Search Results

Search found 7634 results on 306 pages for 'preg replace'.

Page 279/306 | < Previous Page | 275 276 277 278 279 280 281 282 283 284 285 286  | Next Page >

  • Sanitizing DB inputs with XSLT

    - by azathoth
    Hello I've been looking for a method to strip my XML content of apostrophes (') like: <name> Jim O'Connor</name> since my DBMS is complaining of receiving those. By looking at the example described here, that is supposed to replace ' with '', I constructed the following script: <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:output omit-xml-declaration="yes" indent="yes" /> <xsl:template match="node()|@*"> <xsl:copy> <xsl:apply-templates select="node()|@*" /> </xsl:copy> </xsl:template> <xsl:template name="sqlApostrophe"> <xsl:param name="string" /> <xsl:variable name="apostrophe">'</xsl:variable> <xsl:choose> <xsl:when test="contains($string,$apostrophe)"> <xsl:value-of select="concat(substring-before($string,$apostrophe), $apostrophe,$apostrophe)" disable-output-escaping="yes" /> <xsl:call-template name="sqlApostrophe"> <xsl:with-param name="string" select="substring-after($string,$apostrophe)" /> </xsl:call-template> </xsl:when> <xsl:otherwise> <xsl:value-of select="$string" disable-output-escaping="yes" /> </xsl:otherwise> </xsl:choose> </xsl:template> <xsl:template match="node()|@*"> <xsl:apply-templates name="sqlApostrophe"/> </xsl:template> </xsl:stylesheet> However, the processor isn't accepting it. What am I missing here? Is there a better way to get rid of the apostrophes? Perhaps another approach for sanitizing DB inputs by using XSLT? Thanks for your help

    Read the article

  • How do I create/use a Fluent NHibernate convention to automap UInt32 properties to an SQL Server 200

    - by dommer
    I'm trying to use a convention to map UInt32 properties to a SQL Server 2008 database. I don't seem to be able to create a solution based on existing web sources, due to updates in the way Fluent NHibernate works - i.e. examples are out of date. I'm trying to have NHibernate generate the schema (via ExposeConfiguration). I'm happy to have NHibernate map it to anything sensible (e.g. bigint). Here's my code as it currently stands (which, when I try to expose the schema, fails due to SQL Server not supporting UInt32). Apologies for the code being a little long, but I'm not 100% sure what is relevant to the problem, so I'm erring on the side of caution. Most of it is based on this post. The error reported is: System.ArgumentException : Dialect does not support DbType.UInt32 I think I'll need a relatively comprehensive example, as I don't seem to be able to pull the pieces together into a working solution, at present. FluentConfiguration configuration = Fluently.Configure() .Database(MsSqlConfiguration.MsSql2008 .ConnectionString(connectionString)) .Mappings(mapping => mapping.AutoMappings.Add( AutoMap.AssemblyOf<Product>() .Conventions.Add<UInt32UserTypeConvention>())); configuration.ExposeConfiguration(x => new SchemaExport(x).Create(false, true)); namespace NHibernateTest { public class UInt32UserTypeConvention : UserTypeConvention<UInt32UserType> { // Empty. } } namespace NHibernateTest { public class UInt32UserType : IUserType { // Public properties. public bool IsMutable { get { return false; } } public Type ReturnedType { get { return typeof(UInt32); } } public SqlType[] SqlTypes { get { return new SqlType[] { SqlTypeFactory.Int32 }; } } // Public methods. public object Assemble(object cached, object owner) { return cached; } public object DeepCopy(object value) { return value; } public object Disassemble(object value) { return value; } public new bool Equals(object x, object y) { return (x != null && x.Equals(y)); } public int GetHashCode(object x) { return x.GetHashCode(); } public object NullSafeGet(IDataReader rs, string[] names, object owner) { int? i = (int?)NHibernateUtil.Int32.NullSafeGet(rs, names[0]); return (UInt32?)i; } public void NullSafeSet(IDbCommand cmd, object value, int index) { UInt32? u = (UInt32?)value; int? i = (Int32?)u; NHibernateUtil.Int32.NullSafeSet(cmd, i, index); } public object Replace(object original, object target, object owner) { return original; } } }

    Read the article

  • maven-ear-plugin works if jboss version is 4.2, but not 5. Why ?

    - by NSINGH
    I am using maven to configure maven-ear-plugin. I am getting following exception when I say jboss version is 5 (See below code, under tag). It works if I replace version to 4.2 <build> <finalName>tactical</finalName> <plugins> <plugin> <artifactId>maven-ear-plugin</artifactId> <configuration> <version>5</version> <defaultJavaBundleDir>lib</defaultJavaBundleDir> <jboss> <version>5</version> <loader-repository>seam.jboss.org:loader=tactical</loader-repository> </jboss> <modules> <ejbModule> <groupId>${project.groupId}</groupId> <artifactId>tactical-jar</artifactId> </ejbModule> </modules> </configuration> </plugin> </plugins> </build> Why it works fine for jboss 4.2 but not for 5. What ?? I get the following exception: [INFO] Failed to initialize JBoss configuration Embedded error: Invalid JBoss configuration, version[5] is not supported. [INFO] ------------------------------------------------------------------------ [INFO] Trace org.apache.maven.lifecycle.LifecycleExecutionException: Failed to initialize JBoss configuration at org.apache.maven.lifecycle.DefaultLifecycleExecutor.executeGoals(DefaultLifecycleExecutor.java:583) at org.apache.maven.lifecycle.DefaultLifecycleExecutor.executeGoalWithLifecycle(DefaultLifecycleExecutor.java:49 9) at org.apache.maven.lifecycle.DefaultLifecycleExecutor.executeGoal(DefaultLifecycleExecutor.java:478) at org.apache.maven.lifecycle.DefaultLifecycleExecutor.executeGoalAndHandleFailures(DefaultLifecycleExecutor.jav a:330) at org.apache.maven.lifecycle.DefaultLifecycleExecutor.executeTaskSegments(DefaultLifecycleExecutor.java:291) at org.apache.maven.lifecycle.DefaultLifecycleExecutor.execute(DefaultLifecycleExecutor.java:142) at org.apache.maven.DefaultMaven.doExecute(DefaultMaven.java:336) at org.apache.maven.DefaultMaven.execute(DefaultMaven.java:129) at org.apache.maven.cli.MavenCli.main(MavenCli.java:287) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.codehaus.classworlds.Launcher.launchEnhanced(Launcher.java:315) at org.codehaus.classworlds.Launcher.launch(Launcher.java:255) at org.codehaus.classworlds.Launcher.mainWithExitCode(Launcher.java:430) at org.codehaus.classworlds.Launcher.main(Launcher.java:375) Caused by: org.apache.maven.plugin.MojoExecutionException: Failed to initialize JBoss configuration at org.apache.maven.plugin.ear.AbstractEarMojo.execute(AbstractEarMojo.java:159) at org.apache.maven.plugin.ear.GenerateApplicationXmlMojo.execute(GenerateApplicationXmlMojo.java:96) at org.apache.maven.plugin.DefaultPluginManager.executeMojo(DefaultPluginManager.java:451) at org.apache.maven.lifecycle.DefaultLifecycleExecutor.executeGoals(DefaultLifecycleExecutor.java:558) ... 16 more Caused by: org.apache.maven.plugin.ear.EarPluginException: Invalid JBoss configuration, version[5] is not supported. at org.apache.maven.plugin.ear.JbossConfiguration.(JbossConfiguration.java:95) at org.apache.maven.plugin.ear.AbstractEarMojo.initializeJbossConfiguration(AbstractEarMojo.java:296) at org.apache.maven.plugin.ear.AbstractEarMojo.execute(AbstractEarMojo.java:155) ... 19 more [INFO] ------------------------------------------------------------------------ [INFO] Total time: 2 seconds Any idea. Thanks

