Search Results

Search found 23949 results on 958 pages for 'program crashes'.

Page 278/958 | < Previous Page | 274 275 276 277 278 279 280 281 282 283 284 285  | Next Page >

  • 'dxerr9.h': No such file or directory

    - by numerical25
    I am trying to compile a program I took off a cd from a book that uses directx to render 3d objects. when i press compile I get the following error C1083: Cannot open include file: 'dxerr9.h': No such file or directory I am using VC++ 2008 Express Edition and i am running off of Vista. I went to the following folder C:\Program Files\Microsoft SDKs\Windows\v6.0A\Include and I was not able to find the header there. Unless I am looking in the wrong place. When I initially installed DX sdk I allowed the installer to put everything in a default location. I am not sure If I am looking in the right places or what.

    Read the article

  • Undefined variable from import when using wxPython in pydev

    - by Bibendum
    I just downloaded wxPython, and was running some of the sample programs from here. However, on every line that uses a variable from wx.*, I get a "Undefined variable from import error" For example, the following program generates five errors on lines 1,4,8, and two on line 5: import wx class MyFrame(wx.Frame): """ We simply derive a new class of Frame. """ def __init__(self, parent, title): wx.Frame.__init__(self, parent, title=title, size=(200,100)) self.control = wx.TextCtrl(self, style=wx.TE_MULTILINE) self.Show(True) app = wx.App(False) frame = MyFrame(None, 'Small editor') app.MainLoop() The program, however, compiles and runs perfectly. I haven't made any significant modifications to pydev or eclipse, and the wxPython install is fresh.

    Read the article

  • How to combine library with my jar?

    - by Dacto
    Ok so i wrote a program that makes use of a 3rd party open source library and i want to package it with my program in a single jar. I'm using netbeans 6.8 and everything I've tried java always spit back the error: java.lang.NoClassDefFoundError: libraryname; off topic:also i would like to know how to make an executable-jar(exe) through netbeans if it is possible. (ive seen programs that were written in java but were an .exe) EDIT discovered a plugin for eclipse called FatJar which can do what i want, but i cant find something similar for netbeans, is there such thing?

    Read the article

  • .gitconfig error

    - by Tanner
    I edited my .gitconfig file to add support for LabView and it appears that I did something that Git doesn't exactly like. The problem is it (Git) doesn't tell me what it doesn't like. What did I do wrong? The error message doesn't help much either: "fatal: bad config file line 13 in c:/Users/Tanner/.gitconfig" [gui] recentrepo = C:/Users/Tanner/Desktop/FIRST 2010 Beta/Java/LoganRover [user] name = Tanner Smith email = [email protected] [merge "labview"] name = LabView 3-Way Merge driver = “C:\Program Files\National Instruments\Shared\LabVIEW Merge\LVMerge.exe” “C:\Program Files\National Instruments\LabVIEW 8.6\LabVIEW.exe” %O %B %A %A recursive = binary And I'm not seeing a line 13, but usually that would mean something is wrong at the end? I don't know, Git is new to me.

    Read the article

  • Easier debugging stl array

    - by bobobobo
    In MSVC++ I have a vector. Whenever you go out of bounds of the vector (in debug mode, launched as "Start Debugging"), when you step out of bounds of the vector the program halts with a dialog box: Microsoft Visual C++ Debug Library ==== Debug Assertion Failed! Expression: Vector subscript out of range Abort | Retry | Ignore So what I want though is the MSVC++ debugger within visual studio to STOP AT THE LINE WHERE THE OUT OF BOUNDS OCCURRED, not give me this dialog box. How can I cause the program to "break" properly and be able to step through code /inspect variables when an out of bounds occurs on an STL vector?

