n"; alert(output); This becomes even more useful if you combine it with templates which can also include any JavaScript expressions. Assuming the globalization plug-in is loaded you can create template expressions that use the $.format function. Here’s the template I used earlier for the stock quote again with a couple of formats applied: <script id="stockTemplate" type="text/x-jquery-tmpl"> <div id="divStockQuote" class="errordisplay" style="width: 500px;"> <div class="label">Company:</div><div><b>${Company}(${Symbol})</b></div> <div class="label">Last Price:</div> <div>${$.format(LastPrice,"N2")}</div> <div class="label">Net Change:</div><div> {{if NetChange > 0}} <b style="color:green" >${NetChange}</b> {{else}} <b style="color:red" >${NetChange}</b> {{/if}} </div> <div class="label">Last Update:</div> <div>${$.format(LastQuoteTime,"MMM dd, yyyy")}</div> </div> </script> There are also parsing methods that can parse dates and numbers from strings into numbers easily: alert($.parseDate("25.10.2010")); alert($.parseInt("12.222")); // de-DE uses . for thousands separators As you can see culture specific options are taken into account when parsing. The globalization plugin provides rich support for a variety of locales: Get a list of all available cultures Query cultures for culture items (like currency symbol, separators etc.) Localized string names for all calendar related items (days of week, months) Generated off of .NET’s supported locales In short you get much of the same functionality that you already might be using in .NET on the server side. The plugin includes a huge number of locales and an Globalization.all.min.js file that contains the text defaults for each of these locales as well as small locale specific script files that define each of the locale specific settings. It’s highly recommended that you NOT use the huge globalization file that includes all locales, but rather add script references to only those languages you explicitly care about. Overall this plug-in is a welcome helper. Even if you use it with a single locale (like en-US) and do no other localization, you’ll gain solid support for number and date formatting which is a vital feature of many applications. Changes for Microsoft It’s good to see Microsoft coming out of its shell and away from the ‘not-built-here’ mentality that has been so pervasive in the past. It’s especially good to see it applied to jQuery – a technology that has stood in drastic contrast to Microsoft’s own internal efforts in terms of design, usage model and… popularity. It’s great to see that Microsoft is paying attention to what customers prefer to use and supporting the customer sentiment – even if it meant drastically changing course of policy and moving into a more open and sharing environment in the process. The additional jQuery support that has been introduced in the last two years certainly has made lives easier for many developers on the ASP.NET platform. It’s also nice to see Microsoft submitting proposals through the standard jQuery process of plug-ins and getting accepted for various very useful projects. Certainly the jQuery Templates plug-in is going to be very useful to many especially since it will be baked into the jQuery core in jQuery 1.5. I hope we see more of this type of involvement from Microsoft in the future. Kudos!© Rick Strahl, West Wind Technologies, 2005-2010Posted in jQuery  ASP.NET  

    Read the article

  • WebSocket and Java EE 7 - Getting Ready for JSR 356 (TOTD #181)