    Read the article

  • R: Plotting a graph with different colors of points based on advanced criteria

    - by balconydoor
    What I would like to do is a plot (using ggplot), where the x axis represent years which have a different colour for the last three years in the plot than the rest. The last three years should also meet a certain criteria and based on this the last three years can either be red or green. The criteria is that the mean of the last three years should be less (making it green) or more (making it red) than the 66%-percentile of the remaining years. So far I have made two different functions calculating the last three year mean: LYM3 <- function (x) { LYM3 <- tail(x,3) mean(LYM3$Data,na.rm=T) } And the 66%-percentile for the remaining: perc66 <- function(x) { percentile <- head(x,-3) quantile(percentile$Data, .66, names=F,na.rm=T) } Here are two sets of data that can be used in the calculations (plots), the first which is an example from my real data where LYM3(df1) < perc66(df1) and the second is just made up data where LYM3 perc66. df1<- data.frame(Year=c(1979:2010), Data=c(347261.87, 145071.29, 110181.93, 183016.71, 210995.67, 205207.33, 103291.78, 247182.10, 152894.45, 170771.50, 206534.55, 287770.86, 223832.43, 297542.86, 267343.54, 475485.47, 224575.08, 147607.81, 171732.38, 126818.10, 165801.08, 136921.58, 136947.63, 83428.05, 144295.87, 68566.23, 59943.05, 49909.08, 52149.11, 117627.75, 132127.79, 130463.80)) df2 <- data.frame(Year=c(1979:2010), Data=c(sample(50,29,replace=T),75,75,75)) Here’s my code for my plot so far: plot <- ggplot(df1, aes(x=Year, y=Data)) + theme_bw() + geom_point(size=3, aes(colour=ifelse(df1$Year<2008, "black",ifelse(LYM3(df1) < perc66(df1),"green","red")))) + geom_line() + scale_x_continuous(breaks=c(1980,1985,1990,1995,2000,2005,2010), limits=c(1978,2011)) plot As you notice it doesn’t really do what I want it to do. The only thing it does seem to do is that it turns the years before 2008 into one level and those after into another one and base the point colour off these two levels. Since I don’t want this year to be stationary either, I made another tiny function: fun3 <- function(x) { df <- subset(x, Year==(max(Year)-2)) df$Year } So the previous code would have the same effect as: geom_point(size=3, aes(colour=ifelse(df1$Year<fun3(df1), "black","red"))) But it still does not care about my colours. Why does it make the years into levels? And how come an ifelse function doesn’t work within another one in this case? How would it be possible to the arguments to do what I like? I realise this might be a bit messy, asking for a lot at the same time, but I hope my description is pretty clear. It would be helpful if someone could at least point me in the right direction. I tried to put the code for the plot into a function as well so I wouldn’t have to change the data frame at all functions within the plot, but I can’t get it to work. Thank you!

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • What to Expect in Rails 4

    - by mikhailov
    Rails 4 is nearly there, we should be ready before it released. Most developers are trying hard to keep their application on the edge. Must see resources: 1) @sikachu talk: What to Expect in Rails 4.0 - YouTube 2) Rails Guides release notes: http://edgeguides.rubyonrails.org/4_0_release_notes.html There is a mix of all major changes down here: ActionMailer changes excerpt: Asynchronously send messages via the Rails Raise an ActionView::MissingTemplate exception when no implicit template could be found ActionPack changes excerpt Added controller-level etag additions that will be part of the action etag computation Add automatic template digests to all CacheHelper#cache calls (originally spiked in the cache_digests plugin) Add Routing Concerns to declare common routes that can be reused inside others resources and routes Added ActionController::Live. Mix it in to your controller and you can stream data to the client live truncate now always returns an escaped HTML-safe string. The option :escape can be used as false to not escape the result Added ActionDispatch::SSL middleware that when included force all the requests to be under HTTPS protocol ActiveModel changes excerpt AM::Validation#validates ability to pass custom exception to :strict option Changed `AM::Serializers::JSON.include_root_in_json' default value to false. Now, AM Serializers and AR objects have the same default behaviour Added ActiveModel::Model, a mixin to make Ruby objects work with AP out of box Trim down Active Model API by removing valid? and errors.full_messages ActiveRecord changes excerpt Use native mysqldump command instead of structure_dump method when dumping the database structure to a sql file. Attribute predicate methods, such as article.title?, will now raise ActiveModel::MissingAttributeError if the attribute being queried for truthiness was not read from the database, instead of just returning false ActiveRecord::SessionStore has been extracted from Active Record as activerecord-session_store gem. Please read the README.md file on the gem for the usage Fix reset_counters when there are multiple belongs_to association with the same foreign key and one of them have a counter cache Raise ArgumentError if list of attributes to change is empty in update_all Add Relation#load. This method explicitly loads the records and then returns self Deprecated most of the 'dynamic finder' methods. All dynamic methods except for find_by_... and find_by_...! are deprecated Added ability to ActiveRecord::Relation#from to accept other ActiveRecord::Relation objects Remove IdentityMap ActiveSupport changes excerpt ERB::Util.html_escape now escapes single quotes ActiveSupport::Callbacks: deprecate monkey patch of object callbacks Replace deprecated memcache-client gem with dalli in ActiveSupport::Cache::MemCacheStore Object#try will now return nil instead of raise a NoMethodError if the receiving object does not implement the method, but you can still get the old behavior by using the new Object#try! Object#try can't call private methods Add ActiveSupport::Deprecations.behavior = :silence to completely ignore Rails runtime deprecations What are the most important changes for you?