    Read the article

  • Prime Numbers Code Help

    - by andrew
    Hello Everybody, I am suppose to "write a Java program that reads a positive integer n from standard input, then prints out the first n prime number." It's divided into 3 parts. 1st: This function will return true or false according to whether m is prime or composite. The array argument P will contain a sufficient number of primes to do the testing. Specifically, at the time isPrime() is called, array P must contain (at least) all primes p in the range 2 p m . For instance, to test m = 53 for primality, one must do successive trial divisions by 2, 3, 5, and 7. We go no further since 11 53 . Thus a precondition for the function call isPrime(53, P) is that P[0] = 2 , P[1] = 3 , P[2] = 5, and P[3] = 7 . The return value in this case would be true since all these divisions fail. Similarly to test m =143 , one must do trial divisions by 2, 3, 5, 7, and 11 (since 13 143 ). The precondition for the function call isPrime(143, P) is therefore P[0] = 2 , P[1] = 3 , P[2] = 5, P[3] = 7 , and P[4] =11. The return value in this case would be false since 11 divides 143. Function isPrime() should contain a loop that steps through array P, doing trial divisions. This loop should terminate when 2 either a trial division succeeds, in which case false is returned, or until the next prime in P is greater than m , in which case true is returned. Then there is the "main function" • Check that the user supplied exactly one command line argument which can be interpreted as a positive integer n. If the command line argument is not a single positive integer, your program will print a usage message as specified in the examples below, then exit. • Allocate array Primes[] of length n and initialize Primes[0] = 2 . • Enter a loop which will discover subsequent primes and store them as Primes[1] , Primes[2], Primes[3] , ……, Primes[n -1] . This loop should contain an inner loop which walks through successive integers and tests them for primality by calling function isPrime() with appropriate arguments. • Print the contents of array Primes[] to stdout, 10 to a line separated by single spaces. In other words Primes[0] through Primes[9] will go on line 1, Primes[10] though Primes[19] will go on line 2, and so on. Note that if n is not a multiple of 10, then the last line of output will contain fewer than 10 primes. The last function is called "usage" which I am not sure how to execute this! Your program will include a function called Usage() having signature static void Usage() that prints this message to stderr, then exits. Thus your program will contain three functions in all: main(), isPrime(), and Usage(). Each should be preceded by a comment block giving it’s name, a short description of it’s operation, and any necessary preconditions (such as those for isPrime().) And hear is my code, but I am having a bit of a problem and could you guys help me fix it? If I enter the number "5" it gives me the prime numbers which are "6,7,8,9" which doesn't make much sense. import java.util.; import java.io.; import java.lang.*; public class PrimeNumber { static boolean isPrime(int m, int[] P){ int squarert = Math.round( (float)Math.sqrt(m) ); int i = 2; boolean ans=false; while ((i<=squarert) & (ans==false)) { int c= P[i]; if (m%c==0) ans= true; else ans= false; i++; } /* if(ans ==true) ans=false; else ans=true; return ans; } ///****main public static void main(String[] args ) { Scanner in= new Scanner(System.in); int input= in.nextInt(); int i, j; int squarert; boolean ans = false; int userNum; int remander = 0; System.out.println("input: " + input); int[] prime = new int[input]; prime[0]= 2; for(i=1; i ans = isPrime(j,prime); j++;} prime[i] = j; } //prnt prime System.out.println("The first " + input + " prime number(s) are: "); for(int r=0; r }//end of main } Thanks for the help

    Read the article

  • Why do I get a null pointer exception from TabWidget?