    - by arungupta
    WebSocket is developed as part of HTML 5 specification and provides a bi-directional, full-duplex communication channel over a single TCP socket. It provides dramatic improvement over the traditional approaches of Polling, Long-Polling, and Streaming for two-way communication. There is no latency from establishing new TCP connections for each HTTP message. There is a WebSocket API and the WebSocket Protocol. The Protocol defines "handshake" and "framing". The handshake defines how a normal HTTP connection can be upgraded to a WebSocket connection. The framing defines wire format of the message. The design philosophy is to keep the framing minimum to avoid the overhead. Both text and binary data can be sent using the API. WebSocket may look like a competing technology to Server-Sent Events (SSE), but they are not. Here are the key differences: WebSocket can send and receive data from a client. A typical example of WebSocket is a two-player game or a chat application. Server-Sent Events can only push data data to the client. A typical example of SSE is stock ticker or news feed. With SSE, XMLHttpRequest can be used to send data to the server. For server-only updates, WebSockets has an extra overhead and programming can be unecessarily complex. SSE provides a simple and easy-to-use model that is much better suited. SSEs are sent over traditional HTTP and so no modification is required on the server-side. WebSocket require servers that understand the protocol. SSE have several features that are missing from WebSocket such as automatic reconnection, event IDs, and the ability to send arbitrary events. The client automatically tries to reconnect if the connection is closed. The default wait before trying to reconnect is 3 seconds and can be configured by including "retry: XXXX\n" header where XXXX is the milliseconds to wait before trying to reconnect. Event stream can include a unique event identifier. This allows the server to determine which events need to be fired to each client in case the connection is dropped in between. The data can span multiple lines and can be of any text format as long as EventSource message handler can process it. WebSockets provide true real-time updates, SSE can be configured to provide close to real-time by setting appropriate timeouts. OK, so all excited about WebSocket ? Want to convert your POJOs into WebSockets endpoint ? websocket-sdk and GlassFish 4.0 is here to help! The complete source code shown in this project can be downloaded here. On the server-side, the WebSocket SDK converts a POJO into a WebSocket endpoint using simple annotations. Here is how a WebSocket endpoint will look like: @WebSocket(path="/echo")public class EchoBean { @WebSocketMessage public String echo(String message) { return message + " (from your server)"; }} In this code "@WebSocket" is a class-level annotation that declares a POJO to accept WebSocket messages. The path at which the messages are accepted is specified in this annotation. "@WebSocketMessage" indicates the Java method that is invoked when the endpoint receives a message. This method implementation echoes the received message concatenated with an additional string. The client-side HTML page looks like <div style="text-align: center;"> <form action=""> <input onclick="send_echo()" value="Press me" type="button"> <input id="textID" name="message" value="Hello WebSocket!" type="text"><br> </form></div><div id="output"></div> WebSocket allows a full-duplex communication. So the client, a browser in this case, can send a message to a server, a WebSocket endpoint in this case. And the server can send a message to the client at the same time. This is unlike HTTP which follows a "request" followed by a "response". In this code, the "send_echo" method in the JavaScript is invoked on the button click. There is also a <div> placeholder to display the response from the WebSocket endpoint. The JavaScript looks like: <script language="javascript" type="text/javascript"> var wsUri = "ws://localhost:8080/websockets/echo"; var websocket = new WebSocket(wsUri); websocket.onopen = function(evt) { onOpen(evt) }; websocket.onmessage = function(evt) { onMessage(evt) }; websocket.onerror = function(evt) { onError(evt) }; function init() { output = document.getElementById("output"); } function send_echo() { websocket.send(textID.value); writeToScreen("SENT: " + textID.value); } function onOpen(evt) { writeToScreen("CONNECTED"); } function onMessage(evt) { writeToScreen("RECEIVED: " + evt.data); } function onError(evt) { writeToScreen('<span style="color: red;">ERROR:</span> ' + evt.data); } function writeToScreen(message) { var pre = document.createElement("p"); pre.style.wordWrap = "break-word"; pre.innerHTML = message; output.appendChild(pre); } window.addEventListener("load", init, false);</script> In this code The URI to connect to on the server side is of the format ws://<HOST>:<PORT>/websockets/<PATH> "ws" is a new URI scheme introduced by the WebSocket protocol. <PATH> is the path on the endpoint where the WebSocket messages are accepted. In our case, it is ws://localhost:8080/websockets/echo WEBSOCKET_SDK-1 will ensure that context root is included in the URI as well. WebSocket is created as a global object so that the connection is created only once. This object establishes a connection with the given host, port and the path at which the endpoint is listening. The WebSocket API defines several callbacks that can be registered on specific events. The "onopen", "onmessage", and "onerror" callbacks are registered in this case. The callbacks print a message on the browser indicating which one is called and additionally also prints the data sent/received. On the button click, the WebSocket object is used to transmit text data to the endpoint. Binary data can be sent as one blob or using buffering. The HTTP request headers sent for the WebSocket call are: GET ws://localhost:8080/websockets/echo HTTP/1.1Origin: http://localhost:8080Connection: UpgradeSec-WebSocket-Extensions: x-webkit-deflate-frameHost: localhost:8080Sec-WebSocket-Key: mDbnYkAUi0b5Rnal9/cMvQ==Upgrade: websocketSec-WebSocket-Version: 13 And the response headers received are Connection:UpgradeSec-WebSocket-Accept:q4nmgFl/lEtU2ocyKZ64dtQvx10=Upgrade:websocket(Challenge Response):00:00:00:00:00:00:00:00:00:00:00:00:00:00:00:00 The headers are shown in Chrome as shown below: The complete source code shown in this project can be downloaded here. The builds from websocket-sdk are integrated in GlassFish 4.0 builds. Would you like to live on the bleeding edge ? Then follow the instructions below to check out the workspace and install the latest SDK: Check out the source code svn checkout https://svn.java.net/svn/websocket-sdk~source-code-repository Build and install the trunk in your local repository as: mvn install Copy "./bundles/websocket-osgi/target/websocket-osgi-0.3-SNAPSHOT.jar" to "glassfish3/glassfish/modules/websocket-osgi.jar" in your GlassFish 4 latest promoted build. Notice, you need to overwrite the JAR file. Anybody interested in building a cool application using WebSocket and get it running on GlassFish ? :-) This work will also feed into JSR 356 - Java API for WebSocket. On a lighter side, there seems to be less agreement on the name. Here are some of the options that are prevalent: WebSocket (W3C API, the URL is www.w3.org/TR/websockets though) Web Socket (HTML5 Demos - html5demos.com/web-socket) Websocket (Jenkins Plugin - wiki.jenkins-ci.org/display/JENKINS/Websocket%2BPlugin) WebSockets (Used by Mozilla - developer.mozilla.org/en/WebSockets, but use WebSocket as well) Web sockets (HTML5 Working Group - www.whatwg.org/specs/web-apps/current-work/multipage/network.html) Web Sockets (Chrome Blog - blog.chromium.org/2009/12/web-sockets-now-available-in-google.html) I prefer "WebSocket" as that seems to be most common usage and used by the W3C API as well. What do you use ?