    Read the article

  • PHP Session Class and $_SESSION Array

    - by Gianluca Bargelli
    Hello, i've implemented this custom PHP Session Class for storing sessions into a MySQL database: class Session { private $_session; public $maxTime; private $database; public function __construct(mysqli $database) { $this->database=$database; $this->maxTime['access'] = time(); $this->maxTime['gc'] = get_cfg_var('session.gc_maxlifetime'); session_set_save_handler(array($this,'_open'), array($this,'_close'), array($this,'_read'), array($this,'_write'), array($this,'_destroy'), array($this,'_clean') ); register_shutdown_function('session_write_close'); session_start();//SESSION START } public function _open() { return true; } public function _close() { $this->_clean($this->maxTime['gc']); } public function _read($id) { $getData= $this->database->prepare("SELECT data FROM Sessions AS Session WHERE Session.id = ?"); $getData->bind_param('s',$id); $getData->execute(); $allData= $getData->fetch(); $totalData = count($allData); $hasData=(bool) $totalData >=1; return $hasData ? $allData['data'] : ''; } public function _write($id, $data) { $getData = $this->database->prepare("REPLACE INTO Sessions VALUES (?, ?, ?)"); $getData->bind_param('sss', $id, $this->maxTime['access'], $data); return $getData->execute(); } public function _destroy($id) { $getData=$this->database->prepare("DELETE FROM Sessions WHERE id = ?"); $getData->bind_param('S', $id); return $getData->execute(); } public function _clean($max) { $old=($this->maxTime['access'] - $max); $getData = $this->database->prepare("DELETE FROM Sessions WHERE access < ?"); $getData->bind_param('s', $old); return $getData->execute(); } } It works well but i don't really know how to properly access the $_SESSION array: For example: $db=new DBClass();//This is a custom database class $session=new Session($db->getConnection()); if (isset($_SESSION['user'])) { echo($_SESSION['user']);//THIS IS NEVER EXECUTED! } else { $_SESSION['user']="test"; Echo("Session created!"); } At every page refresh it seems that $_SESSION['user'] is somehow "resetted", what methods can i apply to prevent such behaviour?

    Read the article

  • Trouble with ASP.NET MVC auto-scaffolder template

    - by DanM
    I'm trying to write an auto-scaffolder template for Index views. I'd like to be able to pass in a collection of models or view-models (e.g., IQueryable<MyViewModel>) and get back an HTML table that uses the DisplayName attribute for the headings (th elements) and Html.Display(propertyName) for the cells (td elements). Each row should correspond to one item in the collection. Here's what I have so far: <%@ Control Language="C#" Inherits="System.Web.Mvc.ViewUserControl" %> <% var items = (IQueryable<TestProj.ViewModels.TestViewModel>)Model; // How do I make this generic? var properties = items.First().GetMetadata().Properties .Where(pm => pm.ShowForDisplay && !ViewData.TemplateInfo.Visited(pm)); %> <table> <tr> <% foreach(var property in properties) { %> <th> <%= property.DisplayName %> </th> <% } %> </tr> <% foreach(var item in items) { HtmlHelper itemHtml = ????; // What should I put in place of "????"? %> <tr> <% foreach(var property in properties) { %> <td> <%= itemHtml.Display(property.DisplayName) %> </td> <% } %> </tr> <% } %> </table> Two problems with this: I'd like it to be generic. So, I'd like to replace var items = (IQueryable<TestProj.ViewModels.TestViewModel>)Model; with var items = (IQueryable<T>)Model; or something to that effect. A property Html is automatically created for me when the view is created, but this HtmlHelper applies to the whole collection. I need to somehow create an itemHtml object that applies just to the current item in the foreach loop. I'm not sure how to do this, however, because the constructors for HtmlHelper don't take a Model object. How do I solve these two problems?

    Read the article

  • How to override loading a TImage from the object inspector (at run-time)?

    - by Mawg
    Further to my previous question, which did not get a useful answer despite a bounty, I will try rephrasing the question. Basically, when the user clicks the ellipsis in the object inspector, Delphi opens a file/open dialog. I want to replace this handling with my own, so that I can save the image's path. I would have expected that all I need to do is to derive a class from TImage and override the Assign() function, as in the following code. However, when I do the assign function is never called. So, it looks like I need to override something else, but what? unit my_Image; interface uses Classes, ExtCtrls, Jpeg, Graphics; type Tmy_Image = class(Timage) private FPicture : TPicture; protected procedure OnChange(Sender: TObject); public { Public declarations } Constructor Create(AOwner: TComponent); override; procedure SetPicture(picture : TPicture); procedure Assign(Source: TPersistent); override; published { Published declarations - available in the Object Inspector at design-time } property Picture : TPicture read FPicture write SetPicture; end; // of class Tmy_Image() procedure Register; implementation uses Controls, Dialogs; procedure Register; begin RegisterComponents('Standard', [Tmy_Image]); end; Constructor Tmy_Image.Create(AOwner: TComponent); begin inherited; // Call the parent Create method Hint := 'Add an image from a file|Add an image from a file'; // Tooltip | status bar text AutoSize := True; // Control resizes when contents change (new image is loaded) Height := 104; Width := 104; FPicture := TPicture.Create(); self.Picture.Bitmap.LoadFromResourceName(hInstance, 'picture_poperty_bmp'); end; procedure Tmy_Image.OnChange(Sender: TObject); begin Constraints.MaxHeight := Picture.Height; Constraints.MaxWidth := Picture.Width; Self.Height := Picture.Height; Self.Width := Picture.Width; end; procedure Tmy_Image.SetPicture(picture : TPicture); begin MessageDlg('Tmy_Image.SetPicture', mtWarning, [mbOK], 0); // never called end; procedure Tmy_Image.Assign(Source: TPersistent); begin MessageDlg('Tmy_Image.Assign', mtWarning, [mbOK], 0); // never called end; end.