    - by rushinge
    I'm writing an android program in which I have an activity that uses tabs. The Activity public class UnitActivity extends TabActivity { @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); TabHost tabHost = getTabHost(); TabSpec spec; Resources res = getResources(); LayoutInflater.from(this).inflate(R.layout.unit_view, tabHost.getTabContentView(), true); spec = tabHost.newTabSpec("controls"); spec.setIndicator("Control", res.getDrawable(R.drawable.ic_tab_equalizer)); spec.setContent(R.id.txtview); tabHost.addTab(spec); } } The XML referenced by R.layout.unit_view <?xml version="1.0" encoding="utf-8"?> <TabHost xmlns:android="http://schemas.android.com/apk/res/android" android:id="@android:id/tabhost" android:layout_width="fill_parent" android:layout_height="fill_parent"> <LinearLayout android:layout_width="fill_parent" android:layout_height="fill_parent" android:padding="5dp"> <TabWidget android:id="@android:id/tabs" android:layout_width="fill_parent" android:layout_height="wrap_content"/> <FrameLayout android:id="@android:id/tabcontent" android:layout_width="fill_parent" android:layout_height="fill_parent" android:padding="5dp"> <TextView android:id="@+id/txtview" android:layout_width="fill_parent" android:layout_height="fill_parent" android:gravity="bottom" android:text="nullpointer this!" /> </FrameLayout> </LinearLayout> </TabHost> As far as I can see I'm doing the same thing I see in the tabs1 api sample from the android sdk. I've tried "getLayoutInflator()" instead of "LayoutInflator.from(this)" with the same result. If I replace the LayoutInflater line with "setContentView(R.layout.unit_view)" my program doesn't crash with a null pointer exception but my content is completely blank and empty. I get the tab and that's it. I've checked to make sure R.layout.unit_view and tabHost are not null when it runs the LayoutInflater line and they seem to be fine. They're defenitely not null. I've also checked to make sure LayoutInflater.from(this) returns a valid layout inflater object and it does. The logcat indicating the error says E/AndroidRuntime( 541): java.lang.NullPointerException E/AndroidRuntime( 541): at android.widget.TabWidget.dispatchDraw(TabWidget.java:206) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.View.draw(View.java:6538) E/AndroidRuntime( 541): at android.widget.FrameLayout.draw(FrameLayout.java:352) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1531) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.View.draw(View.java:6538) E/AndroidRuntime( 541): at android.widget.FrameLayout.draw(FrameLayout.java:352) E/AndroidRuntime( 541): at com.android.internal.policy.impl.PhoneWindow$DecorView.draw(PhoneWindow.java:1830) E/AndroidRuntime( 541): at android.view.ViewRoot.draw(ViewRoot.java:1349) E/AndroidRuntime( 541): at android.view.ViewRoot.performTraversals(ViewRoot.java:1114) E/AndroidRuntime( 541): at android.view.ViewRoot.handleMessage(ViewRoot.java:1633) E/AndroidRuntime( 541): at android.os.Handler.dispatchMessage(Handler.java:99) E/AndroidRuntime( 541): at android.os.Looper.loop(Looper.java:123) E/AndroidRuntime( 541): at android.app.ActivityThread.main(ActivityThread.java:4363) E/AndroidRuntime( 541): at java.lang.reflect.Method.invokeNative(Native Method) E/AndroidRuntime( 541): at java.lang.reflect.Method.invoke(Method.java:521) E/AndroidRuntime( 541): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:860) E/AndroidRuntime( 541): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:618) E/AndroidRuntime( 541): at dalvik.system.NativeStart.main(Native Method) I/Process ( 61): Sending signal. PID: 541 SIG: 3 I/dalvikvm( 541): threadid=7: reacting to signal 3 I/dalvikvm( 541): Wrote stack trace to '/data/anr/traces.txt' Anybody have any idea how I can get this content into a tab without crashing my application? My actual program is more complex and has more than one tab but I simplified it down to this in an attempt to find out why it's crashing but it still crashes and I don't know why. If I don't use LayoutInflator my program doesn't crash but I don't get any content either, just tabs.