    Read the article

  • Using HTML 5 SessionState to save rendered Page Content

    - by Rick Strahl
    HTML 5 SessionState and LocalStorage are very useful and super easy to use to manage client side state. For building rich client side or SPA style applications it's a vital feature to be able to cache user data as well as HTML content in order to swap pages in and out of the browser's DOM. What might not be so obvious is that you can also use the sessionState and localStorage objects even in classic server rendered HTML applications to provide caching features between pages. These APIs have been around for a long time and are supported by most relatively modern browsers and even all the way back to IE8, so you can use them safely in your Web applications. SessionState and LocalStorage are easy The APIs that make up sessionState and localStorage are very simple. Both object feature the same API interface which  is a simple, string based key value store that has getItem, setItem, removeitem, clear and  key methods. The objects are also pseudo array objects and so can be iterated like an array with  a length property and you have array indexers to set and get values with. Basic usage  for storing and retrieval looks like this (using sessionStorage, but the syntax is the same for localStorage - just switch the objects):// set var lastAccess = new Date().getTime(); if (sessionStorage) sessionStorage.setItem("myapp_time", lastAccess.toString()); // retrieve in another page or on a refresh var time = null; if (sessionStorage) time = sessionStorage.getItem("myapp_time"); if (time) time = new Date(time * 1); else time = new Date(); sessionState stores data that is browser session specific and that has a liftetime of the active browser session or window. Shut down the browser or tab and the storage goes away. localStorage uses the same API interface, but the lifetime of the data is permanently stored in the browsers storage area until deleted via code or by clearing out browser cookies (not the cache). Both sessionStorage and localStorage space is limited. The spec is ambiguous about this - supposedly sessionStorage should allow for unlimited size, but it appears that most WebKit browsers support only 2.5mb for either object. This means you have to be careful what you store especially since other applications might be running on the same domain and also use the storage mechanisms. That said 2.5mb worth of character data is quite a bit and would go a long way. The easiest way to get a feel for how sessionState and localStorage work is to look at a simple example. You can go check out the following example online in Plunker: http://plnkr.co/edit/0ICotzkoPjHaWa70GlRZ?p=preview which looks like this: Plunker is an online HTML/JavaScript editor that lets you write and run Javascript code and similar to JsFiddle, but a bit cleaner to work in IMHO (thanks to John Papa for turning me on to it). The sample has two text boxes with counts that update session/local storage every time you click the related button. The counts are 'cached' in Session and Local storage. The point of these examples is that both counters survive full page reloads, and the LocalStorage counter survives a complete browser shutdown and restart. Go ahead and try it out by clicking the Reload button after updating both counters and then shutting down the browser completely and going back to the same URL (with the same browser). What you should see is that reloads leave both counters intact at the counted values, while a browser restart will leave only the local storage counter intact. The code to deal with the SessionStorage (and LocalStorage not shown here) in the example is isolated into a couple of wrapper methods to simplify the code: function getSessionCount() { var count = 0; if (sessionStorage) { var count = sessionStorage.getItem("ss_count"); count = !count ? 0 : count * 1; } $("#txtSession").val(count); return count; } function setSessionCount(count) { if (sessionStorage) sessionStorage.setItem("ss_count", count.toString()); } These two functions essentially load and store a session counter value. The two key methods used here are: sessionStorage.getItem(key); sessionStorage.setItem(key,stringVal); Note that the value given to setItem and return by getItem has to be a string. If you pass another type you get an error. Don't let that limit you though - you can easily enough store JSON data in a variable so it's quite possible to pass complex objects and store them into a single sessionStorage value:var user = { name: "Rick", id="ricks", level=8 } sessionStorage.setItem("app_user",JSON.stringify(user)); to retrieve it:var user = sessionStorage.getItem("app_user"); if (user) user = JSON.parse(user); Simple! If you're using the Chrome Developer Tools (F12) you can also check out the session and local storage state on the Resource tab:   You can also use this tool to refresh or remove entries from storage. What we just looked at is a purely client side implementation where a couple of counters are stored. For rich client centric AJAX applications sessionStorage and localStorage provide a very nice and simple API to store application state while the application is running. But you can also use these storage mechanisms to manage server centric HTML applications when you combine server rendering with some JavaScript to perform client side data caching. You can both store some state information and data on the client (ie. store a JSON object and carry it forth between server rendered HTML requests) or you can use it for good old HTTP based caching where some rendered HTML is saved and then restored later. Let's look at the latter with a real life example. Why do I need Client-side Page Caching for Server Rendered HTML? I don't know about you, but in a lot of my existing server driven applications I have lists that display a fair amount of data. Typically these lists contain links to then drill down into more specific data either for viewing or editing. You can then click on a link and go off to a detail page that provides more concise content. So far so good. But now you're done with the detail page and need to get back to the list, so you click on a 'bread crumbs trail' or an application level 'back to list' button and… …you end up back at the top of the list - the scroll position, the current selection in some cases even filters conditions - all gone with the wind. You've left behind the state of the list and are starting from scratch in your browsing of the list from the top. Not cool! Sound familiar? This a pretty common scenario with server rendered HTML content where it's so common to display lists to drill into, only to lose state in the process of returning back to the original list. Look at just about any traditional forums application, or even StackOverFlow to see what I mean here. Scroll down a bit to look at a post or entry, drill in then use the bread crumbs or tab to go back… In some cases returning to the top of a list is not a big deal. On StackOverFlow that sort of works because content is turning around so quickly you probably want to actually look at the top posts. Not always though - if you're browsing through a list of search topics you're interested in and drill in there's no way back to that position. Essentially anytime you're actively browsing the items in the list, that's when state becomes important and if it's not handled the user experience can be really disrupting. Content Caching If you're building client centric SPA style applications this is a fairly easy to solve problem - you tend to render the list once and then update the page content to overlay the detail content, only hiding the list temporarily until it's used again later. It's relatively easy to accomplish this simply by hiding content on the page and later making it visible again. But if you use server rendered content, hanging on to all the detail like filters, selections and scroll position is not quite as easy. Or is it??? This is where sessionStorage comes in handy. What if we just save the rendered content of a previous page, and then restore it when we return to this page based on a special flag that tells us to use the cached version? Let's see how we can do this. A real World Use Case Recently my local ISP asked me to help out with updating an ancient classifieds application. They had a very busy, local classifieds app that was originally an ASP classic application. The old app was - wait