    Read the article

  • basic operations for modifying a source document with XSLT

    - by SpliFF
    All the tutorials and examples I've found of XSLT processing seem to assume your destination will be a significantly different format/structure to your source and that you know the structure of the source in advance. I'm struggling with finding out how to perform simple "in-place" modifications to a HTML document without knowing anything else about its existing structure. Could somebody show me a clear example that, given an arbitrary unknown HTML source will: 1.) delete the classname 'foo' from all divs 2.) delete a node if its empty (ie <p></p>) 3.) delete a <p> node if its first child is <br> 4.) add newattr="newvalue" to all H1 5.) replace 'heading' in text nodes with 'title' 6.) wrap all <u> tags in <b> tags (ie, <u>foo</u> -> <b><u>foo</u></b>) 7.) output the transformed document without changing anything else The above examples are the primary types of transform I wish to accomplish. Understanding how to do the above will go a long way towards helping me build more complex transforms. To help clarify/test the examples here is a sample source and output, however I must reiterate that I want to work with arbitrary samples without rewriting the XSLT for each source: <!doctype html> <html> <body> <h1>heading</h1> <p></p> <p><br>line</p> <div class="foo bar"><u>baz</u></div> <p>untouched</p> </body> </html> output: <!doctype html> <html> <body> <h1 newattr="newvalue">title</h1> <div class="bar"><b><u>baz</u></b></div> <p>untouched</p> </body> </html>

    Read the article

  • removing contents of div using Jquery "empty" doesn't work

    - by Andrew
    I'm trying to remove contents of particular div which are basically list items and a heading by using jquery empty so that I could replace with new contents. What happens when I run the code is, the whole div element blinked and flash the replaced content and then the old one reappear. Can anyone tell me what am I doing wrong? Here's an excerpt of my code - <pre> $("#msg_tab").bind("click",function(){ $("#sidebar1").remove(); var html="<ul><li><h2>test</h2><ul><li><a href='#'>Compose New Message</a></li><li><a href='#'>Inbox</a></li><li><a href='#'>Outbox</a></li><li><a href='#'>Unread</a></li><li><a href='#'>Archive</a></li></ul></li></ul>"; $("#sidebar1").append(html); }); <div id="sidebar1" class="sidebar"> <ul> <li> <h2>Messages</h2> <ul> <li><a href="#">Compose New Message</a></li> <li><a href="#">Inbox</a></li> <li><a href="#">Outbox</a></li> <li><a href="#">Unread</a></li> <li><a href="#">Archive</a></li> </ul> </li> </ul> </div> Another question is, how do I write multiple line html code string in javascript so that java would recognize as a string value? Placing forward slash at the end is ok when the string is not a html code but, in html code, I can't figure out how to escape forward slash from ending tags.I've tried escaping it with backward slash but doesn't work. I would be appreciated if anyone could shed a light on this matter as well.

    Read the article

  • Configuring a html page from an original demo page

    - by Wold
    I forked into rainyday.js through github, an awesome javascript program made by maroslaw at this link: https://github.com/maroslaw/rainyday.js. Basically I tried taking his demo page and my own photo city.jpg and changed the applicable fields so that I could run it on my own site, but only the picture loads and the script itself doesn't start to run. I'm pretty new to html and javascript so I'm probably omitting something very simple, but here is the script for the demo code: <script src="rainyday.js"></script> <script> function getURLParameter(name) { return decodeURIComponent((new RegExp('[?|&]' + name + '=' + '([^&;]+?)(&|#|;|$)').exec(location.search)||[,''])[1].replace(/\+/g, '%20'))||null; } function demo() { var image = document.getElementById('background'); image.onload = function () { var engine = null; var preset = getURLParameter('preset') || '1'; if (preset === '1') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.rain([ [1, 2, 8000] ]); engine.rain([ [3, 3, 0.88], [5, 5, 0.9], [6, 2, 1] ], 100); } else if (preset === '2') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.VARIABLE_GRAVITY_ANGLE = Math.PI / 8; engine.rain([ [0, 2, 0.5], [4, 4, 1] ], 50); } else if (preset === '3') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.trail = engine.TRAIL_SMUDGE; engine.rain([ [0, 2, 0.5], [4, 4, 1] ], 100); } }; image.crossOrigin = 'anonymous'; if (getURLParameter('imgur')) { image.src = 'http://i.imgur.com/' + getURLParameter('imgur') + '.jpg'; } else if (getURLParameter('img')) { image.src = getURLParameter('img') + '.jpg'; } var youtube = getURLParameter('youtube'); if (youtube) { var div = document.getElementById('sound'); var player = document.createElement('iframe'); player.frameborder = '0'; player.height = '1'; player.width = '1'; player.src = 'https://youtube.com/embed/' + youtube + '?autoplay=1&controls=0&showinfo=0&autohide=1&loop=1'; div.appendChild(player); } } </script> This is where I am naming my background and specifying the photo from within the directory. <body onload="demo();"> <div id="sound" style="z-index: -1;"></div> <div id="parent"> <img id='background' alt="background" src="city.jpg" /> </div> </body> The actual code for the whole entire rainyday.js script can be found here: https://github.com/maroslaw/rainyday.js/blob/master/rainyday.js Thanks in advance for any help and advice!