    Read the article

  • Lotus Notes rich text field to RTF File - VB

    - by user236105
    Here is my problem, I am doing a data migration from Lotus notes to another type of software that does not support Rich Text Fields. I am trying to write a VB 2005 program that will take any rich text fields that are found and place them into an RTF file - which will be uploaded as an attachment in the new software. I cannot get the program to take the rich text formating or objects to the RTF file, only the plain text. I have tried everything under the sun using the COM library to get these objects out to no avail. Any ideas or suggestions? Thank you in advance Bryan

    Read the article

  • C Privilege Escalation (With Password)

    - by AriX
    Hey everyone, I need to write a C program that will allow me to read/write files that are owned by root. However, I can only run the code under another user. I have the root password, but there are no "sudo" or "su" commands on the system, so I have no way of accessing the root account (there are practically no shell commands whatsoever, actually). I don't know a whole lot about UNIX permissions, so I don't know whether or not it is actually possible to do this without exploiting the system in some way or running a program owned by root itself (with +s or whatever). Any advice? Thanks! P.S. No, this isn't anything malicious, this is on an iPhone.

    Read the article

  • WIX will not add HKLM registry setting during Windows 7 install

    - by Scott Boettger
    Good Morning, I have written a WiX installer that works perfectly with Windows XP but when installing to a Windows 7 box I am running into difficulty with Registry Entries. What I need to do is add a HKLM entry as well as the registry entry for the program to show in the start menu. Here is the code i am using for both types of entry: <!-- Create the registry entries for the program --> <DirectoryRef Id="TARGETDIR"> <Component Id="RegistryEntriesInst" Guid="..."> <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)\$(var.ProductName)" Action="createAndRemoveOnUninstall"> <RegistryValue Type="string" Name="installed" Value="true" KeyPath="yes"/> </RegistryKey> </Component> <Component Id="RegistryEntriesVer" Guid="..."> <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)\$(var.ProductName)" Action="createAndRemoveOnUninstall"> <RegistryValue Type="string" Name="version" Value="$(var.ProductVersion)" KeyPath="yes"/> </RegistryKey> </Component> </DirectoryRef> <!-- To add shortcuts to the start menu to run and uninstall the program--> <DirectoryRef Id="ApplicationProgramsFolder"> <Component Id="ApplicationShortcut" Guid="..."> <Shortcut Id="ApplicationStartMenuShortcut" Name="$(var.ProductName)" Description="..." Target="[SERVERLOCATION]$(var.Project.TargetFileName)" WorkingDirectory="SERVERLOCATION"/> <Shortcut Id="UninstallProduct" Name="Uninstall $(var.ProductName)" Description="..." Target="[System64Folder]msiexec.exe" Arguments="/x [ProductCode]"/> <RemoveFolder Id="SERVERLOCATION" On="uninstall"/> <RegistryValue Root="HKCU" Key="Software\$(var.Manufacturer)\$(var.ProductName)" Name="installed" Type="integer" Value="1" KeyPath="yes"/> </Component> </DirectoryRef> Any help/suggestions that can be given will be appreciated. On a side note the registry permissions are the same on the XP and 7 computers. Thanks

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Installing Office Customization

    - by user187229
    Name: From: file:///D:/Samples/TestUpdatedVersion/bin/Debug/TestUpdatedVersion.vsto The customization cannot be installed because another version is currently installed and cannot be upgraded from this location. To install this version of the customization, first use Add or Remove Programs to uninstall this program: TestUpdatedVersion. Then install the new customization from the following location: file:///D:/Samples/TestUpdatedVersion/bin/Debug/TestUpdatedVersion.vsto ********** Exception Text ********** Microsoft.VisualStudio.Tools.Applications.Deployment.AddInAlreadyInstalledException: The customization cannot be installed because another version is currently installed and cannot be upgraded from this location. To install this version of the customization, first use Add or Remove Programs to uninstall this program: TestUpdatedVersion. Then install the new customization from the following location: file:///D:/Samples/TestUpdatedVersion/bin/Debug/TestUpdatedVersion.vsto at Microsoft.VisualStudio.Tools.Applications.Deployment.ClickOnceAddInDeploymentManager.VerifySolutionCodebaseIsUnchanged(Uri uri, String subscriptionId, Boolean previouslyInstalled) at Microsoft.VisualStudio.Tools.Applications.Deployment.ClickOnceAddInDeploymentManager.InstallAddIn()

    Read the article

  • MIPS assembly: how to declare integer values in the .data section?