for it: frames based - and even though I lobbied against it, the decision was made to keep the frames based layout to allow rapid browsing of the hundreds of posts that are made on a daily basis. The primary reason they wanted this was precisely for the ability to quickly browse content item by item. While I personally hate working with Frames, I have to admit that the UI actually works well with the frames layout as long as you're running on a large desktop screen. You can check out the frames based desktop site here: http://classifieds.gorge.net/ However when I rebuilt the app I also added a secondary view that doesn't use frames. The main reason for this of course was for mobile displays which work horribly with frames. So there's a somewhat mobile friendly interface to the interface, which ditches the frames and uses some responsive design tweaking for mobile capable operation: http://classifeds.gorge.net/mobile  (or browse the base url with your browser width under 800px)   Here's what the mobile, non-frames view looks like:   As you can see this means that the list of classifieds posts now is a list and there's a separate page for drilling down into the item. And of course… originally we ran into that usability issue I mentioned earlier where the browse, view detail, go back to the list cycle resulted in lost list state. Originally in mobile mode you scrolled through the list, found an item to look at and drilled in to display the item detail. Then you clicked back to the list and BAM - you've lost your place. Because there are so many items added on a daily basis the full list is never fully loaded, but rather there's a "Load Additional Listings"  entry at the button. Not only did we originally lose our place when coming back to the list, but any 'additionally loaded' items are no longer there because the list was now rendering  as if it was the first page hit. The additional listings, and any filters, the selection of an item all were lost. Major Suckage! Using Client SessionStorage to cache Server Rendered Content To work around this problem I decided to cache the rendered page content from the list in SessionStorage. Anytime the list renders or is updated with Load Additional Listings, the page HTML is cached and stored in Session Storage. Any back links from the detail page or the login or write entry forms then point back to the list page with a back=true query string parameter. If the server side sees this parameter it doesn't render the part of the page that is cached. Instead the client side code retrieves the data from the sessionState cache and simply inserts it into the page. It sounds pretty simple, and the overall the process is really easy, but there are a few gotchas that I'll discuss in a minute. But first let's look at the implementation. Let's start with the server side here because that'll give a quick idea of the doc structure. As I mentioned the server renders data from an ASP.NET MVC view. On the list page when returning to the list page from the display page (or a host of other pages) looks like this: https://classifieds.gorge.net/list?back=True The query string value is a flag, that indicates whether the server should render the HTML. Here's what the top level MVC Razor view for the list page looks like:@model MessageListViewModel @{ ViewBag.Title = "Classified Listing"; bool isBack = !string.IsNullOrEmpty(Request.QueryString["back"]); } <form method="post" action="@Url.Action("list")"> <div id="SizingContainer"> @if (!isBack) { @Html.Partial("List_CommandBar_Partial", Model) <div id="PostItemContainer" class="scrollbox" xstyle="-webkit-overflow-scrolling: touch;"> @Html.Partial("List_Items_Partial", Model) @if (Model.RequireLoadEntry) { <div class="postitem loadpostitems" style="padding: 15px;"> <div id="LoadProgress" class="smallprogressright"></div> <div class="control-progress"> Load additional listings... </div> </div> } </div> } </div> </form> As you can see the query string triggers a conditional block that if set is simply not rendered. The content inside of #SizingContainer basically holds  the entire page's HTML sans the headers and scripts, but including the filter options and menu at the top. In this case this makes good sense - in other situations the fact that the menu or filter options might be dynamically updated might make you only cache the list rather than essentially the entire page. In this particular instance all of the content works and produces the proper result as both the list along with any filter conditions in the form inputs are restored. Ok, let's move on to the client. On the client there are two page level functions that deal with saving and restoring state. Like the counter example I showed earlier, I like to wrap the logic to save and restore values from sessionState into a separate function because they are almost always used in several places.page.saveData = function(id) { if (!sessionStorage) return; var data = { id: id, scroll: $("#PostItemContainer").scrollTop(), html: $("#SizingContainer").html() }; sessionStorage.setItem("list_html",JSON.stringify(data)); }; page.restoreData = function() { if (!sessionStorage) return; var data = sessionStorage.getItem("list_html"); if (!data) return null; return JSON.parse(data); }; The data that is saved is an object which contains an ID which is the selected element when the user clicks and a scroll position. These two values are used to reset the scroll position when the data is used from the cache. Finally the html from the #SizingContainer element is stored, which makes for the bulk of the document's HTML. In this application the HTML captured could be a substantial bit of data. If you recall, I mentioned that the server side code renders a small chunk of data initially and then gets more data if the user reads through the first 50 or so items. The rest of the items retrieved can be rather sizable. Other than the JSON deserialization that's Ok. Since I'm using SessionStorage the storage space has no immediate limits. Next is the core logic to handle saving and restoring the page state. At first though this would seem pretty simple, and in some cases it might be, but as the following code demonstrates there are a few gotchas to watch out for. Here's the relevant code I use to save and restore:$( function() { … var isBack = getUrlEncodedKey("back", location.href); if (isBack) { // remove the back key from URL setUrlEncodedKey("back", "", location.href); var data = page.restoreData(); // restore from sessionState if (!data) { // no data - force redisplay of the server side default list window.location = "list"; return; } $("#SizingContainer").html(data.html); var el = $(".postitem[data-id=" + data.id + "]"); $(".postitem").removeClass("highlight"); el.addClass("highlight"); $("#PostItemContainer").scrollTop(data.scroll); setTimeout(function() { el.removeClass("highlight"); }, 2500); } else if (window.noFrames) page.saveData(null); // save when page loads $("#SizingContainer").on("click", ".postitem", function() { var id = $(this).attr("data-id"); if (!id) return true; if (window.noFrames) page.saveData(id); var contentFrame = window.parent.frames["Content"]; if (contentFrame) contentFrame.location.href = "show/" + id; else window.location.href = "show/" + id; return false; }); … The code starts out by checking for the back query string flag which triggers restoring from the client cache. If cached the cached data structure is read from sessionStorage. It's important here to check if data was returned. If the user had back=true on the querystring but there is no cached data, he likely bookmarked this page or otherwise shut down the browser and came back to this URL. In that case the server didn't render any detail and we have no cached data, so all we can do is redirect to the original default list view using window.location. If we continued the page would render no data - so make sure to always check the cache retrieval result. Always! If there is data the it's loaded and the data.html data is restored back into the document by simply injecting the HTML back into the document's #SizingContainer element:$("#SizingContainer").html(data.html); It's that simple and it's quite quick even with a fully loaded list of additional items and on a phone. The actual HTML data is stored to the cache on every page load initially and then again when the user clicks on an element to navigate to a particular listing. The former ensures that the client cache