    Read the article

  • Refactor a link and an image

    - by Mihail Stoynov
    I have to write an link with an image inside. Instead of explaining, here's the code I have now: <c:if test="${userSession.loggedUser eq null and company.image != null}"> <a onclick="${rich:component('loginPanel')}.show()"> <img src="/download.do?hash=#{company.image.hash}" /> </a> </c:if> <c:if test="${userSession.loggedUser eq null and company.image == null}"> <a onclick="${rich:component('loginPanel')}.show()"> <img src="${request.contextPath}/img/icons/logo_default.jpg" /> </a> </c:if> <c:if test="${userSession.loggedUser ne null and company.image != null}"> <a href="company.xhtml?${company.name}"> <img src="/download.do?hash=#{company.image.hash}" /> </a> </c:if> <c:if test="#{userSession.loggedUser ne null and company.image == null}"> <a href="company.xhtml?${company.name}"> <img src="${request.contextPath}/img/icons/logo_default.jpg" /> </a> </c:if> This code looks awful - there are two exact links with two exact images but combined in all possible combinations. Is there a better way? Is there a way to avoid c:if - it created tables? Update: Bozho proposes: You can replace <c:if and <a with <h:outputLink rendered="#{..}". Apart from that I don't see any other optimization. But it doesn't work. This does not render correctly: <a href=> <h:outputLink rendered="#{..} <h:outputLink rendered="#{..} </a> (the image is outside the anchor) This does render fine: <h:outputLink value=> <h:outputLink rendered="#{..} <h:outputLink rendered="#{..} </a> , but it always adds href and in two of the cases I don't want href when rendered.

    Read the article

  • Commitment to Zend Framework - any arguments against?

    - by Pekka
    I am refurbishing a big CMS that I have been working on for quite a number of years now. The product itself is great, but some components, the Database and translation classes for example, need urgent replacing - partly self-made as far back as 2002, grown into a bit of a chaos over time, and might have trouble surviving a security audit. So, I've been looking closely at a number of frameworks (or, more exactly, component Libraries, as I do not intend to change the basic structure of the CMS) and ended up with liking Zend Framework the best. They offer a solid MVC model but don't force you into it, and they offer a lot of professional components that have obviously received a lot of attention (Did you know there are multiple plurals in Russian, and you can't translate them using a simple ($number == 0) or ($number > 1) switch? I didn't, but Zend_Translate can handle it. Just to illustrate the level of thorougness the library seems to have been built with.) I am now literally at the point of no return, starting to replace key components of the system by the Zend-made ones. I'm not really having second thoughts - and I am surely not looking to incite a flame war - but before going onward, I would like to step back for a moment and look whether there is anything speaking against tying a big system closely to Zend Framework. What I like about Zend: As far as I can see, very high quality code Extremely well documented, at least regarding introductions to how things work (Haven't had to use detailed API documentation yet) Backed by a company that has an interest in seeing the framework prosper Well received in the community, has a considerable user base Employs coding standards I like Comes with a full set of unit tests Feels to me like the right choice to make - or at least, one of the right choices - in terms of modern, professional PHP development. I have been thinking about encapsulating and abstracting ZF's functionality into own classes to be able to switch frameworks more easily, but have come to the conclusion that this would not be a good idea because: it would be an unnecessary level of abstraction it could cost performance the big advantage of using a framework - the existence of a developer base that is familiar with its components - would partly be cancelled out therefore, the commitment to ZF would be a deep one. Thus my question: Is there anything substantial speaking against committing to the Zend Framework? Do you have insider knowledge of plans of Zend Inc.'s to go evil in 2011, and make it a closed source library? Is Zend Inc. run by vampires? Are there conceptual flaws in the code base you start to notice when you've transitioned all your projects to it? Is the appearance of quality code an illusion? Does the code look good, but run terribly slow on anything below my quad-core workstation?

    Read the article

  • Dynamically Creating Flex Components In ActionScript

    - by Joshua
    Isn't there some way to re-write the following code, such that I don't need a gigantic switch statement with every conceivable type? Also, if I can replace the switch statement with some way to dynamically create new controls, then I can make the code smaller, more direct, and don't have to anticipate the possibility of custom control types. Before: <?xml version="1.0" encoding="utf-8"?> <mx:WindowedApplication xmlns:mx="http://www.adobe.com/2006/mxml" layout="vertical"> <mx:Script> <![CDATA[ import mx.containers.HBox; import mx.controls.Button; import mx.controls.Label; public function CreateControl(event:Event):void { var Type:String=Edit.text; var NewControl:Object; switch (Type) { case 'mx.controls::Label':NewControl=new Label();break; case 'mx.controls::Button':NewControl=new Button();break; case 'mx.containers::HBox':NewControl=new HBox();break; ... every other type, including unforeseeable custom types } this.addChild(NewControl as DisplayObject); } ]]> </mx:Script> <mx:Label text="Control Type"/> <mx:TextInput id="Edit"/> <mx:Button label="Create" click="CreateControl(event);"/> </mx:WindowedApplication> AFTER: <?xml version="1.0" encoding="utf-8"?> <mx:WindowedApplication xmlns:mx="http://www.adobe.com/2006/mxml" layout="vertical"> <mx:Script> <![CDATA[ import mx.containers.HBox; import mx.controls.Button; import mx.controls.Label; public function CreateControl(event:Event):void { var Type:String=Edit.text; var NewControl:Object= *???*(Type); this.addChild(NewControl as DisplayObject); } ]]> </mx:Script> <mx:Label text="Control Type"/> <mx:TextInput id="Edit"/> <mx:Button label="Create" click="CreateControl(event);"/> </mx:WindowedApplication>