    - by Barney
    I'm trying to get my feet wet with MIPS assembly language using the MARS simulator. My main problem now is how do I initialize a set of memory locations so that I can access them later via assembly language instructions? For example, I want to initialize addresses 0x1001000 - 0x10001003 with the values 0x99, 0x87, 0x23, 0x45. I think this can be done in the data declaration (.data) section of my assembly program but I'm not sure of the syntax. Is this possible? Alternatively, in the .data section, how do I specify storing the integer values in some memory location (I don't care where, but I just want to reference them somewhere). So I'm looking for the C equivalent of "int x = 20, y=30, z=90;" I know how to do that using MIPS instructions but is it possible to declare something like that in the .data section of a MIPS assembly program?

    Read the article

  • MIDL2003 Error in VC6 project

    - by graham.reeds
    While bug fixing I tracked a problem to an old vc6 compiled dll that hasn't been touched in nearly 3 years. After checking out the most recent source I am getting the following error when trying to compile. Processing C:\PROGRAM FILES\MICROSOFT SDK\INCLUDE\msxml.idl msxml.idl .\ocidl.idl(1524) : error MIDL2003 : redefinition : IErrorLog .\ocidl.idl(1541) : error MIDL2003 : redefinition : IPropertyBag Google gives lots of suggestions regarding Visual Studio 2002 - 2003 errors but I can't find anything that relates to Visual Studio 6 or can be applied to my problem. I did find this page but following it's advice didn't fix my problem. Does anyone have any suggestions on how to fix this? (I am presuming that it did work once.) Other items of interest: I have the February 2003 Platform SDK installed, and looking at the add/remove program page I have Micrsoft XML Parser and SDK, MSXML 4.0 SP2 and MSXML 6.0 Parser too.

    Read the article

  • Using Python to call Mencoder with some arguments

    - by Manu
    Hello, I'll start by saying that I am very, very new to Python. I used to have a Windows/Dos batch file in order to launch Mencoder with the right set of parameters, without having to type them each time. Things got messy when I tried to improve my script, and I decided that it would be a good opportunity to try coding something in python. I've come up with that : #!/usr/bin/python import sys, os #Path to mencoder mencoder = "C:\Program Files\MPlayer-1.0rc2\mencoder.exe" infile = "holidays.avi" outfile = "holidays (part1).avi" startTime = "00:48:00" length = "00:00:15" commande = "%s %s -ovc copy -oac copy -ss %s -endpos %s -o %s" os.system(commande % (mencoder, infile, startTime, length, outfile)) #Pause raw_input() But that doesn't work, windows complains that "C:\Program" is not recognized command. I've trying putting some "\"" here and there, but that didn't help.

    Read the article

  • VS2010 - Add template to New Project window

    - by gbogumil
    I am trying to add a new project template for an often used pattern. Starting from the class library template I have done the following (it still does not show up in the new project window): opened the .vstemplate file changed name and description to 'hard coded' values (my template). The values in there pulled from the csharpui.dll resources. changed the TemplateID, DefaultName, and ProjectItems included. saved these to the ProjectemplatesCache folder and as a zip in the ProjectTemplates folder. restarted VS2010 and checked the new project location which should have shown my new template. specifically, the folders I saved to were.. C:\program files\Microsoft Visual Studio 10.0\Common7\IDE\ProjectTemplatesCache\CSharp\Windows\1033\HostComm.zip (the zip is the folder name, not a zip file) and C:\program files\Microsoft Visual Studio 10.0\Common7\IDE\ProjectTemplates\CSharp\Windows\1033 (this folder has a HostComm.zip file in it) Has anyone else done this? Can it be done? If it can then what did I miss?