always has something in it, and the latter updates with additional information for the selected element. For the click handling I use a data-id attribute on the list item (.postitem) in the list and retrieve the id from that. That id is then used to navigate to the actual entry as well as storing that Id value in the saved cached data. The id is used to reset the selection by searching for the data-id value in the restored elements. The overall process of this save/restore process is pretty straight forward and it doesn't require a bunch of code, yet it yields a huge improvement in the usability of the site on mobile devices (or anybody who uses the non-frames view). Some things to watch out for As easy as it conceptually seems to simply store and retrieve cached content, you have to be quite aware what type of content you are caching. The code above is all that's specific to cache/restore cycle and it works, but it took a few tweaks to the rest of the script code and server code to make it all work. There were a few gotchas that weren't immediately obvious. Here are a few things to pay attention to: Event Handling Logic Timing of manipulating DOM events Inline Script Code Bookmarking to the Cache Url when no cache exists Do you have inline script code in your HTML? That script code isn't going to run if you restore from cache and simply assign or it may not run at the time you think it would normally in the DOM rendering cycle. JavaScript Event Hookups The biggest issue I ran into with this approach almost immediately is that originally I had various static event handlers hooked up to various UI elements that are now cached. If you have an event handler like:$("#btnSearch").click( function() {…}); that works fine when the page loads with server rendered HTML, but that code breaks when you now load the HTML from cache. Why? Because the elements you're trying to hook those events to may not actually be there - yet. Luckily there's an easy workaround for this by using deferred events. With jQuery you can use the .on() event handler instead:$("#SelectionContainer").on("click","#btnSearch", function() {…}); which monitors a parent element for the events and checks for the inner selector elements to handle events on. This effectively defers to runtime event binding, so as more items are added to the document bindings still work. For any cached content use deferred events. Timing of manipulating DOM Elements Along the same lines make sure that your DOM manipulation code follows the code that loads the cached content into the page so that you don't manipulate DOM elements that don't exist just yet. Ideally you'll want to check for the condition to restore cached content towards the top of your script code, but that can be tricky if you have components or other logic that might not all run in a straight line. Inline Script Code Here's another small problem I ran into: I use a DateTime Picker widget I built a while back that relies on the jQuery date time picker. I also created a helper function that allows keyboard date navigation into it that uses JavaScript logic. Because MVC's limited 'object model' the only way to embed widget content into the page is through inline script. This code broken when I inserted the cached HTML into the page because the script code was not available when the component actually got injected into the page. As the last bullet - it's a matter of timing. There's no good work around for this - in my case I pulled out the jQuery date picker and relied on native <input type="date" /> logic instead - a better choice these days anyway, especially since this view is meant to be primarily to serve mobile devices which actually support date input through the browser (unlike desktop browsers of which only WebKit seems to support it). Bookmarking Cached Urls When you cache HTML content you have to make a decision whether you cache on the client and also not render that same content on the server. In the Classifieds app I didn't render server side content so if the user comes to the page with back=True and there is no cached content I have to a have a Plan B. Typically this happens when somebody ends up bookmarking the back URL. The easiest and safest solution for this scenario is to ALWAYS check the cache result to make sure it exists and if not have a safe URL to go back to - in this case to the plain uncached list URL which amounts to effectively redirecting. This seems really obvious in hindsight, but it's easy to overlook and not see a problem until much later, when it's not obvious at all why the page is not rendering anything. Don't use <body> to replace Content Since we're practically replacing all the HTML in the page it may seem tempting to simply replace the HTML content of the <body> tag. Don't. The body tag usually contains key things that should stay in the page and be there when it loads. Specifically script tags and elements and possibly other embedded content. It's best to create a top level DOM element specifically as a placeholder container for your cached content and wrap just around the actual content you want to replace. In the app above the #SizingContainer is that container. Other Approaches The approach I've used for this application is kind of specific to the existing server rendered application we're running and so it's just one approach you can take with caching. However for server rendered content caching this is a pattern I've used in a few apps to retrofit some client caching into list displays. In this application I took the path of least resistance to the existing server rendering logic. Here are a few other ways that come to mind: Using Partial HTML Rendering via AJAXInstead of rendering the page initially on the server, the page would load empty and the client would render the UI by retrieving the respective HTML and embedding it into the page from a Partial View. This effectively makes the initial rendering and the cached rendering logic identical and removes the server having to decide whether this request needs to be rendered or not (ie. not checking for a back=true switch). All the logic related to caching is made on the client in this case. Using JSON Data and Client RenderingThe hardcore client option is to do the whole UI SPA style and pull data from the server and then use client rendering or databinding to pull the data down and render using templates or client side databinding with knockout/angular et al. As with the Partial Rendering approach the advantage is that there's no difference in the logic between pulling the data from cache or rendering from scratch other than the initial check for the cache request. Of course if the app is a  full on SPA app, then caching may not be required even - the list could just stay in memory and be hidden and reactivated. I'm sure there are a number of other ways this can be handled as well especially using  AJAX. AJAX rendering might simplify the logic, but it also complicates search engine optimization since there's no content loaded initially. So there are always tradeoffs and it's important to look at all angles before deciding on any sort of caching solution in general. State of the Session SessionState and LocalStorage are easy to use in client code and can be integrated even with server centric applications to provide nice caching features of content and data. In this post I've shown a very specific scenario of storing HTML content for the purpose of remembering list view data and state and making the browsing experience for lists a bit more friendly, especially if there's dynamically loaded content involved. If you haven't played with sessionStorage or localStorage I encourage you to give it a try. There's a lot of cool stuff that you can do with this beyond the specific scenario I've covered here… Resources Overview of localStorage (also applies to sessionStorage) Web Storage Compatibility Modernizr Test Suite© Rick Strahl, West Wind Technologies, 2005-2013Posted in JavaScript  HTML5  ASP.NET  MVC   Tweet !function(d,s,id){var js,fjs=d.getElementsByTagName(s)[0];if(!d.getElementById(id)){js=d.createElement(s);js.id=id;js.src="//platform.twitter.com/widgets.js";fjs.parentNode.insertBefore(js,fjs);}}(document,"script","twitter-wjs"); (function() { var po = document.createElement('script'); po.type = 'text/javascript'; po.async = true; po.src = 'https://apis.google.com/js/plusone.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(po, s); })();