    Read the article

  • SVG via dynamic XML+XSL

    - by Daniel
    This is a bit of a vague notion which I have been running over in my head, and which I am very curious if there is an elegant method of solving. Perhaps it should be taken as a thought experiment. Imagine you have an XML schema with a corresponding XSL transform, which renders the XML as SVG in the browser. The XSL generates SVG with appropriate Javascript handlers that, ultimately, implement editing-like functionality such that properties of the objects or their locations on the SVG canvas can be edited by the user. For instance, an element can be dragged from one location to another. Now, this isn't particularly difficult - the drag/drop example is simply a matter of changing the (x,y) coordinates of the SVG object, or a resize operation would be a simple matter of changing its width or height. But is there an elegant way to have Javascript work on the DOM of the source XML document instead of the rendered SVG? Why, you ask? Well, imagine you have very complex XSL transforms, where the modification of one property results in complex changes to the SVG. You want to maintain simplicity in your Javascript code, but also a simple way to persist the modified XML back to the server. Some possibilities of how this may function: After modification of the source DOM, simply re-run the XSL transform and replace the original. Downside: brute force, potentially expensive operation. Create id/class naming conventions in the source and target XML/SVG so elements can be related back to each other, and do an XSL transform on only a subset of the new DOM. In other words, modify temporary DOM, apply XSL to it, remove changed elements from SVG, and insert the new one. Downside: May not be possible to apply XSL to temporary in-browser DOMs(?). Also, perhaps a bit convoluted or ugly to maintain. I think that it may be possible to come up with a framework that handles the second scenario, but the challenge would be making it lightweight and not heavily tied to the actual XML schema. Any ideas or other possibilities? Or is there maybe an existing method of doing this which I'm not aware of? UPDATE: To clarify, as I mentioned in a comment below, this aids in separating the draw code from the edit code. For a more concrete example of how this is useful, imagine an element which determines how it is drawn dependent on the value of a property of an adjacent element. It's better to condense that logic directly in the draw code instead of also duplicating it in the edit code.

    Read the article

  • Thread sleep and thread join.

    - by Dhruv Gairola
    hi guys, if i put a thread to sleep in a loop, netbeans gives me a caution saying Invoking Thread.sleep in loop can cause performance problems. However, if i were to replace the sleep with join, no such caution is given. Both versions compile and work fine tho. My code is below (check the last few lines for "Thread.sleep() vs t.join()"). public class Test{ //Display a message, preceded by the name of the current thread static void threadMessage(String message) { String threadName = Thread.currentThread().getName(); System.out.format("%s: %s%n", threadName, message); } private static class MessageLoop implements Runnable { public void run() { String importantInfo[] = { "Mares eat oats", "Does eat oats", "Little lambs eat ivy", "A kid will eat ivy too" }; try { for (int i = 0; i < importantInfo.length; i++) { //Pause for 4 seconds Thread.sleep(4000); //Print a message threadMessage(importantInfo[i]); } } catch (InterruptedException e) { threadMessage("I wasn't done!"); } } } public static void main(String args[]) throws InterruptedException { //Delay, in milliseconds before we interrupt MessageLoop //thread (default one hour). long patience = 1000 * 60 * 60; //If command line argument present, gives patience in seconds. if (args.length > 0) { try { patience = Long.parseLong(args[0]) * 1000; } catch (NumberFormatException e) { System.err.println("Argument must be an integer."); System.exit(1); } } threadMessage("Starting MessageLoop thread"); long startTime = System.currentTimeMillis(); Thread t = new Thread(new MessageLoop()); t.start(); threadMessage("Waiting for MessageLoop thread to finish"); //loop until MessageLoop thread exits while (t.isAlive()) { threadMessage("Still waiting..."); //Wait maximum of 1 second for MessageLoop thread to //finish. /*******LOOK HERE**********************/ Thread.sleep(1000);//issues caution unlike t.join(1000) /**************************************/ if (((System.currentTimeMillis() - startTime) > patience) && t.isAlive()) { threadMessage("Tired of waiting!"); t.interrupt(); //Shouldn't be long now -- wait indefinitely t.join(); } } threadMessage("Finally!"); } } As i understand it, join waits for the other thread to complete, but in this case, arent both sleep and join doing the same thing? Then why does netbeans throw the caution?

    Read the article

  • How do I create a safe local development environment?

    - by docgnome
    I'm currently doing web development with another developer on a centralized development server. In the past this has worked alright, as we have two separate projects we are working on and rarely conflict. Now, however, we are adding a third (possible) developer into the mix. This is clearly going to create problems with other developers changes affecting my work and vice versa. To solve this problem, I'm thinking the best solution would be to create a virtual machine to distribute between the developers for local use. The problem I have is when it comes to the database. Given that we all develop on laptops, simply keeping a local copy of the live data is plain stupid. I've considered sanitizing the data, but I can't really figure out how to replace the real data, with data that would be representative of what people actually enter with out repeating the same information over and over again, e.g. everyone's address becomes 123 Testing Lane, Test Town, WA, 99999 or something. Is this really something to be concerned about? Are there tools to help with this sort of thing? I'm using MySQL. Ideally, if I sanitized the db it should be done from a script that I can run regularly. If I do this I'd also need a way to reduce the size of the db itself. (I figure I could select all the records created after x and whack them and all the records in corresponding tables out so that isn't really a big deal.) The second solution I've thought of is to encrypt the hard drive of the vm, but I'm unsure of how practical this is in terms of speed and also in the event of a lost/stolen laptop. If I do this, should the vm hard drive file itself be encrypted or should it be encrypted in the vm? (I'm assuming the latter as it would be portable and doesn't require the devs to have any sort of encryption capability on their OS of choice.) The third is to create a copy of the database for each developer on our development server that they are then responsible to keep the schema in sync with the canonical db by means of migration scripts or what have you. This solution seems to be the simplest but doesn't really scale as more developers are added. How do you deal with this problem?