    Read the article

  • C# timer won't tick

    - by Andrej
    hi, i have a strange problem... I've been going out of my mind for the past couple of hours... the timer i put in my winform code (from the toolbar) won't tick... I have timers on a couple of forms in my program, they all work fine... I try to do exactly the same it this it won't tick... I select it, drag it on to a form, enable it, set interval and handle the tick event... and nothing happens... i even tried putting random code like messagebox.show in the tick event just to see if anything happens, and nothing!!! as I said, a have a couple of more timer in my program (on other forms, not in the one i'm trying to put this timer) and they all work fine... any suggestions? thanks in advance!

    Read the article

  • Windows Workflow and sql script in declarative config like InRule

    - by Satish
    We have been using InRule for our Rule needs we have found that it does not scale well and so are investigating the Windows Work Flow. Within InRule we could configure pretty much have any task for example our sql scripts and stored procedures where all part of a separate rule config file, I am wondering if there is a similar functionality within windows work flow where I could just call a declarative task and pass it a bunch of parameters – This task should contain the sql script I would be executing , we should be able to change the script at runtime without recompilation to the WF code. Is this possible in Windows Work flow – How can I accomplish this within work flow. Additionally for sql execution within Work Flow, how does it get the connection string. Should it be passed from the calling program – is passing it as input parameter from the Calling app via the Dictionary object the best way or can the work flow code have visibility to my calling program app.config and get the connection string ?

    Read the article

  • RAR password recovery on GPU using ATI Stream processor

    - by Wajdy Essam
    Hello, I'm newbie in GPU programming , and i work on brute force RAR Password Recovery on ATI Stream Processor using brook+ language, but i see that the kernel written in brook+ language doesn't allow any calling to normal functions (except kernel functions) , my questions is : 1) how to use unrar.dll (to unrar archive files) API in this situation? and is this the only way to program RAR password recovery? 2) what about crack and ElcomSoft software that use GPU , how they work ? 3) what exactly the role for the function work inside GPU (ATI Stream processor or CUDA) in this program? 4) is nVidia/CUDA technology is easier/more flexible than ATI/brook+ language ?

    Read the article

  • How do you run PartCover with spaces in the path?

    - by nportelli
    I have a msbuild file that I'm trying to run from Hudson CI. It outputs like this "C:\Program Files\Gubka Bob\PartCover .NET 2\PartCover.exe" --target "C:\Program Files\Microsoft Visual Studio 9.0\Common7\IDE\MSTest.exe" --target-args "/noisolation" "/testcontainer:C:\CI\Hudson\jobs\Video Raffle\workspace\Source\VideoRaffleCaller\Source\VideoRaffleCaller.Test.Unit\bin\Debug\VideoRaffleCaller.Test.Unit.dll" --include "[VideoRaffleCaller*]*" --output "Coverage\partcover.xml" I get this error Invalid switch "raffle\workspace\source\videorafflecaller\source\videorafflecall er.test.unit\bin\debug\videorafflecaller.test.unit.dll". For switch syntax, type "MSTest /help" WTF? Looks like PartCover doesn't handle spaces in the --target-args well. Or am I missing some quotes somewhere? Has anyone gotten something like to to work?

    Read the article

  • C# SerialPort - Problems mixing ports with different baud rates.