    Read the article

  • Oracle WebCenter - Well Connected

    - by Brian Dirking
    800x600 Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Calibri","sans-serif"; mso-bidi-font-family:"Times New Roman";} An good post from Dan Elam on the state of the ECM industry (http://www.aiim.org/community/blogs/community/ECM-Vendors-go-to-War) . For those of you who don’t know Dan, he is one of the major forces in the content management industry. He founded eVisory and IMERGE Consulting, he is an AIIM Fellow and a former US Technical Expert to the International Standards Organization (ISO), and has been a driving force behind EmTag, AIIM’s Emerging Technologies Group. His post is interesting – it starts out talking about our Moveoff Documentum campaign, but then it becomes a much deeper insight into the ECM industry. Dan points out that Oracle has been making quiet strides in the ECM industry. In fact, analysts share this view Oracle, pointing out Oracle is growing greater than 20% annually while many of the big vendors are shrinking. And as Dan points out, this cements Oracle as one of the big five in the ECM space – the same week that Autonomy was removed from the Gartner Magic Quadrant for ECM. One of the key things points out is that Oracle WebCenter is well connected. WebCenter has out-of-the-box connections to key enterprise applications such as E-Business Suite, PeopleSoft, Siebel and JD Edwards. Those out-of-the-box integrations make it easy for organizations to drive content right into the places where it is needed, in the midst of business processes. At the same time, WebCenter provides composite interface capabilities to bring together two or more of these enterprise applications onto the same screen. Combine that with the capabilities of Oracle Social Network, you start to see how Oracle is providing a full platform for user engagement. But beyond those connections, WebCenter can also connect to other content management systems. It can index and search those systems from a single point of search, bringing back results in a single combined hitlist. WebCenter can also extend records management capabilities into Documentum, SharePoint, and email archiving systems. From a single console, records managers can define a series, set a retention schedule, and place holds – without having to go to each system to make these updates. Dan points out that there are some new competitive dynamics – to be sure. And it is interesting when a system can interact with another system, enforce dispositions and holds, and enable users to search and retrieve content. Oracle WebCenter is providing the infrastructure to build on, and the interfaces to drive user engagement. It’s an interesting time.

    Read the article

  • Why won't xattr PECL extension build on 12.10?