    Read the article

  • How do I create/use a Fluent NHibernate convention to map UInt32 properties to an SQL Server 2008 da

    - by dommer
    I'm trying to use a convention to map UInt32 properties to a SQL Server 2008 database. I don't seem to be able to create a solution based on existing web sources, due to updates in the way Fluent NHibernate works - i.e. examples are out of date. Here's my code as it currently stands (which, when I try to expose the schema, fails due to SQL Server not supporting UInt32). Apologies for the code being a little long, but I'm not 100% sure what is relevant to the problem, so I'm erring on the side of caution. I think I'll need a relatively comprehensive example, as I don't seem to be able to pull the pieces together into a working solution, at present. FluentConfiguration configuration = Fluently.Configure() .Database(MsSqlConfiguration.MsSql2008 .ConnectionString(connectionString)) .Mappings(mapping => mapping.AutoMappings.Add( AutoMap.AssemblyOf<Product>() .Conventions.Add<UInt32UserTypeConvention>())); configuration.ExposeConfiguration(x => new SchemaExport(x).Create(false, true)); namespace NHibernateTest { public class UInt32UserTypeConvention : UserTypeConvention<UInt32UserType> { // Empty. } } namespace NHibernateTest { public class UInt32UserType : IUserType { // Public properties. public bool IsMutable { get { return false; } } public Type ReturnedType { get { return typeof(UInt32); } } public SqlType[] SqlTypes { get { return new SqlType[] { SqlTypeFactory.Int32 }; } } // Public methods. public object Assemble(object cached, object owner) { return cached; } public object DeepCopy(object value) { return value; } public object Disassemble(object value) { return value; } public new bool Equals(object x, object y) { return (x != null && x.Equals(y)); } public int GetHashCode(object x) { return x.GetHashCode(); } public object NullSafeGet(IDataReader rs, string[] names, object owner) { int? i = (int?)NHibernateUtil.Int32.NullSafeGet(rs, names[0]); return (UInt32?)i; } public void NullSafeSet(IDbCommand cmd, object value, int index) { UInt32? u = (UInt32?)value; int? i = (Int32?)u; NHibernateUtil.Int32.NullSafeSet(cmd, i, index); } public object Replace(object original, object target, object owner) { return original; } } }

    Read the article

  • How to prevent mvn jetty:run from executing test phase?

    - by tputkonen
    We use MySQL in production, and Derby for unit tests. Our pom.xml copies Derby version of persistence.xml before tests, and replaces it with the MySQL version in prepare-package phase: <plugin> <artifactId>maven-antrun-plugin</artifactId> <version>1.3</version> <executions> <execution> <id>copy-test-persistence</id> <phase>process-test-resources</phase> <configuration> <tasks> <!--replace the "proper" persistence.xml with the "test" version--> <copy file="${project.build.testOutputDirectory}/META-INF/persistence.xml.test" tofile="${project.build.outputDirectory}/META-INF/persistence.xml" overwrite="true" verbose="true" failonerror="true" /> </tasks> </configuration> <goals> <goal>run</goal> </goals> </execution> <execution> <id>restore-persistence</id> <phase>prepare-package</phase> <configuration> <tasks> <!--restore the "proper" persistence.xml--> <copy file="${project.build.outputDirectory}/META-INF/persistence.xml.production" tofile="${project.build.outputDirectory}/META-INF/persistence.xml" overwrite="true" verbose="true" failonerror="true" /> </tasks> </configuration> <goals> <goal>run</goal> </goals> </execution> </executions> </plugin> The problem is, that if I execute mvn jetty:run it will execute the test persistence.xml file copy task before starting jetty. I want it to be run using the deployment version. How can I fix this?

    Read the article

  • How do I hide the text links over a toggleable horizontal list with background images.

    - by Sivakanesh
    I'm trying to create a UL/LI horizontal list with background images only, with no text link visible. The reason for this is so that when I over over a list item, the background would rollover and when I click on it the current item would toggle. basically it is a horizontal menu with background images that can be toggled; mimicking the job of a radio button. I have done it like this; <div id="options"> <ul id="list"> <li class="active"><a href="#" class="option1 active" id="link1"><span>XXXXX</span></a></li> <li><a href="#" class="option2" id="link2"><span>XXXXX</span></a></li> <li><a href="#" class="option3" id="link3"><span>XXXXX</span></a></li> </ul> </div> The CSS for option1, option2 and option3 simply define the background image. #options LI{list-style-type: none; display : inline} a.option1{ background:url('../images/option1.png') no-repeat;} a.option2{ background:url('../images/option2.png') no-repeat;} a.option3{ background:url('../images/option3.png') no-repeat;} a.option1, a.option2, a.option3{ background-position:top; display:inline; width:230px; height:40px; } And the hover & active css part simply sets the background position like so- a.option1:hover, a.option2:hover, a.option3:hover{ background-position:bottom; } a.active{ background-position:bottom !important; } This works fine, however on top of the background I get the words "XXXXX" as text links and I'm struggling to hide them. They are interfering with the hover action and preventing rollover (even if I replace XXXXX with a period or something short). I can't just remove the text from the link as it would hide the whole LI element. I have tried to use display:none; or text-indent:-999px but then the whole UI element becomes invisible. I can't understand what I'm doing wrong. Are you able to help? Thanks

    Read the article

  • jQuery: Giving each matched element an unique ID

    - by AnGafraidh
    I am writing an 'inline translator' application to be used with a cloud computing platform to extend non-supported languages. The majority of this uses jQuery to find the text value, replace it with the translation, then append the element with a span tag that has an unique ID, to be used elsewhere within the application. The problem arises however, when there are more than one element, say , that have the exact same value to be translated (matched elements). What happens in the function in question is that it puts all matched elements in the same span, taking the second, third, fourth, etc. out of their parent tags. My code is pretty much like this example: <script src='jquery-1.4.2.js'></script> <script> jQuery.noConflict(); var uniqueID='asdfjkl'; jQuery(window).ready(function() { var myQ1 = jQuery("input[id~=test1]"); myClone=myQ1.clone(); myClone.val('Replaced this button'); myQ1.replaceWith('<span id='+uniqueID+'></span>'); jQuery('#'+uniqueID).append(myClone); }); </script> <table> <tr><td> <input id='test1' type='button' value="I'm a button!"></input> &nbsp; <input id='test2' type='button' value="And so am I"></input> </tr></td> <tr><td> <input id='test1' type='button' value="I'm a button!"></input> </tr></td> </table> As a workaround, I've experimented with using a loop to create a class for each span, rising in increment until jQuery("input[id~=test1]").length, but I can't seem to get anything I do to work. Is there any way to give each matched element an unique ID? My fluency in jQuery is being put to the test! Thanks for any help in advance. Aaron