    - by GrandAdmiral
    Greetings, I have two devices that I would like to connect over a serial interface, but they have incompatible connections. To get around this problem, I connected them both to my PC and I'm working on a C# program that will route traffic on COM port X to COM port Y and vice versa. The program connects to two COM ports. In the data received event handler, I read in incoming data and write it to the other COM port. To do this, I have the following code: private void HandleDataReceived(SerialPort inPort, SerialPort outPort) { byte[] data = new byte[1]; while (inPort.BytesToRead > 0) { // Read the data data[0] = (byte)inPort.ReadByte(); // Write the data if (outPort.IsOpen) { outPort.Write(data, 0, 1); } } } That code worked fine as long as the outgoing COM port operated at a higher baud rate than the incoming COM port. If the incoming COM port was faster than the outgoing COM port, I started missing data. I had to correct the code like this: private void HandleDataReceived(SerialPort inPort, SerialPort outPort) { byte[] data = new byte[1]; while (inPort.BytesToRead > 0) { // Read the data data[0] = (byte)inPort.ReadByte(); // Write the data if (outPort.IsOpen) { outPort.Write(data, 0, 1); while (outPort.BytesToWrite > 0); //<-- Change to fix problem } } } I don't understand why I need that fix. I'm new to C# (this is my first program), so I'm wondering if there is something I am missing. The SerialPort defaults to a 2048 byte write buffer and my commands are less than ten bytes. The write buffer should have the ability to buffer the data until it can be written to a slower COM port. In summary, I'm receiving data on COM X and writing the data to COM Y. COM X is connected at a faster baud rate than COM Y. Why doesn't the buffering in the write buffer handle this difference? Why does it seem that I need to wait for the write buffer to drain to avoid losing data? Thanks!

    Read the article

  • interaction between javascript (desktop application) and C#

    - by Roman Dorevich
    Hello. I am writing for my desktop some application for handling some services. I wrote in C# an application that calculates something (lets call it cl.exe) I created a .bat file that starts the cl.exe. I want to call that .bat file from my javascript so I WShell.Run(**.bat). 2 question: The javascript program will not continue till the cl.exe will end ? (It is synchronized ?) The cl.exe returns a value. How can the javascript take it (It is a javascript program that call .bat file that wrapp the execution of the cl.exe) ? Thanks

    Read the article

  • BufferedReader.readLine() gives error java.net.SocketException: Software caused connection abort: re

    - by javatcp
    I am trying to code my program such that until the buffered reader gets something in readLine() from my tcp client it should keep running in the while loop checking but I get this error as soon as the program executes Mar 31, 2010 11:03:36 PM deswash.DESWashView$5 run SEVERE: null java.net.SocketException: Software caused connection abort: recv failed at java.net.SocketInputStream.socketRead0(Native Method) at java.net.SocketInputStream.read(SocketInputStream.java:129) at sun.nio.cs.StreamDecoder.readBytes(StreamDecoder.java:264) at sun.nio.cs.StreamDecoder.implRead(StreamDecoder.java:306) at sun.nio.cs.StreamDecoder.read(StreamDecoder.java:158) at java.io.InputStreamReader.read(InputStreamReader.java:167) at java.io.BufferedReader.fill(BufferedReader.java:136) at java.io.BufferedReader.readLine(BufferedReader.java:299) at java.io.BufferedReader.readLine(BufferedReader.java:362) at deswash.DESWashView$5.run(DESWashView.java:448) the second line in the following code throws the error while(running){ String temp = in.readLine(); if(!(temp.equals(null))){ int inid = Integer.parseInt(temp); stationList.add(inid); } }

    Read the article

  • Python CGI on Amazon AWS EC2 micro-instance -- a how-to!