    - by Dan Jones
    I was using the xattr pecl extension in 12.04 (in fact, I think since 10.04) without problem. Not surprisingly, I had to reinstall it after upgrading to 12.10 because of the new version of PHP. But now it fails to build, and I can't figure out why. Other PECL extensions have built fine. And I have libattr1 and libattr1-dev installed. Here's the output from the build: downloading xattr-1.1.0.tgz ... Starting to download xattr-1.1.0.tgz (5,204 bytes) .....done: 5,204 bytes 3 source files, building running: phpize Configuring for: PHP Api Version: 20100412 Zend Module Api No: 20100525 Zend Extension Api No: 220100525 libattr library installation dir? [autodetect] : building in /tmp/pear/temp/pear-build-rootdSMx0G/xattr-1.1.0 running: /tmp/pear/temp/xattr/configure --with-xattr checking for grep that handles long lines and -e... /bin/grep checking for egrep... /bin/grep -E checking for a sed that does not truncate output... /bin/sed checking for cc... cc checking whether the C compiler works... yes checking for C compiler default output file name... a.out checking for suffix of executables... checking whether we are cross compiling... no checking for suffix of object files... o checking whether we are using the GNU C compiler... yes checking whether cc accepts -g... yes checking for cc option to accept ISO C89... none needed checking how to run the C preprocessor... cc -E checking for icc... no checking for suncc... no checking whether cc understands -c and -o together... yes checking for system library directory... lib checking if compiler supports -R... no checking if compiler supports -Wl,-rpath,... yes checking build system type... x86_64-unknown-linux-gnu checking host system type... x86_64-unknown-linux-gnu checking target system type... x86_64-unknown-linux-gnu checking for PHP prefix... /usr checking for PHP includes... -I/usr/include/php5 -I/usr/include/php5/main -I/usr/include/php5/TSRM -I/usr/include/php5/Zend -I/usr/include/php5/ext -I/usr/include/php5/ext/date/lib checking for PHP extension directory... /usr/lib/php5/20100525 checking for PHP installed headers prefix... /usr/include/php5 checking if debug is enabled... no checking if zts is enabled... no checking for re2c... re2c checking for re2c version... 0.13.5 (ok) checking for gawk... gawk checking for xattr support... yes, shared checking for xattr files in default path... found in /usr checking for attr_get in -lattr... yes checking how to print strings... printf checking for a sed that does not truncate output... (cached) /bin/sed checking for fgrep... /bin/grep -F checking for ld used by cc... /usr/bin/ld checking if the linker (/usr/bin/ld) is GNU ld... yes checking for BSD- or MS-compatible name lister (nm)... /usr/bin/nm -B checking the name lister (/usr/bin/nm -B) interface... BSD nm checking whether ln -s works... yes checking the maximum length of command line arguments... 1572864 checking whether the shell understands some XSI constructs... yes checking whether the shell understands "+="... yes checking how to convert x86_64-unknown-linux-gnu file names to x86_64-unknown-linux-gnu format... func_convert_file_noop checking how to convert x86_64-unknown-linux-gnu file names to toolchain format... func_convert_file_noop checking for /usr/bin/ld option to reload object files... -r checking for objdump... objdump checking how to recognize dependent libraries... pass_all checking for dlltool... no checking how to associate runtime and link libraries... printf %s\n checking for ar... ar checking for archiver @FILE support... @ checking for strip... strip checking for ranlib... ranlib checking for gawk... (cached) gawk checking command to parse /usr/bin/nm -B output from cc object... ok checking for sysroot... no checking for mt... mt checking if mt is a manifest tool... no checking for ANSI C header files... yes checking for sys/types.h... yes checking for sys/stat.h... yes checking for stdlib.h... yes checking for string.h... yes checking for memory.h... yes checking for strings.h... yes checking for inttypes.h... yes checking for stdint.h... yes checking for unistd.h... yes checking for dlfcn.h... yes checking for objdir... .libs checking if cc supports -fno-rtti -fno-exceptions... no checking for cc option to produce PIC... -fPIC -DPIC checking if cc PIC flag -fPIC -DPIC works... yes checking if cc static flag -static works... yes checking if cc supports -c -o file.o... yes checking if cc supports -c -o file.o... (cached) yes checking whether the cc linker (/usr/bin/ld -m elf_x86_64) supports shared libraries... yes checking whether -lc should be explicitly linked in... no checking dynamic linker characteristics... GNU/Linux ld.so checking how to hardcode library paths into programs... immediate checking whether stripping libraries is possible... yes checking if libtool supports shared libraries... yes checking whether to build shared libraries... yes checking whether to build static libraries... no configure: creating ./config.status config.status: creating config.h config.status: executing libtool commands running: make /bin/bash /tmp/pear/temp/pear-build-rootdSMx0G/xattr-1.1.0/libtool --mode=compile cc -I. -I/tmp/pear/temp/xattr -DPHP_ATOM_INC -I/tmp/pear/temp/pear-build-rootdSMx0G/xattr-1.1.0/include -I/tmp/pear/temp/pear-build-rootdSMx0G/xattr-1.1.0/main -I/tmp/pear/temp/xattr -I/usr/include/php5 -I/usr/include/php5/main -I/usr/include/php5/TSRM -I/usr/include/php5/Zend -I/usr/include/php5/ext -I/usr/include/php5/ext/date/lib -DHAVE_CONFIG_H -g -O2 -c /tmp/pear/temp/xattr/xattr.c -o xattr.lo libtool: compile: cc -I. -I/tmp/pear/temp/xattr -DPHP_ATOM_INC -I/tmp/pear/temp/pear-build-rootdSMx0G/xattr-1.1.0/include -I/tmp/pear/temp/pear-build-rootdSMx0G/xattr-1.1.0/main -I/tmp/pear/temp/xattr -I/usr/include/php5 -I/usr/include/php5/main -I/usr/include/php5/TSRM -I/usr/include/php5/Zend -I/usr/include/php5/ext -I/usr/include/php5/ext/date/lib -DHAVE_CONFIG_H -g -O2 -c /tmp/pear/temp/xattr/xattr.c -fPIC -DPIC -o .libs/xattr.o /tmp/pear/temp/xattr/xattr.c:50:1: error: unknown type name 'function_entry' /tmp/pear/temp/xattr/xattr.c:51:2: warning: braces around scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:51:2: warning: (near initialization for 'xattr_functions[0]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:51:2: warning: initialization makes integer from pointer without a cast [enabled by default] /tmp/pear/temp/xattr/xattr.c:51:2: warning: (near initialization for 'xattr_functions[0]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:51:2: error: initializer element is not computable at load time /tmp/pear/temp/xattr/xattr.c:51:2: error: (near initialization for 'xattr_functions[0]') /tmp/pear/temp/xattr/xattr.c:51:2: warning: excess elements in scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:51:2: warning: (near initialization for 'xattr_functions[0]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:51:2: warning: excess elements in scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:51:2: warning: (near initialization for 'xattr_functions[0]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:51:2: warning: excess elements in scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:51:2: warning: (near initialization for 'xattr_functions[0]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:51:2: warning: excess elements in scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:51:2: warning: (near initialization for 'xattr_functions[0]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:52:2: warning: braces around scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:52:2: warning: (near initialization for 'xattr_functions[1]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:52:2: warning: initialization makes integer from pointer without a cast [enabled by default] /tmp/pear/temp/xattr/xattr.c:52:2: warning: (near initialization for 'xattr_functions[1]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:52:2: error: initializer element is not computable at load time /tmp/pear/temp/xattr/xattr.c:52:2: error: (near initialization for 'xattr_functions[1]') /tmp/pear/temp/xattr/xattr.c:52:2: warning: excess elements in scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:52:2: warning: (near initialization for 'xattr_functions[1]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:52:2: warning: excess elements in scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:52:2: warning: (near initialization for 'xattr_functions[1]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:52:2: warning: excess elements in scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:52:2: warning: (near initialization for 'xattr_functions[1]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:52:2: warning: excess elements in scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:52:2: warning: (near initialization for 'xattr_functions[1]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:53:2: warning: braces around scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:53:2: warning: (near initialization for 'xattr_functions[2]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:53:2: warning: initialization makes integer from pointer without a cast [enabled by default] /tmp/pear/temp/xattr/xattr.c:53:2: warning: (near initialization for 'xattr_functions[2]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:53:2: error: initializer element is not computable at load time /tmp/pear/temp/xattr/xattr.c:53:2: error: (near initialization for 'xattr_functions[2]') /tmp/pear/temp/xattr/xattr.c:53:2: warning: excess elements in scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:53:2: warning: (near initialization for 'xattr_functions[2]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:53:2: warning: excess elements in scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:53:2: warning: (near initialization for 'xattr_functions[2]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:53:2: warning: excess elements in scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:53:2: warning: (near initialization for 'xattr_functions[2]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:53:2: warning: excess elements in scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:53:2: warning: (near initialization for 'xattr_functions[2]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:54:2: warning: braces around scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:54:2: warning: (near initialization for 'xattr_functions[3]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:54:2: warning: initialization makes integer from pointer without a cast [enabled by default] /tmp/pear/temp/xattr/xattr.c:54:2: warning: (near initialization for 'xattr_functions[3]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:54:2: error: initializer element is not computable at load time /tmp/pear/temp/xattr/xattr.c:54:2: error: (near initialization for 'xattr_functions[3]') /tmp/pear/temp/xattr/xattr.c:54:2: warning: excess elements in scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:54:2: warning: (near initialization for 'xattr_functions[3]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:54:2: warning: excess elements in scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:54:2: warning: (near initialization for 'xattr_functions[3]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:54:2: warning: excess elements in scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:54:2: warning: (near initialization for 'xattr_functions[3]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:54:2: warning: excess elements in scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:54:2: warning: (near initialization for 'xattr_functions[3]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:55:2: warning: braces around scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:55:2: warning: (near initialization for 'xattr_functions[4]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:55:2: warning: initialization makes integer from pointer without a cast [enabled by default] /tmp/pear/temp/xattr/xattr.c:55:2: warning: (near initialization for 'xattr_functions[4]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:55:2: error: initializer element is not computable at load time /tmp/pear/temp/xattr/xattr.c:55:2: error: (near initialization for 'xattr_functions[4]') /tmp/pear/temp/xattr/xattr.c:55:2: warning: excess elements in scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:55:2: warning: (near initialization for 'xattr_functions[4]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:55:2: warning: excess elements in scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:55:2: warning: (near initialization for 'xattr_functions[4]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:55:2: warning: excess elements in scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:55:2: warning: (near initialization for 'xattr_functions[4]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:55:2: warning: excess elements in scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:55:2: warning: (near initialization for 'xattr_functions[4]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:56:2: warning: braces around scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:56:2: warning: (near initialization for 'xattr_functions[5]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:56:2: warning: initialization makes integer from pointer without a cast [enabled by default] /tmp/pear/temp/xattr/xattr.c:56:2: warning: (near initialization for 'xattr_functions[5]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:56:2: warning: excess elements in scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:56:2: warning: (near initialization for 'xattr_functions[5]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:56:2: warning: excess elements in scalar initializer [enabled by default] /tmp/pear/temp/xattr/xattr.c:56:2: warning: (near initialization for 'xattr_functions[5]') [enabled by default] /tmp/pear/temp/xattr/xattr.c:67:2: warning: initialization from incompatible pointer type [enabled by default] /tmp/pear/temp/xattr/xattr.c:67:2: warning: (near initialization for 'xattr_module_entry.functions') [enabled by default] /tmp/pear/temp/xattr/xattr.c: In function 'zif_xattr_set': /tmp/pear/temp/xattr/xattr.c:122:49: error: 'struct _php_core_globals' has no member named 'safe_mode' /tmp/pear/temp/xattr/xattr.c:122:92: error: 'CHECKUID_DISALLOW_FILE_NOT_EXISTS' undeclared (first use in this function) /tmp/pear/temp/xattr/xattr.c:122:92: note: each undeclared identifier is reported only once for each function it appears in /tmp/pear/temp/xattr/xattr.c: In function 'zif_xattr_get': /tmp/pear/temp/xattr/xattr.c:171:49: error: 'struct _php_core_globals' has no member named 'safe_mode' /tmp/pear/temp/xattr/xattr.c:171:92: error: 'CHECKUID_DISALLOW_FILE_NOT_EXISTS' undeclared (first use in this function) /tmp/pear/temp/xattr/xattr.c:187:2: warning: passing argument 4 of 'attr_get' from incompatible pointer type [enabled by default] In file included from /tmp/pear/temp/xattr/xattr.c:37:0: /usr/include/attr/attributes.h:122:12: note: expected 'int *' but argument is of type 'size_t *' /tmp/pear/temp/xattr/xattr.c:198:3: warning: passing argument 4 of 'attr_get' from incompatible pointer type [enabled by default] In file included from /tmp/pear/temp/xattr/xattr.c:37:0: /usr/include/attr/attributes.h:122:12: note: expected 'int *' but argument is of type 'size_t *' /tmp/pear/temp/xattr/xattr.c: In function 'zif_xattr_supported': /tmp/pear/temp/xattr/xattr.c:243:49: error: 'struct _php_core_globals' has no member named 'safe_mode' /tmp/pear/temp/xattr/xattr.c:243:92: error: 'CHECKUID_DISALLOW_FILE_NOT_EXISTS' undeclared (first use in this function) /tmp/pear/temp/xattr/xattr.c: In function 'zif_xattr_remove': /tmp/pear/temp/xattr/xattr.c:288:49: error: 'struct _php_core_globals' has no member named 'safe_mode' /tmp/pear/temp/xattr/xattr.c:288:92: error: 'CHECKUID_DISALLOW_FILE_NOT_EXISTS' undeclared (first use in this function) /tmp/pear/temp/xattr/xattr.c: In function 'zif_xattr_list': /tmp/pear/temp/xattr/xattr.c:337:49: error: 'struct _php_core_globals' has no member named 'safe_mode' /tmp/pear/temp/xattr/xattr.c:337:92: error: 'CHECKUID_DISALLOW_FILE_NOT_EXISTS' undeclared (first use in this function) make: *** [xattr.lo] Error 1 ERROR: `make' failed There seem to be a few errors, but I can't make heads or tails of them. Does this just not work properly in 12.10? That would be a big problem for me.

    Read the article

  • Getting Query Parameters in Javascript

    - by PhubarBaz
    I find myself needing to get query parameters that are passed into a web app on the URL quite often. At first I wrote a function that creates an associative array (aka object) with all of the parameters as keys and returns it. But then I was looking at the revealing module pattern, a nice javascript design pattern designed to hide private functions, and came up with a way to do this without even calling a function. What I came up with was this nice little object that automatically initializes itself into the same associative array that the function call did previously. // Creates associative array (object) of query params var QueryParameters = (function() {     var result = {};     if (window.location.search)     {         // split up the query string and store in an associative array         var params = window.location.search.slice(1).split("&");         for (var i = 0; i < params.length; i++)         {             var tmp = params[i].split("=");             result[tmp[0]] = unescape(tmp[1]);         }     }     return result; }()); Now all you have to do to get the query parameters is just reference them from the QueryParameters object. There is no need to create a new object or call any function to initialize it. var debug = (QueryParameters.debug === "true"); or if (QueryParameters["debug"]) doSomeDebugging(); or loop through all of the parameters. for (var param in QueryParameters) var value = QueryParameters[param]; Hope you find this object useful.

    Read the article

< Previous Page | 273 274 275 276 277 278 279 280 281 282 283 284  | Next Page >