    Read the article

  • [C++] std::string manipulation: whitespace, "newline escapes '\'" and comments #

    - by rubenvb
    Kind of looking for affirmation here. I have some hand-written code, which I'm not shy to say I'm proud of, which reads a file, removes leading whitespace, processes newline escapes '\' and removes comments starting with #. It also removes all empty lines (also whitespace-only ones). Any thoughts/recommendations? I could probably replace some std::cout's with std::runtime_errors... but that's not a priority here :) const int RecipeReader::readRecipe() { ifstream is_recipe(s_buffer.c_str()); if (!is_recipe) cout << "unable to open file" << endl; while (getline(is_recipe, s_buffer)) { // whitespace+comment removeLeadingWhitespace(s_buffer); processComment(s_buffer); // newline escapes + append all subsequent lines with '\' processNewlineEscapes(s_buffer, is_recipe); // store the real text line if (!s_buffer.empty()) v_s_recipe.push_back(s_buffer); s_buffer.clear(); } is_recipe.close(); return 0; } void RecipeReader::processNewlineEscapes(string &s_string, ifstream &is_stream) { string s_temp; size_t sz_index = s_string.find_first_of("\\"); while (sz_index <= s_string.length()) { if (getline(is_stream,s_temp)) { removeLeadingWhitespace(s_temp); processComment(s_temp); s_string = s_string.substr(0,sz_index-1) + " " + s_temp; } else cout << "Error: newline escape '\' found at EOF" << endl; sz_index = s_string.find_first_of("\\"); } } void RecipeReader::processComment(string &s_string) { size_t sz_index = s_string.find_first_of("#"); s_string = s_string.substr(0,sz_index); } void RecipeReader::removeLeadingWhitespace(string &s_string) { const size_t sz_length = s_string.size(); size_t sz_index = s_string.find_first_not_of(" \t"); if (sz_index <= sz_length) s_string = s_string.substr(sz_index); else if ((sz_index > sz_length) && (sz_length != 0)) // "empty" lines with only whitespace s_string.clear(); } Some extra info: the first s_buffer passed to the ifstream contains the filename, std::string s_buffer is a class data member, so is std::vector v_s_recipe. Any comment is welcome :)

    Read the article

  • ZF Autoloader to load ancestor and requested class

    - by Pekka
    I am integrating Zend Framework into an existing application. I want to switch the application over to Zend's autoloading mechanism to replace dozens of include() statements. I have a specific requirement for the autoloading mechanism, though. Allow me to elaborate. The existing application uses a core library (independent from ZF), for example: /Core/Library/authentication.php /Core/Library/translation.php /Core/Library/messages.php this core library is to remain untouched at all times and serves a number of applications. The library contains classes like class ancestor_authentication { ... } class ancestor_translation { ... } class ancestor_messages { ... } in the application, there is also a Library directory: /App/Library/authentication.php /App/Library/translation.php /App/Library/messages.php these includes extend the ancestor classes and are the ones that actually get instantiated in the application. class authentication extends ancestor_authentication { } class translation extends ancestor_translation { } class messages extends ancestor_messages { } usually, these class definitions are empty. They simply extend their ancestors and provide the class name to instantiate. $authentication = new authentication(); The purpose of this solution is to be able to easily customize aspects of the application without having to patch the core libraries. Now, the autoloader I need would have to be aware of this structure. When an object of the class authentication is requested, the autoloader would have to: 1. load /Core/Library/authentication.php 2. load /App/Library/authentication.php My current approach would be creating a custom function, and binding that to Zend_Loader_Autoloader for a specific namespace prefix. Is there already a way to do this in Zend that I am overlooking? The accepted answer in this question kind of implies there is, but that may be just a bad choice of wording. Are there extensions to the Zend Autoloader that do this? Can you - I am new to ZF - think of an elegant way, conforming with the spirit of the framework, of extending the Autoloader with this functionality? I'm not necessary looking for a ready-made implementation, some pointers (This should be an extension to the xyz method that you would call like this...) would already be enough.

    Read the article

  • Ping remote server and wait to get data

    - by infinity
    Hi I'm building my first application for android and I've reached a point where I can't find a solution even have no idea what to search for in Google. So the problem: I am pinging a remote server with GET request through the application passing some parameters like file_id. Then the server gives back confirmation if the file exists or error otherwise, both in plain text. The error string is $$$ERROR$$$. Actually the confirmation is JSON string that holds the path to the file. If the file doesn't exists on the server it generated the error message and start downloading the file and processing it which normally takes 10-30 seconds. What would be the best way to check if the file is ready for download? I have DownloadFile class that extends AsyncTask but before I reach the point to download the file I need the URL which is dependant on the previous request which is in the main class in the UI thread. Here is some code: public class MainActivity extends Activity { private String getInfo() { // Create a new HttpClient and Post Header HttpClient httpClient = new DefaultHttpClient(); HttpGet httpPost = new HttpGet(infoUrl); StringBuilder sb = null; String data; JSONObject jObject = null; try { HttpResponse response = httpClient.execute(httpPost); // This might be equal "$$$ERROR$$$" if no file exists sb = inputStreamToString(response.getEntity().getContent()); } catch(ClientProtocolException e) { // TODO Auto-generated catch block Log.v("Error: pushItem ClientProtocolException: ", e.toString()); } catch (IOException e) { // TODO Auto-generated catch block Log.v("Error: pushItem IOException: ", e.toString()); } // Clean the data to be complaint JSON format data = sb.toString().replace("info = ", ""); try { jObject = new JSONObject(data); data = jObject.getString("h"); fileTitle = jObject.getString("title"); } catch (JSONException e) { // TODO Auto-generated catch block e.printStackTrace(); } downloadUrl = String.format(downloadUrl, fileId, data); return downloadUrl; } } So my idea was to get the content and if equal to $$$ERROR$$$ go into loop until JSON data is passed but I guess there is better solution. Note: I don't have control over the server output so have to deal with what I have.

    Read the article

< Previous Page | 275 276 277 278 279 280 281 282 283 284 285 286  | Next Page >