    - by user595585
    How can you make an EC2 micro instance serve CGI scripts from lighthttpd? For instance Python CGI? Well, it took half a day, but I have gotten Python cgi running on a free Amazon AWS EC2 micro-instance, using the lighttpd server. I think it will help my fellow noobs to put all the steps in one place. Armed with the simple steps below, it will take you only 15 minutes to set things up! My question for the more experienced users reading this is: Are there any security flaws in what I've done? (See file and directory permissions.) Step 1: Start your EC2 instance and ssh into it. [Obviously, you'll need to sign up for Amazon EC2 and save your key pairs to a *.pem file. I won't go over this, as Amazon tells you how to do it.] Sign into your AWS account and start your EC2 instance. The web has tutorials on doing this. Notice that default instance-size that Amazon presents to you is "small." This is not "micro" and so it will cost you money. Be sure to manually choose "micro." (Micro instances are free only for the first year...) Find the public DNS code for your running instance. To do this, click on the instance in the top pane of the dashboard and you'll eventually see the "Public DNS" field populated in the bottom pane. (You may need to fiddle a bit.) The Public DNS looks something like: ec2-174-129-110-23.compute-1.amazonaws.com Start your Unix console program. (On Max OS X, it's called Terminal, and lives in the Applications - Utilities folder.) cd to the directory on your desktop system that has your *.pem file containing your AWS keypairs. ssh to your EC2 instance using a command like: ssh -i <<your *.pem filename>> ec2-user@<< Public DNS address >> So, for me, this was: ssh -i amzn_ec2_keypair.pem [email protected] Your EC2 instance should let you in. Step 2: Download lighttpd to your EC2 instance. To install lighttpd, you will need root access on your EC2 instance. The problem is: Amazon will not let you sign in as root. (Not straightforwardly, at least.) But there is a workaround. Type this command: sudo /bin/bash The system prompt-character will change from $ to #. We won't exit from "sudo" until the very last step in this whole process. Install the lighttpd application (version 1.4.28-1.3.amzn1 for me): yum install lighttpd Install the FastCGI libraries for lighttpd (not needed, but why not?): yum install lighttpd-fastcgi Test that your server is working: /etc/init.d/lighttpd start Step 3: Let the outside world see your server. If you now tried to hit your server from the browser on your desktop, it would fail. The reason: By default, Amazon AWS does not open any ports to your EC2 instance. So, you have to open the ports manually. Go to your EC2 dashboard in your desktop's browser. Click on "Security Groups" in the left pane. One or more security groups will appear in the upper right pane. Choose the one that was assigned to your EC2 instance when you launched your instance. A table called "Allowed Connections" will appear in the lower right pane. A pop-up menu will let you choose "HTTP" as the connection method. The other values in that line of the table should be: tcp, 80, 80, 0.0.0.0/0 Now hit your EC2 instance's server from the desktop in your browser. Use the Public DNS address that you used earlier to SSH in. You should see the lighttpd generic web page. If you don't, I can't help you because I am such a noob. :-( Step 4: Configure lighttpd to serve CGI. Back in the console program, cd to the configuration directory for lighttpd: cd /etc/lighttpd To enable CGI, you want to uncomment one line in the < modules.conf file. (I could have enabled Fast CGI, but baby steps are best!) You can do this with the "ed" editor as follows: ed modules.conf /include "conf.d\/cgi.conf"/ s/#// w q Create the directory where CGI programs will live. (The /etc/lighttpd/lighttpd.conf file determines where this will be.) We'll create our directory in the default location, so we don't have to do any editing of configuration files: cd /var/www/lighttpd mkdir cgi-bin chmod 755 cgi-bin Almost there! Of course you need to put a test CGI program into the cgi-bin directory. Here is one: cd cgi-bin ed a #!/usr/bin/python print "Content-type: text/html\n\n" print "<html><body>Hello, pyworld.</body></html>" . w hellopyworld.py q chmod 655 hellopyworld.py Restart your lighttpd server: /etc/init.d/lighttpd restart Test your CGI program. In your desktop's browser, hit this URL, substituting your EC2 instance's public DNS address: http://<<Public DNS>>/cgi-bin/hellopyworld.py For me, this was: http://ec2-174-129-110-23.compute-1.amazonaws.com/cgi-bin/hellopyworld.py Step 5: That's it! Clean up, and give thanks! To exit from the "sudo /bin/bash" command given earlier, type: exit Acknowledgements: Heaps of thanks to: wiki.vpslink.com/Install_and_Configure_lighttpd www.cyberciti.biz/tips/lighttpd-howto-setup-cgi-bin-access-for-perl-programs.html aws.typepad.com/aws/2010/06/building-three-tier-architectures-with-security-groups.html Good luck, amigos! I apologize for the non-traditional nature of this "question" but I have gotten so much help from Stackoverflow that I was eager to give something back.

    Read the article

< Previous Page | 274 275 276 277 278 279 280 281 282 283 284 285  | Next Page >